DNA Metabarcoding for the Characterization of Terrestrial Microbiota—Pitfalls and Solutions
Abstract
1. Introduction
2. DNA Extraction Procedure
Kit Manufacturer or Method | Sample Type | Homogenization and Cell Lysis | DNA Purification and Concentration | Relative Cost Per Sample [Low ($) to High ($$$)] |
---|---|---|---|---|
DNeasy PowerSoil Qiagen, USA | Soil, compost, manure, plant material | Bead beating + chemical lysis | Silica membrane binding | $$$ |
FastDNA Kit for Soil MP Biomedicals, USA | Soil, compost, manure | Bead beating + chemical lysis | Silica membrane binding | $$$ |
Plant DNeasy Mini kit Qiagen, USA | Plant and fungal tissue. | Mortar/pestel or TissueLyzer + chemical lysis | Silica membrane binding | $$ |
Quick-DNA Fecal/Soil Microbe Miniprep Kit Zymo Research, Germany | Soil, biofilm, animal and human samples | Bead beating + chemical lysis | Silica membrane binding | $$ |
Phenol-chloroform-isoamyl alcohol-Extraction [22] | Soil | Bead beating + CTAB a | PEG b 6000 + ethanol precipitation | $ |
Phenol-chloroform-isoamyl alcohol-Extraction modified [31] | Soil | Bead beating + CTAB a + PVP c | PEG b 6000 + ethanol precipitation | $ |
Phenol-chloroform-isoamyl alcohol-Extraction modified [32] | Soil | Bead beating + CTAB a + PVPP d | Isopropanol precipitation | $$ |
Sodiumphosphate extraction [34] | Sediments | Bead beating + Sodiumphosphate buffer + PVP c | Silica membrane binding + GuaHCL e precipitation | $$ |
3. Amplicon Library Preparation
3.1. DNA Quality and Quantity
3.2. Amplification of a Target Marker Gene
3.2.1. Identification of Prokaryotes from Environmental Samples
3.2.2. Identification of Fungi from Environmental Samples
3.2.3. Identification of Protists from Environmental Samples
3.3. Further Recommendations for Library Preparation
4. Bioinformatic Processing
4.1. Pre-Processing of the Metabarcoding Dataset
4.2. Taxonomic Profiling
5. Importance of Metadata Standards and Archiving Practices
6. Future Perspective and Challenges
Author Contributions
Funding
Conflicts of Interest
References
- Nannipieri, P.; Ascher-Jenull, J.; Ceccherini, M.T.; Pietramellara, G.; Renella, G.; Schloter, M. Beyond microbial diversity for predicting soil functions: A mini review. Pedosphere 2020, 30, 5–17. [Google Scholar] [CrossRef]
- Francioli, D.; Schulz, E.; Buscot, F.; Reitz, T. Dynamics of Soil Bacterial Communities Over a Vegetation Season Relate to Both Soil Nutrient Status and Plant Growth Phenology. Microb. Ecol. 2018, 75, 216–227. [Google Scholar] [CrossRef]
- Francioli, D.; Schulz, E.; Purahong, W.; Buscot, F.; Reitz, T. Reinoculation elucidates mechanisms of bacterial community assembly in soil and reveals undetected microbes. Biol. Fertil. Soils 2016, 52, 1073–1083. [Google Scholar] [CrossRef]
- Cortois, R.; De Deyn, G.B. The curse of the black box. Plant Soil 2012, 350, 27–33. [Google Scholar] [CrossRef]
- Delmont, T.O.; Francioli, D.; Jacquesson, S.; Laoudi, S.; Mathieu, A.; Nesme, J.; Ceccherini, M.T.; Nannipieri, P.; Simonet, P.; Vogel, T.M. Microbial community development and unseen diversity recovery in inoculated sterile soil. Biol. Fertil. Soils 2014, 50, 1069–1076. [Google Scholar] [CrossRef]
- Caron, D.A.; Worden, A.Z.; Countway, P.D.; Demir, E.; Heidelberg, K.B. Protists are microbes too: A perspective. ISME J. 2009, 3, 4–12. [Google Scholar] [CrossRef] [PubMed]
- Geisen, S.; Mitchell, E.A.D.; Adl, S.; Bonkowski, M.; Dunthorn, M.; Ekelund, F.; Fernández, L.D.; Jousset, A.; Krashevska, V.; Singer, D.; et al. Soil protists: A fertile frontier in soil biology research. FEMS Microbiol. Rev. 2018, 42, 293–323. [Google Scholar] [CrossRef] [PubMed]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Brochmann, C.; Willerslev, E. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol. 2012, 21, 2045–2050. [Google Scholar] [CrossRef]
- Giampaoli, S.; Berti, A.; Di Maggio, R.M.; Pilli, E.; Valentini, A.; Valeriani, F.; Gianfranceschi, G.; Barni, F.; Ripani, L.; Romano Spica, V. The environmental biological signature: NGS profiling for forensic comparison of soils. Forensic Sci. Int. 2014, 240, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Szelecz, I.; Lösch, S.; Seppey, C.V.W.; Lara, E.; Singer, D.; Sorge, F.; Tschui, J.; Perotti, M.A.; Mitchell, E.A.D. Comparative analysis of bones, mites, soil chemistry, nematodes and soil micro-eukaryotes from a suspected homicide to estimate the post-mortem interval. Sci. Rep. 2018, 8, 25. [Google Scholar] [CrossRef] [PubMed]
- van der Heyde, M.; Bunce, M.; Dixon, K.; Wardell-Johnson, G.; White, N.E.; Nevill, P. Changes in soil microbial communities in post mine ecological restoration: Implications for monitoring using high throughput DNA sequencing. Sci. Total Environ. 2020, 749, 142262. [Google Scholar] [CrossRef] [PubMed]
- Vischetti, C.; Casucci, C.; De Bernardi, A.; Monaci, E.; Tiano, L.; Marcheggiani, F.; Ciani, M.; Comitini, F.; Marini, E.; Taskin, E.; et al. Sub-Lethal Effects of Pesticides on the DNA of Soil Organisms as Early Ecotoxicological Biomarkers. Front. Microbiol. 2020, 11. [Google Scholar] [CrossRef] [PubMed]
- Inderbitzin, P.; Robbertse, B.; Schoch, C.L. Species Identification in Plant-Associated Prokaryotes and Fungi Using DNA. Phytobiomes J. 2020, 4, 103–114. [Google Scholar] [CrossRef]
- Poretsky, R.; Rodriguez-R, L.M.; Luo, C.; Tsementzi, D.; Konstantinidis, K.T. Strengths and Limitations of 16S rRNA Gene Amplicon Sequencing in Revealing Temporal Microbial Community Dynamics. PLoS ONE 2014, 9, e93827. [Google Scholar] [CrossRef] [PubMed]
- Ruppert, K.M.; Kline, R.J.; Rahman, M.S. Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA. Glob. Ecol. Conserv. 2019, 17, e00547. [Google Scholar] [CrossRef]
- van Ruijven, J.; Ampt, E.; Francioli, D.; Mommer, L. Do soil-borne fungal pathogens mediate plant diversity–productivity relationships? Evidence and future opportunities. J. Ecol. 2020, 108, 1810–1821. [Google Scholar] [CrossRef]
- Zinger, L.; Bonin, A.; Alsos, I.G.; Bálint, M.; Bik, H.; Boyer, F.; Chariton, A.A.; Creer, S.; Coissac, E.; Deagle, B.E.; et al. DNA metabarcoding—Need for robust experimental designs to draw sound ecological conclusions. Mol. Ecol. 2019, 28, 1857–1862. [Google Scholar] [CrossRef]
- Hugerth, L.W.; Andersson, A.F. Analysing Microbial Community Composition through Amplicon Sequencing: From Sampling to Hypothesis Testing. Front. Microbiol. 2017, 8, 1561. [Google Scholar] [CrossRef]
- Pollock, J.; Glendinning, L.; Wisedchanwet, T.; Watson, M. The Madness of Microbiome: Attempting To Find Consensus “Best Practice” for 16S Microbiome Studies. Appl. Environ. Microbiol. 2018, 84, e02627. [Google Scholar] [CrossRef]
- Černohlávková, J.; Jarkovský, J.; Nešporová, M.; Hofman, J. Variability of soil microbial properties: Effects of sampling, handling and storage. Ecotoxicol. Environ. Saf. 2009, 72, 2102–2108. [Google Scholar] [CrossRef]
- Öhlinger, R. Soil Sampling and Sample Preparation. In Methods in Soil Biology; Schinner, F., Öhlinger, R., Kandeler, E., Margesin, R., Eds.; Springer: Berlin/Heidelberg, Germany, 1996; pp. 7–11. [Google Scholar] [CrossRef]
- Griffiths, R.I.; Whiteley, A.S.; O’Donnell, A.G.; Bailey, M.J. Rapid method for coextraction of DNA and RNA from natural environments for analysis of ribosomal DNA- and rRNA-based microbial community composition. Appl. Environ. Microbiol. 2000, 66, 5488–5491. [Google Scholar] [CrossRef]
- Lakay, F.M.; Botha, A.; Prior, B.A. Comparative analysis of environmental DNA extraction and purification methods from different humic acid-rich soils. J. Appl. Microbiol. 2007, 102, 265–273. [Google Scholar] [CrossRef] [PubMed]
- Pawlowski, J.; Apothéloz-Perret-Gentil, L.; Altermatt, F. Environmental DNA: What’s behind the term? Clarifying the terminology and recommendations for its future use in biomonitoring. Mol. Ecol. 2020, 29, 4258–4264. [Google Scholar] [CrossRef] [PubMed]
- Ceccherini, M.T.; Ascher, J.; Agnelli, A.; Borgogni, F.; Pantani, O.L.; Pietramellara, G. Experimental discrimination and molecular characterization of the extracellular soil DNA fraction. Antonie Van Leeuwenhoek 2009, 96, 653–657. [Google Scholar] [CrossRef] [PubMed]
- Taberlet, P.; Prud’Homme, S.M.; Campione, E.; Roy, J.; Miquel, C.; Shehzad, W.; Gielly, L.; Rioux, D.; Choler, P.; Clément, J.C.; et al. Soil sampling and isolation of extracellular DNA from large amount of starting material suitable for metabarcoding studies. Mol. Ecol. 2012, 21, 1816–1820. [Google Scholar] [CrossRef] [PubMed]
- Courtois, S.; Frostegård, Å.; Göransson, P.; Depret, G.; Jeannin, P.; Simonet, P. Quantification of bacterial subgroups in soil: Comparison of DNA extracted directly from soil or from cells previously released by density gradient centrifugation. Environ. Microbiol. 2001, 3, 431–439. [Google Scholar] [CrossRef] [PubMed]
- Holmsgaard, P.N.; Norman, A.; Hede, S.C.; Poulsen, P.H.B.; Al-Soud, W.A.; Hansen, L.H.; Sørensen, S.J. Bias in bacterial diversity as a result of Nycodenz extraction from bulk soil. Soil Biol. Biochem. 2011, 43, 2152–2159. [Google Scholar] [CrossRef]
- Eichorst, S.A.; Strasser, F.; Woyke, T.; Schintlmeister, A.; Wagner, M.; Woebken, D. Advancements in the application of NanoSIMS and Raman microspectroscopy to investigate the activity of microbial cells in soils. Fems Microbiol. Ecol. 2015, 91. [Google Scholar] [CrossRef]
- Lentendu, G.; Hübschmann, T.; Müller, S.; Dunker, S.; Buscot, F.; Wilhelm, C. Recovery of soil unicellular eukaryotes: An efficiency and activity analysis on the single cell level. J. Microbiol. Methods 2013, 95, 463–469. [Google Scholar] [CrossRef]
- Sharma, S.; Mehta, R.; Gupta, R.; Schloter, M. Improved protocol for the extraction of bacterial mRNA from soils. J. Microbiol. Methods 2012, 91, 62–64. [Google Scholar] [CrossRef]
- Lim, N.Y.N.; Roco, C.A.; Frostegård, Å. Transparent DNA/RNA Co-extraction Workflow Protocol Suitable for Inhibitor-Rich Environmental Samples That Focuses on Complete DNA Removal for Transcriptomic Analyses. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef]
- Lever, M.A.; Torti, A.; Eickenbusch, P.; Michaud, A.B.; Šantl-Temkiv, T.; Jørgensen, B.B. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types. Front. Microbiol. 2015, 6. [Google Scholar] [CrossRef]
- Alawi, M.; Schneider, B.; Kallmeyer, J. A procedure for separate recovery of extra- and intracellular DNA from a single marine sediment sample. J. Microbiol. Methods 2014, 104, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Schöler, A.; Jacquiod, S.; Vestergaard, G.; Schulz, S.; Schloter, M. Analysis of soil microbial communities based on amplicon sequencing of marker genes. Biol. Fertil. Soils 2017, 53, 485–489. [Google Scholar] [CrossRef]
- Liu, M.; Clarke, L.J.; Baker, S.C.; Jordan, G.J.; Burridge, C.P. A practical guide to DNA metabarcoding for entomological ecologists. Ecol. Entomol. 2020, 45, 373–385. [Google Scholar] [CrossRef]
- Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F.O. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2013, 41, e1. [Google Scholar] [CrossRef]
- Ficetola, G.F.; Coissac, E.; Zundel, S.; Riaz, T.; Shehzad, W.; Bessière, J.; Taberlet, P.; Pompanon, F. An In silico approach for the evaluation of DNA barcodes. BMC Genom. 2010, 11, 434. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet. J. 2011, 17, 3. [Google Scholar] [CrossRef]
- Singer, E.; Bushnell, B.; Coleman-Derr, D.; Bowman, B.; Bowers, R.M.; Levy, A.; Gies, E.A.; Cheng, J.-F.; Copeland, A.; Klenk, H.-P.; et al. High-resolution phylogenetic microbial community profiling. ISME J. 2016, 10, 2020–2032. [Google Scholar] [CrossRef]
- Rhoads, A.; Au, K.F. PacBio Sequencing and Its Applications. Genom. Proteom. Bioinform. 2015, 13, 278–289. [Google Scholar] [CrossRef]
- Jain, M.; Olsen, H.E.; Paten, B.; Akeson, M. The Oxford Nanopore MinION: Delivery of nanopore sequencing to the genomics community. Genome Biol. 2016, 17, 239. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, M.; Zywicki, M.; Twardowski, T.; Karlowski, W.M. Efficiency of PacBio long read correction by 2nd generation Illumina sequencing. Genomics 2019, 111, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Overholt, W.A.; Hölzer, M.; Geesink, P.; Diezel, C.; Marz, M.; Küsel, K. Inclusion of Oxford Nanopore long reads improves all microbial and viral metagenome-assembled genomes from a complex aquifer system. Environ. Microbiol. 2020, 22, 4000–4013. [Google Scholar] [CrossRef]
- Lundberg, D.S.; Yourstone, S.; Mieczkowski, P.; Jones, C.D.; Dangl, J.L. Practical innovations for high-throughput amplicon sequencing. Nat. Methods 2013, 10, 999–1002. [Google Scholar] [CrossRef] [PubMed]
- Thijs, S.; Op De Beeck, M.; Beckers, B.; Truyens, S.; Stevens, V.; Van Hamme, J.D.; Weyens, N.; Vangronsveld, J. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys. Front. Microbiol. 2017, 8, 494. [Google Scholar] [CrossRef]
- Tremblay, J.; Singh, K.; Fern, A.; Kirton, E.; He, S.; Woyke, T.; Lee, J.; Chen, F.; Dangl, J.; Tringe, S. Primer and platform effects on 16S rRNA tag sequencing. Front. Microbiol. 2015, 6, 771. [Google Scholar] [CrossRef] [PubMed]
- Ghyselinck, J.; Pfeiffer, S.; Heylen, K.; Sessitsch, A.; De Vos, P. The Effect of Primer Choice and Short Read Sequences on the Outcome of 16S rRNA Gene Based Diversity Studies. PLoS ONE 2013, 8, e71360. [Google Scholar] [CrossRef]
- Lear, G.; Dickie, I.; Banks, J.C.; Boyer, S.; Buckley, H.L.; Buckley, T.R.; Cruickshank, R.; Dopheide, A.; Handley, K.M.; Hermans, S.; et al. Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples. N. Z. J. Ecol. 2018, 42, 10A–50A. [Google Scholar] [CrossRef]
- Parada, A.E.; Needham, D.M.; Fuhrman, J.A. Every base matters: Assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol. 2016, 18, 1403–1414. [Google Scholar] [CrossRef]
- Apprill, A.; McNally, S.; Parsons, R.; Weber, L. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 2015, 75, 129–137. [Google Scholar] [CrossRef]
- Quince, C.; Lanzen, A.; Davenport, R.J.; Turnbaugh, P.J. Removing Noise From Pyrosequenced Amplicons. BMC Bioinform. 2011, 12, 38. [Google Scholar] [CrossRef] [PubMed]
- Chelius, M.K.; Triplett, E.W. The Diversity of Archaea and Bacteria in Association with the Roots of Zea mays L. Microb. Ecol. 2001, 41, 252–263. [Google Scholar] [CrossRef]
- Redford, A.J.; Bowers, R.M.; Knight, R.; Linhart, Y.; Fierer, N. The ecology of the phyllosphere: Geographic and phylogenetic variability in the distribution of bacteria on tree leaves. Environ. Microbiol. 2010, 12, 2885–2893. [Google Scholar] [CrossRef] [PubMed]
- Bodenhausen, N.; Horton, M.W.; Bergelson, J. Bacterial Communities Associated with the Leaves and the Roots of Arabidopsis thaliana. PLoS ONE 2013, 8, e56329. [Google Scholar] [CrossRef] [PubMed]
- Sogin, M.L.; Morrison, H.G.; Huber, J.A.; Welch, D.M.; Huse, S.M.; Neal, P.R.; Arrieta, J.M.; Herndl, G.J. Microbial diversity in the deep sea and the underexplored “rare biosphere”. Proc. Natl. Acad. Sci. USA 2006, 103, 12115–12120. [Google Scholar] [CrossRef]
- Walker, J.J.; Pace, N.R. Phylogenetic Composition of Rocky Mountain Endolithic Microbial Ecosystems. Appl. Environ. Microbiol. 2007, 73, 3497–3504. [Google Scholar] [CrossRef]
- McAllister, S.M.; Davis, R.E.; McBeth, J.M.; Tebo, B.M.; Emerson, D.; Moyer, C.L. Biodiversity and Emerging Biogeography of the Neutrophilic Iron-Oxidizing Zetaproteobacteria. Appl. Environ. Microbiol. 2011, 77, 5445–5457. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.K.; Van Doan, T.; Yoo, K.; Choi, S.; Kim, C.; Park, J. Discovery of commonly existing anode biofilm microbes in two different wastewater treatment MFCs using FLX Titanium pyrosequencing. Appl. Microbiol. Biotechnol. 2010, 87, 2335–2343. [Google Scholar] [CrossRef] [PubMed]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Lozupone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108, 4516–4522. [Google Scholar] [CrossRef]
- Gilbert, J.A.; Jansson, J.K.; Knight, R. The Earth Microbiome project: Successes and aspirations. BMC Biol. 2014, 12, 69. [Google Scholar] [CrossRef] [PubMed]
- Bahram, M.; Anslan, S.; Hildebrand, F.; Bork, P.; Tedersoo, L. Newly designed 16S rRNA metabarcoding primers amplify diverse and novel archaeal taxa from the environment. Environ. Microbiol. Rep. 2019, 11, 487–494. [Google Scholar] [CrossRef]
- Gantner, S.; Andersson, A.F.; Alonso-Sáez, L.; Bertilsson, S. Novel primers for 16S rRNA-based archaeal community analyses in environmental samples. J. Microbiol. Methods 2011, 84, 12–18. [Google Scholar] [CrossRef] [PubMed]
- Takai, K.; Horikoshi, K. Rapid Detection and Quantification of Members of the Archaeal Community by Quantitative PCR Using Fluorogenic Probes. Appl. Environ. Microbiol. 2000, 66, 5066–5072. [Google Scholar] [CrossRef]
- Ovreås, L.; Forney, L.; Daae, F.L.; Torsvik, V. Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 1997, 63, 3367–3373. [Google Scholar] [CrossRef] [PubMed]
- Raskin, L.; Stromley, J.M.; Rittmann, B.E.; Stahl, D.A. Group-specific 16S rRNA hybridization probes to describe natural communities of methanogens. Appl. Environ. Microbiol. 1994, 60, 1232–1240. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, T.; Kimura, M.; Asakawa, S. Dynamics of methanogenic archaeal communities based on rRNA analysis and their relation to methanogenic activity in Japanese paddy field soils. Soil Biol. Biochem. 2007, 39, 2877–2887. [Google Scholar] [CrossRef]
- Illumina. 16S metagenomic sequencing library preparation - Preparing 16S Ribosomal RNA Gene Amplicons for theIllumina MiSeq System (Illumina Technical Note 15044223). Available online: http://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (accessed on 8 September 2020).
- Laforest-Lapointe, I.; Messier, C.; Kembel, S.W. Tree Leaf Bacterial Community Structure and Diversity Differ along a Gradient of Urban Intensity. mSystems 2017, 2, e00087-17. [Google Scholar] [CrossRef]
- Kembel, S.W.; O’Connor, T.K.; Arnold, H.K.; Hubbell, S.P.; Wright, S.J.; Green, J.L. Relationships between phyllosphere bacterial communities and plant functional traits in a neotropical forest. Proc. Natl. Acad. Sci. USA 2014, 111, 13715–13720. [Google Scholar] [CrossRef]
- Laforest-Lapointe, I.; Messier, C.; Kembel, S.W. Host species identity, site and time drive temperate tree phyllosphere bacterial community structure. Microbiome 2016, 4, 27. [Google Scholar] [CrossRef]
- Miura, T.; Sánchez, R.; Castañeda, L.E.; Godoy, K.; Barbosa, O. Shared and unique features of bacterial communities in native forest and vineyard phyllosphere. Ecol. Evol. 2019, 9, 3295–3305. [Google Scholar] [CrossRef]
- Ulrich, K.; Becker, R.; Behrendt, U.; Kube, M.; Ulrich, A. A Comparative Analysis of Ash Leaf-Colonizing Bacterial Communities Identifies Putative Antagonists of Hymenoscyphus fraxineus. Front. Microbiol. 2020, 11, 966. [Google Scholar] [CrossRef]
- Gdanetz, K.; Trail, F. The Wheat Microbiome Under Four Management Strategies, and Potential for Endophytes in Disease Protection. Phytobiomes J. 2017, 1, 158–168. [Google Scholar] [CrossRef]
- Vorholt, J.A. Microbial life in the phyllosphere. Nat. Rev. Microbiol. 2012, 10, 828–840. [Google Scholar] [CrossRef] [PubMed]
- Sakai, M.; Ikenaga, M. Application of peptide nucleic acid (PNA)-PCR clamping technique to investigate the community structures of rhizobacteria associated with plant roots. J. Microbiol. Methods 2013, 92, 281–288. [Google Scholar] [CrossRef] [PubMed]
- Ray, A.; Nordén, B. Peptide nucleic acid (PNA): Its medical and biotechnical applications and promise for the future. FASEB J. 2000, 14, 1041–1060. [Google Scholar] [CrossRef] [PubMed]
- Santhanam, R.; Groten, K.; Meldau, D.G.; Baldwin, I.T. Analysis of Plant-Bacteria Interactions in Their Native Habitat: Bacterial Communities Associated with Wild Tobacco Are Independent of Endogenous Jasmonic Acid Levels and Developmental Stages. PLoS ONE 2014, 9, e94710. [Google Scholar] [CrossRef] [PubMed]
- Toju, H.; Kurokawa, H.; Kenta, T. Factors Influencing Leaf- and Root-Associated Communities of Bacteria and Fungi Across 33 Plant Orders in a Grassland. Front. Microbiol. 2019, 10, 241. [Google Scholar] [CrossRef] [PubMed]
- Wagner, M.R.; Lundberg, D.S.; del Rio, T.G.; Tringe, S.G.; Dangl, J.L.; Mitchell-Olds, T. Host genotype and age shape the leaf and root microbiomes of a wild perennial plant. Nat. Commun. 2016, 7, 12151. [Google Scholar] [CrossRef]
- Wagner, M.R.; Busby, P.E.; Balint-Kurti, P. Analysis of leaf microbiome composition of near-isogenic maize lines differing in broad-spectrum disease resistance. New Phytol. 2020, 225, 2152–2165. [Google Scholar] [CrossRef]
- Jackrel, S.L.; Owens, S.M.; Gilbert, J.A.; Pfister, C.A. Identifying the plant-associated microbiome across aquatic and terrestrial environments: The effects of amplification method on taxa discovery. Mol. Ecol. Resour. 2017, 17, 931–942. [Google Scholar] [CrossRef]
- Fitzpatrick, C.R.; Lu-Irving, P.; Copeland, J.; Guttman, D.S.; Wang, P.W.; Baltrus, D.A.; Dlugosch, K.M.; Johnson, M.T.J. Chloroplast sequence variation and the efficacy of peptide nucleic acids for blocking host amplification in plant microbiome studies. Microbiome 2018, 6, 144. [Google Scholar] [CrossRef]
- Begerow, D.; Nilsson, H.; Unterseher, M.; Maier, W. Current state and perspectives of fungal DNA barcoding and rapid identification procedures. Appl. Microbiol. Biotechnol. 2010, 87, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, R.H.; Tedersoo, L.; Ryberg, M.; Kristiansson, E.; Hartmann, M.; Unterseher, M.; Porter, T.M.; Bengtsson-Palme, J.; Walker, D.M.; de Sousa, F.; et al. A Comprehensive, Automatically Updated Fungal ITS Sequence Dataset for Reference-Based Chimera Control in Environmental Sequencing Efforts. Microbes Environ. 2015, 30, 145–150. [Google Scholar] [CrossRef]
- Bellemain, E.; Carlsen, T.; Brochmann, C.; Coissac, E.; Taberlet, P.; Kauserud, H. ITS as an environmental DNA barcode for fungi: An in silico approach reveals potential PCR biases. BMC Microbiol. 2010, 10, 189. [Google Scholar] [CrossRef]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef]
- Li, S.; Deng, Y.; Wang, Z.; Zhang, Z.; Kong, X.; Zhou, W.; Yi, Y.; Qu, Y. Exploring the accuracy of amplicon-based internal transcribed spacer markers for a fungal community. Mol. Ecol. Resour. 2020, 20, 170–184. [Google Scholar] [CrossRef] [PubMed]
- Xu, J. Fungal DNA barcoding. Genome 2016, 59, 913–932. [Google Scholar] [CrossRef]
- Nilsson, R.H.; Kristiansson, E.; Ryberg, M.; Hallenberg, N.; Larsson, K.-H. Intraspecific ITS Variability in the Kingdom Fungi as Expressed in the International Sequence Databases and Its Implications for Molecular Species Identification. Evol. Bioinform. 2008, 4, EBO-S653. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-C.; Liu, C.; Huang, L.; Bengtsson-Palme, J.; Chen, H.; Zhang, J.-H.; Cai, D.; Li, J.-Q. ITS1: A DNA barcode better than ITS2 in eukaryotes? Mol. Ecol. Resour. 2015, 15, 573–586. [Google Scholar] [CrossRef] [PubMed]
- Bazzicalupo, A.L.; Bálint, M.; Schmitt, I. Comparison of ITS1 and ITS2 rDNA in 454 sequencing of hyperdiverse fungal communities. Fungal Ecol. 2013, 6, 102–109. [Google Scholar] [CrossRef]
- Yang, R.-H.; Su, J.-H.; Shang, J.-J.; Wu, Y.-Y.; Li, Y.; Bao, D.-P.; Yao, Y.-J. Evaluation of the ribosomal DNA internal transcribed spacer (ITS), specifically ITS1 and ITS2, for the analysis of fungal diversity by deep sequencing. PLoS ONE 2018, 13, e0206428. [Google Scholar] [CrossRef] [PubMed]
- Yahr, R.; Schoch, C.L.; Dentinger, B.T.M. Scaling up discovery of hidden diversity in fungi: Impacts of barcoding approaches. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150336. [Google Scholar] [CrossRef]
- Nilsson, R.H.; Anslan, S.; Bahram, M.; Wurzbacher, C.; Baldrian, P.; Tedersoo, L. Mycobiome diversity: High-throughput sequencing and identification of fungi. Nat. Rev. Microbiol. 2019, 17, 95–109. [Google Scholar] [CrossRef] [PubMed]
- Blaalid, R.; Kumar, S.; Nilsson, R.H.; Abarenkov, K.; Kirk, P.M.; Kauserud, H. ITS1 versus ITS2 as DNA metabarcodes for fungi. Mol. Ecol. Resour. 2013, 13, 218–224. [Google Scholar] [CrossRef] [PubMed]
- Monard, C.; Gantner, S.; Stenlid, J. Utilizing ITS1 and ITS2 to study environmental fungal diversity using pyrosequencing. Fems Microbiol. Ecol. 2013, 84, 165–175. [Google Scholar] [CrossRef]
- Tedersoo, L.; Lindahl, B. Fungal identification biases in microbiome projects. Environ. Microbiol. Rep. 2016, 8, 774–779. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
- Toju, H.; Tanabe, A.S.; Yamamoto, S.; Sato, H. High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples. PLoS ONE 2012, 7, e40863. [Google Scholar] [CrossRef]
- Ihrmark, K.; Bödeker, I.T.M.; Cruz-Martinez, K.; Friberg, H.; Kubartova, A.; Schenck, J.; Strid, Y.; Stenlid, J.; Brandström-Durling, M.; Clemmensen, K.E.; et al. New primers to amplify the fungal ITS2 region – evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol. Ecol. 2012, 82, 666–677. [Google Scholar] [CrossRef]
- Tedersoo, L.; Bahram, M.; Põlme, S.; Kõljalg, U.; Yorou, N.S.; Wijesundera, R.; Ruiz, L.V.; Vasco-Palacios, A.M.; Thu, P.Q.; Suija, A.; et al. Global diversity and geography of soil fungi. Science 2014, 346, 1256688. [Google Scholar] [CrossRef]
- Turenne, C.Y.; Sanche, S.E.; Hoban, D.J.; Karlowsky, J.A.; Kabani, A.M. Rapid Identification of Fungi by Using the ITS2 Genetic Region and an Automated Fluorescent Capillary Electrophoresis System. J. Clin. Microbiol. 1999, 37, 1846–1851. [Google Scholar] [CrossRef]
- Öpik, M.; Davison, J.; Moora, M.; Zobel, M. DNA-based detection and identification of Glomeromycota: The virtual taxonomy of environmental sequences. Botany 2013, 92, 135–147. [Google Scholar] [CrossRef]
- Krüger, M.; Krüger, C.; Walker, C.; Stockinger, H.; Schüßler, A. Phylogenetic reference data for systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level. New Phytol. 2012, 193, 970–984. [Google Scholar] [CrossRef] [PubMed]
- Francioli, D.; Schulz, E.; Lentendu, G.; Wubet, T.; Buscot, F.; Reitz, T. Mineral vs. organic amendments: Microbial community structure, activity and abundance of agriculturally relevant microbes are driven by long-term fertilization strategies. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef]
- Lekberg, Y.; Vasar, M.; Bullington, L.S.; Sepp, S.-K.; Antunes, P.M.; Bunn, R.; Larkin, B.G.; Öpik, M. More bang for the buck? Can arbuscular mycorrhizal fungal communities be characterized adequately alongside other fungi using general fungal primers? New Phytol. 2018, 220, 971–976. [Google Scholar] [CrossRef]
- Berruti, A.; Desirò, A.; Visentin, S.; Zecca, O.; Bonfante, P. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards. Environ. Microbiol. Rep. 2017, 9, 658–667. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Suyama, Y.; Saito, M.; Sugawara, K. A new primer for discrimination of arbuscular mycorrhizal fungi with polymerase chain reaction-denature gradient gel electrophoresis. Grassl. Sci. 2005, 51, 179–181. [Google Scholar] [CrossRef]
- Cui, X.; Hu, J.; Wang, J.; Yang, J.; Lin, X. Reclamation negatively influences arbuscular mycorrhizal fungal community structure and diversity in coastal saline-alkaline land in Eastern China as revealed by Illumina sequencing. Appl. Soil Ecol. 2016, 98, 140–149. [Google Scholar] [CrossRef]
- Higo, M.; Tatewaki, Y.; Iida, K.; Yokota, K.; Isobe, K. Amplicon sequencing analysis of arbuscular mycorrhizal fungal communities colonizing maize roots in different cover cropping and tillage systems. Sci. Rep. 2020, 10, 6039. [Google Scholar] [CrossRef] [PubMed]
- Faggioli, V.; Menoyo, E.; Geml, J.; Kemppainen, M.; Pardo, A.; Salazar, M.J.; Becerra, A.G. Soil lead pollution modifies the structure of arbuscular mycorrhizal fungal communities. Mycorrhiza 2019, 29, 363–373. [Google Scholar] [CrossRef]
- Van Geel, M.; Busschaert, P.; Honnay, O.; Lievens, B. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing. J. Microbiol. Methods 2014, 106, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Takahashi, K.; Harada, N. Evaluation of primer pairs for studying arbuscular mycorrhizal fungal community compositions using a MiSeq platform. Biol. Fertil. Soils 2020, 56, 853–858. [Google Scholar] [CrossRef]
- Mitchell, J.I.; Zuccaro, A. Sequences, the environment and fungi. Mycologist 2006, 20, 62–74. [Google Scholar] [CrossRef]
- Misra, J.K.; Tewari, J.P.; Deshmukh, S.K. Systematics and Evolution of Fungi; Misra, J., Tewari, J., Deshmukh, S., Eds.; CRC Press: Boca Raton, FL, USA, 2011. [Google Scholar] [CrossRef]
- Raja, H.A.; Miller, A.N.; Pearce, C.J.; Oberlies, N.H. Fungal Identification Using Molecular Tools: A Primer for the Natural Products Research Community. J. Nat. Prod. 2017, 80, 756–770. [Google Scholar] [CrossRef]
- Banos, S.; Lentendu, G.; Kopf, A.; Wubet, T.; Glöckner, F.O.; Reich, M. A comprehensive fungi-specific 18S rRNA gene sequence primer toolkit suited for diverse research issues and sequencing platforms. BMC Microbiol. 2018, 18, 190. [Google Scholar] [CrossRef] [PubMed]
- De Gruyter, J.; Weedon, J.T.; Bazot, S.; Dauwe, S.; Fernandez-Garberí, P.-R.; Geisen, S.; De La Motte, L.G.; Heinesch, B.; Janssens, I.A.; Leblans, N.; et al. Patterns of local, intercontinental and interseasonal variation of soil bacterial and eukaryotic microbial communities. FEMS Microbiol. Ecol. 2020, 96, fiaa018. [Google Scholar] [CrossRef]
- Liu, K.-L.; Porras-Alfaro, A.; Kuske, C.R.; Eichorst, S.A.; Xie, G. Accurate, rapid taxonomic classification of fungal large-subunit rRNA genes. Appl. Environ. Microbiol. 2012, 78, 1523–1533. [Google Scholar] [CrossRef] [PubMed]
- Singer, D.; Seppey, C.V.W.; Lentendu, G.; Dunthorn, M.; Bass, D.; Belbahri, L.; Blandenier, Q.; Debroas, D.; de Groot, G.A.; de Vargas, C.; et al. Protist taxonomic and functional diversity in soil, freshwater and marine ecosystems. Environ. Int. 2021, 146, 106262. [Google Scholar] [CrossRef] [PubMed]
- Hadziavdic, K.; Lekang, K.; Lanzen, A.; Jonassen, I.; Thompson, E.M.; Troedsson, C. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers. PLoS ONE 2014, 9, e87624. [Google Scholar] [CrossRef]
- Lane, D.J. 6S/23S rRNA Sequencing. In Nucleic Acid Techniques in Bacterial Systematic; Stackebrandt, E., Goodfellow, M., Eds.; John Wiley and Sons: New York, NY, USA, 1991; pp. 115–175. [Google Scholar]
- Medlin, L.; Elwood, H.J.; Stickel, S.; Sogin, M.L. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988, 71, 491–499. [Google Scholar] [CrossRef]
- Amaral-Zettler, L.A.; McCliment, E.A.; Ducklow, H.W.; Huse, S.M. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. PLoS ONE 2009, 4, e6372. [Google Scholar] [CrossRef]
- Seppey, C.V.W.; Singer, D.; Dumack, K.; Fournier, B.; Belbahri, L.; Mitchell, E.A.D.; Lara, E. Distribution patterns of soil microbial eukaryotes suggests widespread algivory by phagotrophic protists as an alternative pathway for nutrient cycling. Soil Biol. Biochem. 2017, 112, 68–76. [Google Scholar] [CrossRef]
- Euringer, K.; Lueders, T. An optimised PCR/T-RFLP fingerprinting approach for the investigation of protistan communities in groundwater environments. J. Microbiol. Methods 2008, 75, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Amann, R.I.; Binder, B.J.; Olson, R.J.; Chisholm, S.W.; Devereux, R.; Stahl, D.A. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 1990, 56, 1919–1925. [Google Scholar] [CrossRef] [PubMed]
- Dollive, S.; Peterfreund, G.L.; Sherrill-Mix, S.; Bittinger, K.; Sinha, R.; Hoffmann, C.; Nabel, C.S.; Hill, D.A.; Artis, D.; Bachman, M.A.; et al. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples. Genome Biol. 2012, 13, R60. [Google Scholar] [CrossRef] [PubMed]
- Nolte, V.; Pandey, R.V.; Jost, S.; Medinger, R.; Ottenwalder, B.; Boenigk, J.; Schlotterer, C. Contrasting seasonal niche separation between rare and abundant taxa conceals the extent of protist diversity. Mol. Ecol. 2010, 19, 2908–2915. [Google Scholar] [CrossRef]
- Bass, D.; Silberman, J.D.; Brown, M.W.; Pearce, R.A.; Tice, A.K.; Jousset, A.; Geisen, S.; Hartikainen, H. Coprophilic amoebae and flagellates, including Guttulinopsis, Rosculus and Helkesimastix, characterise a divergent and diverse rhizarian radiation and contribute to a large diversity of faecal-associated protists. Environ. Microbiol. 2016, 18, 1604–1619. [Google Scholar] [CrossRef]
- Stoeck, T.; Bass, D.; Nebel, M.; Christen, R.; Jones, M.D.; Breiner, H.W.; Richards, T.A. Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Mol. Ecol. 2010, 19 (Suppl. 1), 21–31. [Google Scholar] [CrossRef]
- Hugerth, L.W.; Muller, E.E.L.; Hu, Y.O.O.; Lebrun, L.A.M.; Roume, H.; Lundin, D.; Wilmes, P.; Andersson, A.F. Systematic Design of 18S rRNA Gene Primers for Determining Eukaryotic Diversity in Microbial Consortia. PLoS ONE 2014, 9, e95567. [Google Scholar] [CrossRef]
- Guardiola, M.; Uriz, M.J.; Taberlet, P.; Coissac, E.; Wangensteen, O.S.; Turon, X. Deep-Sea, Deep-Sequencing: Metabarcoding Extracellular DNA from Sediments of Marine Canyons. PLoS ONE 2015, 10, e0139633. [Google Scholar] [CrossRef]
- Bradley, I.M.; Pinto, A.J.; Guest, J.S. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities. Appl. Environ. Microbiol. 2016, 82, 5878–5891. [Google Scholar] [CrossRef]
- Mahé, F.; de Vargas, C.; Bass, D.; Czech, L.; Stamatakis, A.; Lara, E.; Singer, D.; Mayor, J.; Bunge, J.; Sernaker, S.; et al. Parasites dominate hyperdiverse soil protist communities in Neotropical rainforests. Nat. Ecol. Evol. 2017, 1, 0091. [Google Scholar] [CrossRef]
- Heger, T.J.; Giesbrecht, I.J.W.; Gustavsen, J.; Del Campo, J.; Kellogg, C.T.E.; Hoffman, K.M.; Lertzman, K.; Mohn, W.W.; Keeling, P.J. High-throughput environmental sequencing reveals high diversity of litter and moss associated protist communities along a gradient of drainage and tree productivity. Environ. Microbiol. 2018, 20, 1185–1203. [Google Scholar] [CrossRef]
- Singer, D.; Metz, S.; Unrein, F.; Shimano, S.; Mazei, Y.; Mitchell, E.A.D.; Lara, E. Contrasted Micro-Eukaryotic Diversity Associated with Sphagnum Mosses in Tropical, Subtropical and Temperate Climatic Zones. Microb. Ecol. 2019, 78, 714–724. [Google Scholar] [CrossRef]
- Guo, S.; Xiong, W.; Xu, H.; Hang, X.; Liu, H.; Xun, W.; Li, R.; Shen, Q. Continuous application of different fertilizers induces distinct bulk and rhizosphere soil protist communities. Eur. J. Soil Biol. 2018, 88, 8–14. [Google Scholar] [CrossRef]
- Xiong, W.; Song, Y.; Yang, K.; Gu, Y.; Wei, Z.; Kowalchuk, G.A.; Xu, Y.; Jousset, A.; Shen, Q.; Geisen, S. Rhizosphere protists are key determinants of plant health. Microbiome 2020, 8, 27. [Google Scholar] [CrossRef]
- Lentendu, G.; Wubet, T.; Chatzinotas, A.; Wilhelm, C.; Buscot, F.; Schlegel, M. Effects of long-term differential fertilization on eukaryotic microbial communities in an arable soil: A multiple barcoding approach. Mol. Ecol. 2014, 23, 3341–3355. [Google Scholar] [CrossRef]
- Fiore-Donno, A.M.; Rixen, C.; Rippin, M.; Glaser, K.; Samolov, E.; Karsten, U.; Becker, B.; Bonkowski, M. New barcoded primers for efficient retrieval of cercozoan sequences in high-throughput environmental diversity surveys, with emphasis on worldwide biological soil crusts. Mol. Ecol. Resour. 2018, 18, 229–239. [Google Scholar] [CrossRef]
- Adl, S.M.; Bass, D.; Lane, C.E.; Lukeš, J.; Schoch, C.L.; Smirnov, A.; Agatha, S.; Berney, C.; Brown, M.W.; Burki, F.; et al. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. J. Eukaryot. Microbiol. 2019, 66, 4–119. [Google Scholar] [CrossRef]
- Pawlowski, J.; Audic, S.; Adl, S.; Bass, D.; Belbahri, L.; Berney, C.; Bowser, S.S.; Cepicka, I.; Decelle, J.; Dunthorn, M.; et al. CBOL Protist Working Group: Barcoding Eukaryotic Richness beyond the Animal, Plant, and Fungal Kingdoms. PLoS Biol. 2012, 10, e1001419. [Google Scholar] [CrossRef]
- Zizka, V.M.A.; Elbrecht, V.; Macher, J.-N.; Leese, F. Assessing the influence of sample tagging and library preparation on DNA metabarcoding. Mol. Ecol. Resour. 2019, 19, 893–899. [Google Scholar] [CrossRef]
- Carøe, C.; Bohmann, K. Tagsteady: A metabarcoding library preparation protocol to avoid false assignment of sequences to samples. Mol. Ecol. Resour. 2020, 20, 1620–1631. [Google Scholar] [CrossRef]
- Dopheide, A.; Xie, D.; Buckley, T.R.; Drummond, A.J.; Newcomb, R.D. Impacts of DNA extraction and PCR on DNA metabarcoding estimates of soil biodiversity. Methods Ecol. Evol. 2019, 10, 120–133. [Google Scholar] [CrossRef]
- Rychlik, W.; Spencer, W.J.; Rhoads, R.E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 1990, 18, 6409–6412. [Google Scholar] [CrossRef] [PubMed]
- Oliver, A.K.; Brown, S.P.; Callaham, M.A.; Jumpponen, A. Polymerase matters: Non-proofreading enzymes inflate fungal community richness estimates by up to 15%. Fungal Ecol. 2015, 15, 86–89. [Google Scholar] [CrossRef]
- Krueger, F.; Andrews, S.R.; Osborne, C.S. Large Scale Loss of Data in Low-Diversity Illumina Sequencing Libraries Can Be Recovered by Deferred Cluster Calling. PLoS ONE 2011, 6, e16607. [Google Scholar] [CrossRef]
- Illumina. How much PhiX spike-in is recommended when sequencing low diversity libraries on Illumina platforms? Available online: https://support.illumina.com/bulletins/2017/02/how-much-phix-spike-in-is-recommended-when-sequencing-low-divers.html (accessed on 11 November 2020).
- De Muinck, E.J.; Trosvik, P.; Gilfillan, G.D.; Hov, J.R.; Sundaram, A.Y.M. A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform. Microbiome 2017, 5, 68. [Google Scholar] [CrossRef]
- Holm, J.B.; Humphrys, M.S.; Robinson, C.K.; Settles, M.L.; Ott, S.; Fu, L.; Yang, H.; Gajer, P.; He, X.; McComb, E.; et al. Ultrahigh-Throughput Multiplexing and Sequencing of >500-Base-Pair Amplicon Regions on the Illumina HiSeq 2500 Platform. MSystems 2019, 4, e00029-19. [Google Scholar] [CrossRef]
- Glenn, T.C.; Pierson, T.W.; Bayona-Vásquez, N.J.; Kieran, T.J.; Hoffberg, S.L.; Thomas Iv, J.C.; Lefever, D.E.; Finger, J.W.; Gao, B.; Bian, X.; et al. Adapterama II: Universal amplicon sequencing on Illumina platforms (TaggiMatrix). PeerJ 2019, 7, e7786. [Google Scholar] [CrossRef]
- Esling, P.; Lejzerowicz, F.; Pawlowski, J. Accurate multiplexing and filtering for high-throughput amplicon-sequencing. Nucleic Acids Res. 2015, 43, 2513–2524. [Google Scholar] [CrossRef]
- Fadrosh, D.W.; Ma, B.; Gajer, P.; Sengamalay, N.; Ott, S.; Brotman, R.M.; Ravel, J. An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Microbiome 2014, 2, 6. [Google Scholar] [CrossRef] [PubMed]
- Jensen, E.A.; Berryman, D.E.; Murphy, E.R.; Carroll, R.K.; Busken, J.; List, E.O.; Broach, W.H. Heterogeneity spacers in 16S rDNA primers improve analysis of mouse gut microbiomes via greater nucleotide diversity. BioTechniques 2019, 67, 55–62. [Google Scholar] [CrossRef]
- Taberlet, P.; Bonin, A.; Zinger, L.; Coissac, E. Environmental DNA: For Biodiversity Research and Monitoring. Environ. Dna: Biodivers. Res. Monit. 2018, 1–253. [Google Scholar] [CrossRef]
- Schnell, I.B.; Bohmann, K.; Gilbert, M.T.P. Tag jumps illuminated—Reducing sequence-to-sample misidentifications in metabarcoding studies. Mol. Ecol. Resour. 2015, 15, 1289–1303. [Google Scholar] [CrossRef]
- Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 2013, 10, 57–59. [Google Scholar] [CrossRef] [PubMed]
- Kozich, J.J.; Westcott, S.L.; Baxter, N.T.; Highlander, S.K.; Schloss, P.D. Development of a Dual-Index Sequencing Strategy and Curation Pipeline for Analyzing Amplicon Sequence Data on the MiSeq Illumina Sequencing Platform. Appl. Environ. Microbiol. 2013, 79, 5112–5120. [Google Scholar] [CrossRef] [PubMed]
- De Barba, M.; Miquel, C.; Boyer, F.; Mercier, C.; Rioux, D.; Coissac, E.; Taberlet, P. DNA metabarcoding multiplexing and validation of data accuracy for diet assessment: Application to omnivorous diet. Mol. Ecol. Resour. 2014, 14, 306–323. [Google Scholar] [CrossRef] [PubMed]
- McLaren, M.R.; Willis, A.D.; Callahan, B.J. Consistent and correctable bias in metagenomic sequencing experiments. eLife 2019, 8, e46923. [Google Scholar] [CrossRef] [PubMed]
- Gloor, G.B.; Macklaim, J.M.; Pawlowsky-Glahn, V.; Egozcue, J.J. Microbiome Datasets Are Compositional: And This Is Not Optional. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef]
- Harrison, J.G.; John Calder, W.; Shuman, B.; Alex Buerkle, C. The quest for absolute abundance: The use of internal standards for DNA-based community ecology. Mol. Ecol. Resour. 2021. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
- Zafeiropoulos, H.; Viet, H.Q.; Vasileiadou, K.; Potirakis, A.; Arvanitidis, C.; Topalis, P.; Pavloudi, C.; Pafilis, E. PEMA: A flexible Pipeline for Environmental DNA Metabarcoding Analysis of the 16S/18S ribosomal RNA, ITS, and COI marker genes. GigaScience 2020, 9. [Google Scholar] [CrossRef] [PubMed]
- Anslan, S.; Bahram, M.; Hiiesalu, I.; Tedersoo, L. PipeCraft: Flexible open-source toolkit for bioinformatics analysis of custom high-throughput amplicon sequencing data. Mol. Ecol. Resour. 2017, 17, e234–e240. [Google Scholar] [CrossRef] [PubMed]
- Dufresne, Y.; Lejzerowicz, F.; Perret-Gentil, L.A.; Pawlowski, J.; Cordier, T. SLIM: A flexible web application for the reproducible processing of environmental DNA metabarcoding data. BMC Bioinform. 2019, 20, 88. [Google Scholar] [CrossRef] [PubMed]
- Fosso, B.; Santamaria, M.; Marzano, M.; Alonso-Alemany, D.; Valiente, G.; Donvito, G.; Monaco, A.; Notarangelo, P.; Pesole, G. BioMaS: A modular pipeline for Bioinformatic analysis of Metagenomic AmpliconS. BMC Bioinform. 2015, 16, 203. [Google Scholar] [CrossRef] [PubMed]
- Gweon, H.S.; Oliver, A.; Taylor, J.; Booth, T.; Gibbs, M.; Read, D.S.; Griffiths, R.I.; Schonrogge, K. PIPITS: An automated pipeline for analyses of fungal internal transcribed spacer sequences from the Illumina sequencing platform. Methods Ecol. Evol. 2015, 6, 973–980. [Google Scholar] [CrossRef]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [PubMed]
- Boyer, F.; Mercier, C.; Bonin, A.; Le Bras, Y.; Taberlet, P.; Coissac, E. obitools: A unix-inspired software package for DNA metabarcoding. Mol. Ecol. Resour. 2016, 16, 176–182. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Porter, T.M.; Hajibabaei, M. Scaling up: A guide to high-throughput genomic approaches for biodiversity analysis. Mol. Ecol. 2018, 27, 313–338. [Google Scholar] [CrossRef] [PubMed]
- Rideout, J.R.; He, Y.; Navas-Molina, J.A.; Walters, W.A.; Ursell, L.K.; Gibbons, S.M.; Chase, J.; McDonald, D.; Gonzalez, A.; Robbins-Pianka, A.; et al. Subsampled open-reference clustering creates consistent, comprehensive OTU definitions and scales to billions of sequences. PeerJ 2014, 2, e545. [Google Scholar] [CrossRef]
- Nguyen, N.-P.; Warnow, T.; Pop, M.; White, B. A perspective on 16S rRNA operational taxonomic unit clustering using sequence similarity. Npj Biofilms Microbiomes 2016, 2, 16004. [Google Scholar] [CrossRef]
- Gevers, D.; Cohan, F.M.; Lawrence, J.G.; Spratt, B.G.; Coenye, T.; Feil, E.J.; Stackebrandt, E.; de Peer, Y.V.; Vandamme, P.; Thompson, F.L.; et al. Re-evaluating prokaryotic species. Nat. Rev. Microbiol. 2005, 3, 733–739. [Google Scholar] [CrossRef]
- Schmidt, T.S.B.; Matias Rodrigues, J.F.; von Mering, C. Limits to robustness and reproducibility in the demarcation of operational taxonomic units. Environ. Microbiol. 2015, 17, 1689–1706. [Google Scholar] [CrossRef]
- Mahé, F.; Rognes, T.; Quince, C.; de Vargas, C.; Dunthorn, M. Swarm v2: Highly-scalable and high-resolution amplicon clustering. PeerJ 2015, 3, e1420. [Google Scholar] [CrossRef]
- Mahé, F.; Rognes, T.; Quince, C.; de Vargas, C.; Dunthorn, M. Swarm: Robust and fast clustering method for amplicon-based studies. PeerJ 2014, 2, e593. [Google Scholar] [CrossRef] [PubMed]
- De Vargas, C.; Audic, S.; Henry, N.; Decelle, J.; Mahé, F.; Logares, R.; Lara, E.; Berney, C.; Le Bescot, N.; Probert, I.; et al. Eukaryotic plankton diversity in the sunlit ocean. Science 2015, 348, 1261605. [Google Scholar] [CrossRef]
- Eren, A.M.; Morrison, H.G.; Lescault, P.J.; Reveillaud, J.; Vineis, J.H.; Sogin, M.L. Minimum entropy decomposition: Unsupervised oligotyping for sensitive partitioning of high-throughput marker gene sequences. ISME J. 2015, 9, 968–979. [Google Scholar] [CrossRef]
- Callahan, B.J.; Wong, J.; Heiner, C.; Oh, S.; Theriot, C.M.; Gulati, A.S.; McGill, S.K.; Dougherty, M.K. High-throughput amplicon sequencing of the full-length 16S rRNA gene with single-nucleotide resolution. Nucleic Acids Res. 2019, 47, e103. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Holmes, S.P. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J. 2017, 11, 2639–2643. [Google Scholar] [CrossRef]
- Prodan, A.; Tremaroli, V.; Brolin, H.; Zwinderman, A.H.; Nieuwdorp, M.; Levin, E. Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing. PLoS ONE 2020, 15, e0227434. [Google Scholar] [CrossRef]
- Estaki, M.; Jiang, L.; Bokulich, N.A.; McDonald, D.; González, A.; Kosciolek, T.; Martino, C.; Zhu, Q.; Birmingham, A.; Vázquez-Baeza, Y.; et al. QIIME 2 Enables Comprehensive End-to-End Analysis of Diverse Microbiome Data and Comparative Studies with Publicly Available Data. Curr. Protoc. Bioinform. 2020, 70, e100. [Google Scholar] [CrossRef]
- Pauvert, C.; Buée, M.; Laval, V.; Edel-Hermann, V.; Fauchery, L.; Gautier, A.; Lesur, I.; Vallance, J.; Vacher, C. Bioinformatics matters: The accuracy of plant and soil fungal community data is highly dependent on the metabarcoding pipeline. Fungal Ecol. 2019, 41, 23–33. [Google Scholar] [CrossRef]
- Caruso, V.; Song, X.; Asquith, M.; Karstens, L. Performance of Microbiome Sequence Inference Methods in Environments with Varying Biomass. MSystems 2019, 4, e00163-18. [Google Scholar] [CrossRef]
- Nearing, J.T.; Douglas, G.M.; Comeau, A.M.; Langille, M.G.I. Denoising the Denoisers: An independent evaluation of microbiome sequence error-correction approaches. PeerJ 2018, 6, e5364. [Google Scholar] [CrossRef]
- Semchenko, M.; Leff, J.W.; Lozano, Y.M.; Saar, S.; Davison, J.; Wilkinson, A.; Jackson, B.G.; Pritchard, W.J.; De Long, J.R.; Oakley, S.; et al. Fungal diversity regulates plant-soil feedbacks in temperate grassland. Sci. Adv. 2018, 4, eaau4578. [Google Scholar] [CrossRef]
- Beirinckx, S.; Viaene, T.; Haegeman, A.; Debode, J.; Amery, F.; Vandenabeele, S.; Nelissen, H.; Inzé, D.; Tito, R.; Raes, J.; et al. Tapping into the maize root microbiome to identify bacteria that promote growth under chilling conditions. Microbiome 2020, 8, 54. [Google Scholar] [CrossRef] [PubMed]
- Yergeau, É.; Quiza, L.; Tremblay, J. Microbial indicators are better predictors of wheat yield and quality than N fertilization. FEMS Microbiol. Ecol. 2019, 96, fiz205. [Google Scholar] [CrossRef]
- Fitzpatrick, C.R.; Copeland, J.; Wang, P.W.; Guttman, D.S.; Kotanen, P.M.; Johnson, M.T.J. Assembly and ecological function of the root microbiome across angiosperm plant species. Proc. Natl. Acad. Sci. USA 2018, 115, E1157–E1165. [Google Scholar] [CrossRef]
- Rocca, J.D.; Simonin, M.; Blaszczak, J.R.; Ernakovich, J.G.; Gibbons, S.M.; Midani, F.S.; Washburne, A.D. The Microbiome Stress Project: Toward a Global Meta-Analysis of Environmental Stressors and Their Effects on Microbial Communities. Front. Microbiol. 2019, 9, 3272. [Google Scholar] [CrossRef]
- Francioli, D.; van Ruijven, J.; Bakker, L.; Mommer, L. Drivers of total and pathogenic soil-borne fungal communities in grassland plant species. Fungal Ecol. 2020, 48, 100987. [Google Scholar] [CrossRef]
- Glassman, S.I.; Martiny, J.B.H. Broadscale Ecological Patterns Are Robust to Use of Exact Sequence Variants versus Operational Taxonomic Units. MSphere 2018, 3, e00148-18. [Google Scholar] [CrossRef] [PubMed]
- Forster, D.; Lentendu, G.; Filker, S.; Dubois, E.; Wilding, T.A.; Stoeck, T. Improving eDNA-based protist diversity assessments using networks of amplicon sequence variants. Environ. Microbiol. 2019, 21, 4109–4124. [Google Scholar] [CrossRef]
- Frøslev, T.G.; Kjøller, R.; Bruun, H.H.; Ejrnæs, R.; Brunbjerg, A.K.; Pietroni, C.; Hansen, A.J. Algorithm for post-clustering curation of DNA amplicon data yields reliable biodiversity estimates. Nat. Commun. 2017, 8, 1188. [Google Scholar] [CrossRef] [PubMed]
- Bálint, M.; Bahram, M.; Eren, A.M.; Faust, K.; Fuhrman, J.A.; Lindahl, B.; O’Hara, R.B.; Öpik, M.; Sogin, M.L.; Unterseher, M.; et al. Millions of reads, thousands of taxa: Microbial community structure and associations analyzed via marker genes. FEMS Microbiol. Rev. 2016, 40, 686–700. [Google Scholar] [CrossRef]
- Brown, S.P.; Veach, A.M.; Rigdon-Huss, A.R.; Grond, K.; Lickteig, S.K.; Lothamer, K.; Oliver, A.K.; Jumpponen, A. Scraping the bottom of the barrel: Are rare high throughput sequences artifacts? Fungal Ecol. 2015, 13, 221–225. [Google Scholar] [CrossRef]
- Balvočiūtė, M.; Huson, D.H. SILVA, RDP, Greengenes, NCBI and OTT—How do these taxonomies compare? BMC Genom. 2017, 18, 114. [Google Scholar] [CrossRef] [PubMed]
- Pruesse, E.; Quast, C.; Knittel, K.; Fuchs, B.M.; Ludwig, W.; Peplies, J.; Glöckner, F.O. SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 2007, 35, 7188–7196. [Google Scholar] [CrossRef]
- Cole, J.R.; Wang, Q.; Cardenas, E.; Fish, J.; Chai, B.; Farris, R.J.; Kulam-Syed-Mohideen, A.S.; McGarrell, D.M.; Marsh, T.; Garrity, G.M.; et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2008, 37, D141–D145. [Google Scholar] [CrossRef]
- DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [Google Scholar] [CrossRef]
- Federhen, S. The NCBI Taxonomy database. Nucleic Acids Res. 2011, 40, D136–D143. [Google Scholar] [CrossRef]
- Abarenkov, K.; Henrik Nilsson, R.; Larsson, K.-H.; Alexander, I.J.; Eberhardt, U.; Erland, S.; Høiland, K.; Kjøller, R.; Larsson, E.; Pennanen, T.; et al. The UNITE database for molecular identification of fungi—Recent updates and future perspectives. New Phytol. 2010, 186, 281–285. [Google Scholar] [CrossRef]
- Guillou, L.; Bachar, D.; Audic, S.; Bass, D.; Berney, C.; Bittner, L.; Boutte, C.; Burgaud, G.; de Vargas, C.; Decelle, J.; et al. The Protist Ribosomal Reference database (PR2): A catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res. 2012, 41, D597–D604. [Google Scholar] [CrossRef]
- Leinonen, R.; Akhtar, R.; Birney, E.; Bower, L.; Cerdeno-Tárraga, A.; Cheng, Y.; Cleland, I.; Faruque, N.; Goodgame, N.; Gibson, R.; et al. The European Nucleotide Archive. Nucleic Acids Res. 2010, 39, D28–D31. [Google Scholar] [CrossRef]
- Nakamura, Y.; Cochrane, G.; Karsch-Mizrachi, I. The International Nucleotide Sequence Database Collaboration. Nucleic Acids Res. 2012, 41, D21–D24. [Google Scholar] [CrossRef]
- Benson, D.A.; Karsch-Mizrachi, I.; Clark, K.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2011, 40, D48–D53. [Google Scholar] [CrossRef] [PubMed]
- Deshpande, V.; Wang, Q.; Greenfield, P.; Charleston, M.; Porras-Alfaro, A.; Kuske, C.R.; Cole, J.R.; Midgley, D.J.; Tran-Dinh, N. Fungal identification using a Bayesian classifier and the Warcup training set of internal transcribed spacer sequences. Mycologia 2016, 108, 1–5. [Google Scholar] [CrossRef]
- Kõljalg, U.; Nilsson, R.H.; Abarenkov, K.; Tedersoo, L.; Taylor, A.F.S.; Bahram, M.; Bates, S.T.; Bruns, T.D.; Bengtsson-Palme, J.; Callaghan, T.M.; et al. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 2013, 22, 5271–5277. [Google Scholar] [CrossRef]
- Nilsson, R.H.; Larsson, K.-H.; Taylor, A.F.S.; Bengtsson-Palme, J.; Jeppesen, T.S.; Schigel, D.; Kennedy, P.; Picard, K.; Glöckner, F.O.; Tedersoo, L.; et al. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2018, 47, D259–D264. [Google Scholar] [CrossRef]
- Santamaria, M.; Fosso, B.; Licciulli, F.; Balech, B.; Larini, I.; Grillo, G.; De Caro, G.; Liuni, S.; Pesole, G. ITSoneDB: A comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences. Nucleic Acids Res. 2018, 46, D127–D132. [Google Scholar] [CrossRef]
- Ankenbrand, M.J.; Keller, A.; Wolf, M.; Schultz, J.; Förster, F. ITS2 Database V: Twice as Much. Mol. Biol. Evol. 2015, 32, 3030–3032. [Google Scholar] [CrossRef] [PubMed]
- Öpik, M.; Vanatoa, A.; Vanatoa, E.; Moora, M.; Davison, J.; Kalwij, J.M.; Reier, Ü.; Zobel, M. The online database MaarjAM reveals global and ecosystemic distribution patterns in arbuscular mycorrhizal fungi (Glomeromycota). New Phytol. 2010, 188, 223–241. [Google Scholar] [CrossRef] [PubMed]
- Martorelli, I.; Helwerda, L.S.; Kerkvliet, J.; Gomes, S.I.F.; Nuytinck, J.; Werff, C.R.A.v.d.; Ramackers, G.J.; Gultyaev, A.P.; Merckx, V.S.F.T.; Verbeek, F.J. Fungal metabarcoding data integration framework for the MycoDiversity DataBase (MDDB). J. Integr. Bioinform. 2020, 17, 20190046. [Google Scholar] [CrossRef]
- Kodama, Y.; Shumway, M.; Leinonen, R.; on behalf of the International Nucleotide Sequence Database, C. The sequence read archive: Explosive growth of sequencing data. Nucleic Acids Res. 2012, 40, D54–D56. [Google Scholar] [CrossRef]
- Wilkinson, M.D.; Dumontier, M.; Aalbersberg, I.J.; Appleton, G.; Axton, M.; Baak, A.; Blomberg, N.; Boiten, J.-W.; da Silva Santos, L.B.; Bourne, P.E.; et al. The FAIR Guiding Principles for scientific data management and stewardship. Sci. Data 2016, 3, 160018. [Google Scholar] [CrossRef]
- Yilmaz, P.; Gilbert, J.A.; Knight, R.; Amaral-Zettler, L.; Karsch-Mizrachi, I.; Cochrane, G.; Nakamura, Y.; Sansone, S.-A.; Glöckner, F.O.; Field, D. The genomic standards consortium: Bringing standards to life for microbial ecology. ISME J. 2011, 5, 1565–1567. [Google Scholar] [CrossRef] [PubMed]
- ten Hoopen, P.; Finn, R.D.; Bongo, L.A.; Corre, E.; Fosso, B.; Meyer, F.; Mitchell, A.; Pelletier, E.; Pesole, G.; Santamaria, M.; et al. The metagenomic data life-cycle: Standards and best practices. GigaScience 2017, 6, gix047. [Google Scholar] [CrossRef] [PubMed]
- Glass, E.M.; Dribinsky, Y.; Yilmaz, P.; Levin, H.; Van Pelt, R.; Wendel, D.; Wilke, A.; Eisen, J.A.; Huse, S.; Shipanova, A.; et al. MIxS-BE: A MIxS extension defining a minimum information standard for sequence data from the built environment. ISME J. 2014, 8, 1–3. [Google Scholar] [CrossRef]
- Yilmaz, P.; Kottmann, R.; Field, D.; Knight, R.; Cole, J.R.; Amaral-Zettler, L.; Gilbert, J.A.; Karsch-Mizrachi, I.; Johnston, A.; Cochrane, G.; et al. Minimum information about a marker gene sequence (MIMARKS) and minimum information about any (x) sequence (MIxS) specifications. Nat. Biotechnol. 2011, 29, 415–420. [Google Scholar] [CrossRef]
- Jurburg, S.D.; Konzack, M.; Eisenhauer, N.; Heintz-Buschart, A. The archives are half-empty: An assessment of the availability of microbial community sequencing data. Commun. Biol. 2020, 3, 474. [Google Scholar] [CrossRef]
- Cristescu, M.E. From barcoding single individuals to metabarcoding biological communities: Towards an integrative approach to the study of global biodiversity. Trends Ecol. Evol. 2014, 29, 566–571. [Google Scholar] [CrossRef]
- Santos, A.; van Aerle, R.; Barrientos, L.; Martinez-Urtaza, J. Computational methods for 16S metabarcoding studies using Nanopore sequencing data. Comput. Struct. Biotechnol. J. 2020, 18, 296–305. [Google Scholar] [CrossRef]
- Nicholls, S.M.; Quick, J.C.; Tang, S.; Loman, N.J. Ultra-deep, long-read nanopore sequencing of mock microbial community standards. GigaScience 2019, 8, giz043. [Google Scholar] [CrossRef]
- Winand, R.; Bogaerts, B.; Hoffman, S.; Lefevre, L.; Delvoye, M.; Braekel, J.V.; Fu, Q.; Roosens, N.H.; Keersmaecker, S.C.D.; Vanneste, K. argeting the 16S rRNA Gene for Bacterial Identification in Complex Mixed Samples: Comparative Evaluation of Second (Illumina) and Third (Oxford Nanopore Technologies) Generation Sequencing Technologies. Int. J. Mol. Sci. 2019, 21, 298. [Google Scholar] [CrossRef]
- Sokol, H.; Leducq, V.; Aschard, H.; Pham, H.-P.; Jegou, S.; Landman, C.; Cohen, D.; Liguori, G.; Bourrier, A.; Nion-Larmurier, I.; et al. Fungal microbiota dysbiosis in IBD. Gut 2017, 66, 1039–1048. [Google Scholar] [CrossRef]
- Bahram, M.; Hildebrand, F.; Forslund, S.K.; Anderson, J.L.; Soudzilovskaia, N.A.; Bodegom, P.M.; Bengtsson-Palme, J.; Anslan, S.; Coelho, L.P.; Harend, H.; et al. Structure and function of the global topsoil microbiome. Nature 2018, 560, 233–237. [Google Scholar] [CrossRef]
- Ribière, C.; Beugnot, R.; Parisot, N.; Gasc, C.; Defois, C.; Denonfoux, J.; Boucher, D.; Peyretaillade, E.; Peyret, P. Targeted Gene Capture by Hybridization to Illuminate Ecosystem Functioning. In Microbial Environmental Genomics (MEG); Martin, F., Uroz, S., Eds.; Springer: New York, NY, USA, 2016; pp. 167–182. [Google Scholar] [CrossRef]
- Gasc, C.; Peyret, P. Hybridization capture reveals microbial diversity missed using current profiling methods. Microbiome 2018, 6, 61. [Google Scholar] [CrossRef]
Primer Pair | Sequence 5′-3′ | Tm (°C) * | Amplified Region | Amplicon Length | Reference |
---|---|---|---|---|---|
515fB | GTGYCAGCMGCCGCGGTAA | 63.6 | V4 | 253 | [50] |
806rB | GGACTACNVGGGTWTCTAAT | 51.2 | [51] | ||
515fB | GTGYCAGCMGCCGCGGTAA | 63.6 | V4-V5 | 394 | [50] |
926r | CCGYCAATTYMTTTRAGTTT | 48.9 | [52] | ||
341f | CCTACGGGAGGCAGCAG | 58.2 | V3-V4 | 418 | [37] |
B805r | GACTACHVGGGTATCTAATCC | 51.3 | |||
799f | AACMGGATTAGATACCCKG | 50.9 | V5–V6 | 301 | [53] |
1115r | AGGGTTGCGCTCGTTG | 56.1 | [54] | ||
799f | AACMGGATTAGATACCCKG | 50.9 | V5-V7 | 377 | [53] |
1193r | ACGTCATCCCCACCTTCC | 57.1 | [55] | ||
967f | CAACGCGAAGAACCTTACC | 53.8 | V6-V8 | 405 | [56] |
1391r | GACGGGCGGTGWGTRCA | 59.5 | [57] | ||
68f | TNANACATGCAAGTCGRRCG | 55.5 | V1-V3 | 438 | [58] |
518r | WTTACCGCGGCTGCTG | 56 | [59] |
Primer Pair | Sequence 5′-3′ | Tm (°C) * | Amplified Region | Amplicon Length | Reference |
---|---|---|---|---|---|
515fB | GTGYCAGCMGCCGCGGTAA | 63.6 | V4 | 253 | [50] |
806rB | GGACTACNVGGGTWTCTAAT | 51.2 | [51] | ||
340f | CCCTAYGGGGYGCASCAG | 61.3 | V3-V4 | 388 | [63] |
806rB | GGACTACNVGGGTWTCTAAT | 51.2 | [51] | ||
SSU1ArF | TCCGGTTGATCCYGCBRG | 59.2 | V1-V4 | 491 | [62] |
SSU520R | GCTACGRRYGYTTTARRC | 51 | |||
349f | GYGCASCAGKCGMGAAW | 57.7 | V3-V4 | 111 | [64] |
519r | TTACCGCGGCKGCTG | 57.6 | [37] | ||
Parch519f | CAGCCGCCGCGGTAA | 59.4 | V4-V5 | 386 | [65] |
Arch915r | GTGCTCCCCCGCCAATTCCT | 62.9 | [66] | ||
1106F | TTWAGTCAGGCAACGAGC | 52.5 | V7-V8 | 280 | [67] |
1378R | TGTGCAAGGAGCAGGGAC | 57.9 |
Primer Pair | Sequence 5′-3′ | Tm (°C) * | Amplified Region | Amplicon Length | Reference |
---|---|---|---|---|---|
ITS1f | CTTGGTCATTTAGAGGAAGTAA | 49.7 | ITS1 | 357 | [99] |
ITS2r | GCTGCGTTCTTCATCGATGC | 57 | |||
ITS1F_KYO2 | TAGAGGAAGTAAAAGTCGTAA | 48 | ITS1 | 358 | [100] |
ITS2_KYO2 | TTYRCTRCGTTCTTCATC | 48.4 | |||
ITS3 | GCATCGATGAAGAACGCAGC | 57 | ITS2 | 306 | [99] |
ITS4 | TCCTCCGCTTATTGATATGC | 52.1 | |||
gITS7 | GTGARTCATCGARTCTTTG | 48.3 | ITS2 | 288 | [101] |
ITS4ngs | TTCCTSCGCTTATTGATATGC | 52.9 | [102] | ||
fITS7 | GTGARTCATCGAATCTTTG | 47.3 | ITS2 | 292 | [101] |
ITS4 | TCCTCCGCTTATTGATATGC | 52.1 | [99] | ||
ITS86f | GTGAATCATCGAATCTTTGAA | 48.6 | ITS2 | 290 | [103] |
ITS4 | TCCTCCGCTTATTGATATGC | 52.1 | [99] |
Primer Pair | Sequence 5′-3′ | Tm (°C) * | Amplified Region | Amplicon Length | Reference |
---|---|---|---|---|---|
NS1/Euk20f | GTAGTCATATGCTTGTCTC | 47.2 | V1-V3 | 507 | [99,127] |
Euk516r | ACCAGACTTGCCCTCC | 54.3 | [128] | ||
18S_0067a_deg | AAGCCATGCATGYCTAAGTATMA | 54.4 | V1-V3 | 310 | [129] |
NSR 399 | TCTCAGGCTCCYTCTCCGG | 59.7 | |||
fw_366 | ATTAGGGTTCGATTCCGGAGAGG | 58.2 | V3 | 180 | [130] |
rv_586 | CTGGAATTACCGCGGSTGCTG | 61 | |||
TAReuk454FWD1/V4_1f | CCAGCASCYGCGGTAATTCC/CCAGCASCYGCGGTAATWCC | 60.1/59.9 | V4 | 391 | [131] |
TAReukREV3 | ACTTTCGTTCTTGATYRA | 45.9 | [132] | ||
616*f | TTAAARVGYTCGTAGTYG | 47.1 | V4-V5 | 504 | [133] |
1132r | CCGTCAATTHCTTYAART | 45.4 | |||
18S_allshorts-f | TTTGTCTGSTTAATTSCG | 47.7 | V7 | 109 | [134] |
18S_allshort-r | TCACAGACCTGTTATTGC | 49.4 | |||
V8f | ATAACAGGTCTGTGATGCCCT | 55.9 | V8-V9 | 339 | [135] |
1510R | CCTTCYGCAGGTTCACCTAC | 56.6 | [125] | ||
1380F/1389F | CCCTGCCHTTTGTACACAC/TTGTACACACCGCCC | 54.6/51.9 | V9 | 141/136 | [125] |
1510R | CCTTCYGCAGGTTCACCTAC | 56.6 | |||
1391F | GTACACACCGCCCGTC | 56.1 | V9 | 127 | [123] |
EukBr | TGATCCTTCTGCAGGTTCACCTAC | 58.4 | [124] |
Database/Release | Marker/Taxa | URL * | Reference |
---|---|---|---|
SILVA/138.1 | 16S, 18S SSU, 23S, 28S, LSU rRNA sequences/Archaea, Prokaryotes, Eukaryotes | www.arb-silva.de | [205] |
Ribosomal Database Project (RDP)/11 | 16S, 28S rRNA sequences/Prokaryotes, Archaea and Fungi | rdp.cme.msu.edu | [207] |
Greengenes/12_10 | 16S rRNA sequences/Archaea and Bacteria | greengenes.secondgenome.com | [207] |
National Center for Biotechnology Information (NCBI) GenBank/241.0 | raw sequences/Archaea, Prokaryotes, Eukaryotes | www.ncbi.nlm.nih.gov | [208] |
UNITE/8.2 | nuclear ribosomal ITS region sequences/Eukaryotes | unite.ut.ee | [209], |
Protist Reference Database (PR2)/4.12.0 | 18S rRNA sequences/Eukaryotes | pr2-database.org | [210] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Francioli, D.; Lentendu, G.; Lewin, S.; Kolb, S. DNA Metabarcoding for the Characterization of Terrestrial Microbiota—Pitfalls and Solutions. Microorganisms 2021, 9, 361. https://doi.org/10.3390/microorganisms9020361
Francioli D, Lentendu G, Lewin S, Kolb S. DNA Metabarcoding for the Characterization of Terrestrial Microbiota—Pitfalls and Solutions. Microorganisms. 2021; 9(2):361. https://doi.org/10.3390/microorganisms9020361
Chicago/Turabian StyleFrancioli, Davide, Guillaume Lentendu, Simon Lewin, and Steffen Kolb. 2021. "DNA Metabarcoding for the Characterization of Terrestrial Microbiota—Pitfalls and Solutions" Microorganisms 9, no. 2: 361. https://doi.org/10.3390/microorganisms9020361
APA StyleFrancioli, D., Lentendu, G., Lewin, S., & Kolb, S. (2021). DNA Metabarcoding for the Characterization of Terrestrial Microbiota—Pitfalls and Solutions. Microorganisms, 9(2), 361. https://doi.org/10.3390/microorganisms9020361