Persistence of Xanthomonas campestris pv. campestris in Field Soil in Central Europe
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Site and Sampling
2.2. Analysis of Soil Organic Matter
2.3. DNA Extraction
2.4. Conventional PCR Detection of the hrpF Gene
2.5. Nested Real-Time PCR Detection of the Zur Gene
2.5.1. Pre-Amplification
2.5.2. Quantitative Real-Time PCR
2.6. Real-Time PCR Standards Preparation
2.7. Detection Limits and Sensitivity
2.8. Data Analysis
2.8.1. Inverse Estimation of Xcc from Nested Real-Time PCR Ct Values
2.8.2. Most Probable Numbers (MPNs)
2.8.3. Weather Data
3. Results
3.1. Detection Limits and Sensitivity
3.2. Estimation of Xcc by Inverse Estimation Using Nested Real-Time PCR Ct Values
3.3. Most Probable Numbers (MPNs)
3.4. Associations between Estimated Numbers of Xcc and Weather Variables
3.5. Soil Organic Matter Content
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Nested Real-Time PCR (Zur) and Standard PCR (hrpF) Results | ||||||||
Sampling/Sample Location | I. | II. | III. | IV. | ||||
12 December 2016 | 7 February 2017 | 10 April 2017 | 16 June 2017 | |||||
Zur(CFU·g−1) | hrpF | Zur(CFU·g−1) | hrpF | Zur(CFU·g−1) | hrpF | Zur(CFU·g−1) | hrpF | |
1 | 2.08 × 103 | + | 4.05 × 103 | + | 7.19 × 102 | + | 0.00 × 100 | - |
2 | 4.67 × 102 | - | 1.06 × 103 | - | 0.00 × 100 | - | 3.68 × 103 | - |
3 | 2.52 × 102 | - | 1.47 × 103 | + | 3.39 × 102 | + | 4.34 × 102 | - |
4 | 2.46 × 104 | + | 2.50 × 103 | + | 2.49 × 103 | + | 3.00 × 105 | + |
5 | 8.02 × 102 | - | 1.01 × 103 | - | 5.35 × 102 | + | 2.55 × 102 | - |
6 | 1.52 × 104 | + | 3.70 × 105 | + | 1.62 × 103 | + | 1.27 × 102 | - |
7 | 3.95 × 103 | + | 4.04 × 104 | + | 9.63 × 102 | - | 1.09 × 103 | - |
8 | 1.40 × 102 | - | 1.88 × 103 | - | 0.00 × 100 | - | 3.46 × 102 | - |
9 | 3.20 × 102 | - | 3.36 × 102 | - | 0.00 × 100 | - | 7.90 × 103 | + |
V. | VI. | VII. | VIII. | |||||
17 August 2017 | 16 October 2017 | 23 November 2017 | 22 January 2018 | |||||
1 | 0.00 × 100 | - | 0.00 × 100 | - | 4.55 × 103 | - | 4.76 × 103 | - |
2 | 0.00 × 100 | - | 1.04 × 102 | - | 3.07 × 103 | - | 4.07 × 103 | - |
3 | 9.31 × 102 | - | 0.00 × 100 | - | 2.96 × 103 | - | 1.44 × 103 | - |
4 | 8.08 × 103 | + | 1.76 × 103 | - | 1.32 × 104 | - | 3.31 × 103 | - |
5 | 6.41 × 102 | - | 0.00 × 100 | - | 7.48 × 103 | - | 3.14 × 103 | - |
6 | 0.00 × 100 | - | 0.00 × 100 | - | 4.31 × 102 | - | 2.30 × 103 | - |
7 | 0.00 × 100 | - | 0.00 × 100 | - | 1.00 × 103 | - | 4.69 × 103 | - |
8 | 0.00 × 100 | - | 0.00 × 100 | - | 1.62 × 102 | - | 3.18 × 103 | - |
9 | 1.15 × 104 | + | 0.00 × 100 | - | 2.32 × 105 | - | 2.45 × 103 | + |
IX. | X. | XI. | XII. | |||||
23 March 2018 | 21 May 2018 | 24 July 2018 | 22 September 2018 | |||||
1 | 1.28 × 103 | - | 2.52 × 102 | - | 0.00 × 100 | - | 2.22 × 103 | - |
2 | 1.73 × 103 | - | 5.58 × 102 | - | 2.99 × 102 | - | 1.51 × 102 | + |
3 | 1.67 × 103 | - | 0.00 × 100 | - | 2.42 × 102 | + | 1.09 × 102 | - |
4 | 1.64 × 103 | - | 6.09 × 102 | - | 1.15 × 102 | - | 4.77 × 102 | - |
5 | 2.07 × 103 | - | 4.33 × 102 | - | 2.70 × 102 | - | 1.31 × 103 | - |
6 | 1.52 × 103 | - | 1.31 × 102 | - | 0.00 × 100 | - | 8.32 × 103 | - |
7 | 9.49 × 102 | - | 4.11 × 102 | - | 0.00 × 100 | - | 2.24 × 103 | + |
8 | 1.10 × 103 | - | 2.69 × 102 | - | 9.31 × 102 | - | 7.84 × 102 | + |
9 | 1.03 × 103 | - | 1.18 × 102 | - | 0.00 × 100 | - | 2.92 × 103 | + |
Soil Oxidizable Carbon (SOC) and Soil Organic Matter (SOM) | ||||||||
Sampling/Sample Location | I. | II. | III. | IV. | ||||
12 December 2016 | 7 February 2017 | 10 April 2017 | 16 June 2017 | |||||
SOC (%) | SOM (%) | SOC (%) | SOM (%) | SOC (%) | SOM (%) | SOC (%) | SOM (%) | |
1 | 1.135 | 1.955 | 1.165 | 2.005 | 1.165 | 2.005 | 1.010 | 1.750 |
2 | 1.135 | 1.955 | 1.240 | 2.135 | 1.240 | 2.135 | 1.090 | 1.875 |
3 | 1.090 | 1.875 | 1.010 | 1.745 | 1.010 | 1.745 | 0.845 | 1.455 |
4 | 0.825 | 1.420 | 1.125 | 1.940 | 1.125 | 1.940 | 0.940 | 1.615 |
5 | 0.885 | 1.525 | 1.035 | 1.785 | 1.035 | 1.785 | 0.960 | 1.650 |
6 | 0.830 | 1.435 | 1.265 | 2.175 | 1.265 | 2.175 | 0.980 | 1.680 |
7 | 1.035 | 1.785 | 1.045 | 1.795 | 1.045 | 1.795 | 1.090 | 1.875 |
8 | 0.965 | 1.670 | 1.015 | 1.745 | 1.015 | 1.745 | 0.940 | 1.615 |
9 | 0.965 | 1.670 | 1.015 | 1.745 | 1.015 | 1.745 | 0.900 | 1.550 |
V. | VI. | VII. | VIII. | |||||
17 August 2017 | 16 October 2017 | 23 November 2017 | 22 January 2018 | |||||
1 | 1.005 | 1.725 | 1.030 | 1.780 | 0.995 | 1.715 | 1.110 | 1.905 |
2 | 1.305 | 2.250 | 1.260 | 2.165 | 1.050 | 1.810 | 1.110 | 1.905 |
3 | 1.005 | 1.735 | 0.830 | 1.420 | 0.770 | 1.325 | 1.050 | 1.810 |
4 | 1.005 | 1.735 | 1.350 | 2.330 | 1.130 | 1.940 | 1.050 | 1.810 |
5 | 1.230 | 2.125 | 1.070 | 1.840 | 1.070 | 1.845 | 1.050 | 1.810 |
6 | 1.120 | 1.930 | 1.070 | 1.840 | 0.995 | 1.715 | 1.090 | 1.875 |
7 | 1.040 | 1.800 | 0.995 | 1.715 | 0.930 | 1.605 | 0.940 | 1.615 |
8 | 0.855 | 1.475 | 0.880 | 1.510 | 0.900 | 1.550 | 0.920 | 1.585 |
9 | 0.910 | 1.570 | 0.900 | 1.550 | 0.900 | 1.550 | 0.980 | 1.680 |
IX. | X. | XI. | XII. | |||||
23 March 2018 | 21 May 2018 | 24 July 2018 | 22 September 2018 | |||||
1 | 0.990 | 1.715 | 1.010 | 1.745 | 0.900 | 1.550 | 0.885 | 1.525 |
2 | 1.010 | 1.750 | 0.920 | 1.585 | 0.750 | 1.290 | 0.865 | 1.495 |
3 | 0.865 | 1.485 | 0.880 | 1.520 | 1.015 | 1.745 | 1.110 | 1.905 |
4 | 0.900 | 1.550 | 0.990 | 1.715 | 0.830 | 1.420 | 0.865 | 1.485 |
5 | 0.900 | 1.550 | 0.970 | 1.680 | 1.050 | 1.810 | 1.050 | 1.810 |
6 | 0.935 | 1.615 | 0.970 | 1.680 | 0.960 | 1.650 | 0.900 | 1.550 |
7 | 0.900 | 1.550 | 0.900 | 1.550 | 1.050 | 1.810 | 1.030 | 1.780 |
8 | 0.880 | 1.520 | 0.900 | 1.550 | 0.880 | 1.520 | 0.960 | 1.650 |
9 | 0.900 | 1.550 | 0.900 | 1.550 | 1.050 | 1.810 | 1.110 | 1.905 |
References
- Williams, P.H. Black rot: A continuing threat to world crucifers. Plant Dis. 1980, 64, 736–742. [Google Scholar] [CrossRef]
- Agrios, G.N. Plant Pathology, 5th ed.; Department of Plant Pathology, University of Florida: Gainesville, FL, USA, 2005; pp. 653–654. [Google Scholar]
- Alvarez, A.M. Black rot of crucifers. In Mechanisms of Resistance to Plant Diseases; Springer: Dordrecht, The Netherlands, 2000; pp. 21–52. [Google Scholar]
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.A.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Vicente, J.G.; Holub, E.B. Xanthomonas campestris pv. campestris (cause of black rot of crucifers) in the genomic era is still a worldwide threat to brassica crops. Mol. Plant Pathol. 2013, 14, 2–18. [Google Scholar] [CrossRef]
- Cook, A.A.; Walker, J.C.; Larson, R.H. Studies on the disease cycle of black rot of crucifers. Phytopathology 1952, 42, 162. [Google Scholar]
- Schaad, N.W.; Sitterly, W.R.; Humaydan, H. Relationship of incidence of seedborne Xanthomonas campestris to black rot of crucifers. Plant Dis. 1980, 64, 91. [Google Scholar] [CrossRef][Green Version]
- Schaad, N.W.; Dianese, J.C. Cruciferous weeds as sources of inoculum of Xanthomonas campestris in black rot of crucifers. Phytopathology 1981, 71, 1215–1220. [Google Scholar] [CrossRef]
- Schaad, N.W.; White, W.C. Survival of Xanthomonas campestris in soil. Phytopathology 1974, 64, 1518–1520. [Google Scholar] [CrossRef]
- Alvarez, A.M.; Cho, J.J. Black rot of cabbage in Hawaii: Inoculum source and disease incidence. Phytopathology 1978, 68, 1456–1459. [Google Scholar] [CrossRef][Green Version]
- Köhl, J.; Vlaswinkel, M.; Groenenboom-de Haas, B.H.; Kastelein, P.; Van Hoof, R.A.; Van der Wolf, J.M.; Krijger, M. Survival of pathogens of Brussels sprouts (Brassica oleracea Gemmifera Group) in crop residues. Plant Pathol. 2011, 60, 661–670. [Google Scholar] [CrossRef]
- Schultz, T.; Gabrielson, R.L. Xanthomonas campestris pv. campestris in Western Washington crucifer seed fields: Occurrence and survival. Phytopathology 1986, 76, 1306–1309. [Google Scholar] [CrossRef]
- Dzhalilov, F.S.; Tiwari, R.D. Soil and cabbage plant debris as infection sources of black rot. Arch. Phytopathol. Pflanzenschutz 1995, 29, 383–386. [Google Scholar] [CrossRef]
- Zhao, Y.; Damicone, J.P.; Bender, C.L. Detection, survival, and sources of inoculum for bacterial diseases of leafy crucifers in Oklahoma. Plant. Dis. 2002, 86, 883–888. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Silva, J.C.; Silva Júnior, T.A.F.; Soman, J.M.; Tomasini, T.D.; Sartori, M.M.P.; Maringoni, A.C. Survival of Xanthomonas campestris pv. campestris in the phyllosphere and rhizosphere of weeds. Plant. Pathol. 2017, 66, 1517–1526. [Google Scholar] [CrossRef]
- Koenraadt, H.; Van Bilsen, J.G.P.M.; Roberts, S.J. Comparative test of four semi-selective agar media for the detection of Xanthomonas campestris pv. campestris in brassica seeds. Seed Sci. Technol. 2005, 33, 115–125. [Google Scholar] [CrossRef]
- Berg, T.; Tesoriero, L.; Hailstones, D.L. PCR-based detection of Xanthomonas campestris pathovars in Brassica seed. Plant. Pathol. 2005, 54, 416–427. [Google Scholar] [CrossRef]
- Eichmeier, A.; Penazova, E.; Pokluda, R.; Vicente, J.G. Detection of Xanthomonas campestris pv. campestris through a real-time PCR assay targeting the Zur gene and comparison with detection targeting the hrpF gene. Eur. J. Plant. Pathol. 2019, 155, 891–902. [Google Scholar] [CrossRef]
- Vicente, J.G.; Conway, J.; Roberts, S.J.; Taylor, J.D. Identification and origin of Xanthomonas campestris pv. campestris races and related pathovars. Phytopathology 2001, 91, 492–499. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Walkley, A.; Black, I.A. An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Sci. 1934, 37, 29–38. [Google Scholar] [CrossRef]
- Klika, J.; Novak, V.; Gregor, A. Exercise on Phytocenology, Ecology, Climatology and soil Science; ČSAV: Prague, Czech Republic, 1954. [Google Scholar]
- Jandak, J.; Pokorny, E.; Prax, A. Půdoznalství, 3rd ed.; Mendelova Univerzita v Brně: Brno, Czech Republic, 2010. [Google Scholar]
- Zaujec, A.; Chlpik, J.; Nadassky, J.; Szombathova, N.; Tobiasova, E. Pedológia a Základy Geológie; Slovak University of Agriculture: Nitra, Slovakia, 2009. [Google Scholar]
- Eichmeier, A.; Baranek, M.; Pidra, M. Analysis of genetic diversity and phylogeny of partial coat protein domain in Czech and Italian GFLV isolates. Plant. Prot. Sci. 2011, 46, 145–148. [Google Scholar] [CrossRef][Green Version]
- Eichmeier, A.; Cechova, J.; Penazova, E. Genetic diversity of partial hrpF and Zur genes in populations of Xanthomonas campestris pv. campestris in Brassica oleracea convar. capitata in the Czech Republic. Acta Hortic. 2015, 1105, 180–188. [Google Scholar] [CrossRef]
- Cochran, W.G. Estimation of bacterial densities by means of the “most probable number”. Biometrics 1950, 6, 105–116. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, K.M.; Johnsen, P.J.; Bensasson, D.; Daffonchio, D. Release and persistence of extracellular DNA in the environment. Environ. Biosaf. Res. 2007, 6, 37–53. [Google Scholar] [CrossRef] [PubMed][Green Version]
- England, L.S.; Holmes, S.B.; Trevors, J.T. Persistence of viruses and DNA in soil. World J. Microbiol. Biotechnol. 1997, 14, 163–169. [Google Scholar] [CrossRef]
- Romanowski, G.; Lorenz, M.G.; Sayler, G.; Wackernagel, W. Persistence of free plasmid DNA in soil monitored by various methods, including a transformation assay. Appl. Environ. Microbiol. 1992, 58, 3012–3019. [Google Scholar] [CrossRef][Green Version]
- Wang, F.; Che, R.; Xu, Z.; Wang, Y.; Cui, X. Assessing soil extracellular DNA decomposition dynamics through plasmid amendment coupled with real-time PCR. J. Soils Sediments 2019, 19, 91–96. [Google Scholar] [CrossRef]
- Kocks, C.G.; Ruissen, M.A.; Zadoks, J.C.; Duijkers, M.G. Survival and extinction of Xanthomonas campestris pv. campestris in soil. Eur. J. Plant. Pathol. 1998, 104, 911–923. [Google Scholar] [CrossRef]
- Júnior, T.S.; Silva, J.C.; Gonçalves, R.M.; Soman, J.M.; Passos, J.R.; Maringoni, A.C. Survival of Xanthomonas campestris pv. campestris associated with soil and cauliflower crop debris under Brazilian conditions. Eur. J. Plant. Pathol. 2020, 156, 399–411. [Google Scholar] [CrossRef]
- Roberts, S.J. Personal Communication; Plant Health Solutions Ltd.: Warwick, UK, 2020. [Google Scholar]
- Pinches, A.; Pallent, L.J. Rate and yield relationships in the production of xanthan gum by batch fermentations using complex and chemically defined growth media. Biotechnol. Bioeng. 1986, 28, 1484–1496. [Google Scholar] [CrossRef]
- Max, N.; Wolf, K.; Spike, B.; Thiel, E.; Keilholz, U. Nested quantitative real time PCR for detection of occult tumor cells. In Minimal Residual Disease in Melanoma; Springer: Berlin/Heidelberg, Germany, 2001; pp. 25–31. [Google Scholar]
- Takahashi, T.; Nakayama, T. Novel technique of quantitative nested real-time PCR assay for Mycobacterium tuberculosis DNA. J. Clin. Microbiol. 2006, 44, 1029–1039. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Costa, J.; Mafra, I.; Kuchta, T.; Oliveira, M.B.P. Single-tube nested real-time PCR as a new highly sensitive approach to trace hazelnut. J. Agric. Food Chem. 2012, 60, 8103–8110. [Google Scholar] [CrossRef]
- Zhang, Y.; Dai, X.; Ren, Z.; Lin, H.; Cao, W.; Ye, X. A novel nested real-time polymerase chain reaction for Treponema pallidum DNA in syphilis biospecimens. Sex. Transm. Dis. 2019, 46, 41–46. [Google Scholar] [CrossRef] [PubMed]
- Ridout, M.S. Three-stage designs for seed testing experiments. J. R Stat. Soc. Ser. C—Appl. Stat. 1995, 44, 153–162. [Google Scholar] [CrossRef]
Primer | Sequence (5′–3′) | Targeted Gene | Product (bp) |
---|---|---|---|
DLH120 [17] | CCGTAGCACTTAGTGCAATG | Hypersensitivity Reaction and Pathogenicity gene (hrpF) | 619 |
DLH125 [17] | GCATTTCCATCGGTCACGATTG | ||
Zur1-CAE-rev [25] | AGGCGACGAAGGCATTGA | Zinc Uptake Regulator gene (Zur) | 305 |
Zur1-EAC-fwd [25] | AACGCACGACCAGGAACA | ||
Zur2-EAC-fwd [18] | CAAACCGGTCAAGGCCTA | Zinc Uptake Regulator gene (Zur) | 142 |
Zur1-CAE-rev [25] | AGGCGACGAAGGCATTGA | ||
Zur1-TP [18] | FAM-CGCTGGATTTTTTGATGGBHQ |
r | P | |
---|---|---|
IE from Ct | ||
Precipitation (28 days) | −0.49 | 0.106 |
Mean Air Temp. (7 days) | −0.48 | 0.118 |
Min Air Temp. (14 days) | −0.45 | 0.145 |
Soil Temp. at 20 cm (7 days) | −0.43 | 0.159 |
Relat. Humidity (56 days) | 0.43 | 0.159 |
MPN Real-Time PCR | ||
Max. Air Temp. (7 days) | −0.69 | 0.012 |
Soil Temp. at 20 cm (7 days) | −0.69 | 0.012 |
Min. Ground Temp. (14 days) | −0.69 | 0.012 |
Mean Air Temp. (28 days) | −0.69 | 0.012 |
Max. Air Temp. (28 days) | −0.69 | 0.012 |
MPN hrpF | ||
Precipitation (14 days) | −0.41 | 0.182 |
Precipitation (7 days) | 0.32 | 0.306 |
Sunshine hours (14 days) | 0.27 | 0.402 |
Precipitation (56 days) | −0.18 | 0.58 |
Mean Air Temp. (7 days) | −0.15 | 0.643 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gazdik, F.; Magnus, S.; Roberts, S.J.; Baranski, R.; Cechova, J.; Pokluda, R.; Eichmeier, A.; Grzebelus, D.; Baranek, M. Persistence of Xanthomonas campestris pv. campestris in Field Soil in Central Europe. Microorganisms 2021, 9, 591. https://doi.org/10.3390/microorganisms9030591
Gazdik F, Magnus S, Roberts SJ, Baranski R, Cechova J, Pokluda R, Eichmeier A, Grzebelus D, Baranek M. Persistence of Xanthomonas campestris pv. campestris in Field Soil in Central Europe. Microorganisms. 2021; 9(3):591. https://doi.org/10.3390/microorganisms9030591
Chicago/Turabian StyleGazdik, Filip, Samuel Magnus, Steven J. Roberts, Rafal Baranski, Jana Cechova, Robert Pokluda, Ales Eichmeier, Dariusz Grzebelus, and Miroslav Baranek. 2021. "Persistence of Xanthomonas campestris pv. campestris in Field Soil in Central Europe" Microorganisms 9, no. 3: 591. https://doi.org/10.3390/microorganisms9030591