Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth
Abstract
1. Introduction
2. Materials and Methods
2.1. Data Acquisition
2.1.1. Time Series of Gene Expression
2.1.2. SigB Regulon
2.2. Kinetic Model of Gene Expression
2.3. Data Preprocessing
2.4. Promoter Binding Motif Analysis
2.5. Transcription In Vitro
2.5.1. SigB Cloning
2.5.2. Media, Growth Conditions, Protein Purification
2.5.3. PCR of DNA Templates
2.5.4. In Vitro Transcription Assays
3. Results and Discussion
3.1. Modeling of the SigB Regulon
3.2. Binding Motif Analysis of Predicted SigB-Dependent Transcription of the Genes Expressed during Outgrowth
3.3. Experimental Verification of Selected Promoters
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Paget, M.S. Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution. Biomolecules 2015, 5, 1245. [Google Scholar] [CrossRef] [PubMed]
- Loskot, P.; Atitey, K.; Mihaylova, L. Comprehensive Review of Models and Methods for Inferences in Bio-Chemical Reaction Networks. Front. Genet. 2019, 10, 549. [Google Scholar] [CrossRef]
- Wang, Y.R.; Huang, H. Review on statistical methods for gene network reconstruction using expression data. J. Theor. Biol. 2014, 362, 53–61. [Google Scholar] [CrossRef]
- Margolin, A.A.; Nemenman, I.; Basso, K.; Wiggins, C.; Stolovitzky, G.; Dalla-Favera, R.; Califano, A. ARACNE: An Algorithm for the Reconstruction of Gene Regulatory Networks in a Mammalian Cellular Context. BMC Bioinform. 2006, 7, 1. [Google Scholar] [CrossRef] [PubMed]
- Yeung, K.Y.; Dombek, K.M.; Lo, K.; Mittler, J.E.; Zhu, J.; Schadt, E.E.; Bumgarner, R.; Raftery, A.E. Construction of regulatory networks using expression time-series data of a genotyped population. Proc. Natl. Acad. Sci. USA 2011, 108, 19436–19441. [Google Scholar] [CrossRef] [PubMed]
- Modrak, M.; Vohradsky, J. Genexpi: A toolset for identifying regulons and validating gene regulatory networks using time-course expression data. BMC Bioinform. 2018, 19, 137. [Google Scholar] [CrossRef]
- De Smet, R.; Marchal, K. Advantages and limitations of current network inference methods. Nat. Rev. Genet. 2010, 8, 717–729. [Google Scholar] [CrossRef]
- Tiwari, A.; Balázsi, G.; Gennaro, M.L.; Igoshin, O.A. The interplay of multiple feedback loops with post-translational kinetics results in bistability of mycobacterial stress response. Phys. Biol. 2010, 7, 036005. [Google Scholar] [CrossRef]
- Chauhan, R.; Ravi, J.; Datta, P.; Chen, T.; Schnappinger, D.; Bassler, T.C.K.E.; Balázsi, G.; Gennaro, M.L. Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis. Nat. Commun. 2016, 7, 11062. [Google Scholar] [CrossRef]
- Nannapaneni, P.; Hertwig, F.; Depke, M.; Hecker, M.; Mäder, U.; Völker, U.; Steil, L.; Van Hijum, S.A.F.T. Defining the structure of the general stress regulon of Bacillus subtilis using targeted microarray analysis and random forest classification. Microbiology 2012, 158, 696–707. [Google Scholar] [CrossRef]
- MacQuarrie, K.L.; Fong, A.P.; Morse, R.H.; Tapscott, S.J. Genome-wide transcription factor binding: Beyond direct target regulation. Trends Genet. 2011, 27, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Harper, W.F. Bacillus spore awakening: Recent discoveries and technological developments. Curr. Opin. Biotechnol. 2020, 64, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Shorenstein, R.G.; Losick, R. Purification and properties of the sigma subunit of ribonucleic acid polymerase from vegetative Bacillus subtilis. J. Biol. Chem. 1973, 248, 6163–6169. [Google Scholar] [PubMed]
- Price, C.W.; Doi, R.H. Genetic mapping of rpoD implicates the major sigma factor of Bacillus subtilis RNA polymerase in sporulation initiation. Mol. Genet. Genom. 1985, 201, 88–95. [Google Scholar] [CrossRef] [PubMed]
- Haldenwang, W.G. The sigma factors of Bacillus subtilis. Microbiol. Rev. 1995, 59, 1–30. [Google Scholar] [CrossRef]
- Matsumoto, T.; Nakanishi, K.; Asai, K.; Sadaie, Y. Transcriptional analysis of the ylaABCD operon of Bacillus subtilis encoding a sigma factor of extracytoplasmic function family. Genes Genet. Syst. 2005, 80, 385–393. [Google Scholar] [CrossRef][Green Version]
- Helmann, J.D. Bacillus subtilis extracytoplasmic function (ECF) sigma factors and defense of the cell envelope. Curr. Opin. Microbiol. 2016, 30, 122–132. [Google Scholar] [CrossRef]
- Nicolas, P.; Mäder, U.; Dervyn, E.; Rochat, T.; LeDuc, A.; Pigeonneau, N.; Bidnenko, E.; Marchadier, E.; Hoebeke, M.; Aymerich, S.; et al. Condition-Dependent Transcriptome Reveals High-Level Regulatory Architecture in Bacillus subtilis. Science 2012, 335, 1103–1106. [Google Scholar] [CrossRef]
- McDonnell, E.G.; Wood, H.; Devine, K.M.; McConnell, D.J. Genetic control of bacterial suicide: Regulation of the induction of PBSX in Bacillus subtilis. J. Bacteriol. 1994, 176, 5820–5830. [Google Scholar] [CrossRef][Green Version]
- Hecker, M.; Pané-Farré, J.; Uwe, V. SigB-Dependent General Stress Response inBacillus subtilisand Related Gram-Positive Bacteria. Annu. Rev. Microbiol. 2007, 61, 215–236. [Google Scholar] [CrossRef]
- Wise, A.A.; Price, C.W. Four additional genes in the sigB operon of Bacillus subtilis that control activity of the general stress factor sigma B in response to environmental signals. J. Bacteriol. 1995, 177, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Locke, J.C.W.; Young, J.W.; Fontes, M.; Jiménez, M.J.H.; Elowitz, M.B. Stochastic Pulse Regulation in Bacterial Stress Response. Science 2011, 334, 366–369. [Google Scholar] [CrossRef] [PubMed]
- Keijser, B.J.F.; Ter Beek, A.; Rauwerda, H.; Schuren, F.; Montijn, R.; Van Der Spek, H.; Brul, S. Analysis of Temporal Gene Expression during Bacillus subtilis Spore Germination and Outgrowth. J. Bacteriol. 2007, 189, 3624–3634. [Google Scholar] [CrossRef] [PubMed]
- Michna, R.H.; Commichau, F.M.; Tödter, D.; Zschiedrich, C.P.; Stülke, J. SubtiWiki—A database for the model organism Bacillus subtilis that links pathway, interaction and expression information. Nucleic Acids Res. 2014, 42, D692–D698. [Google Scholar] [CrossRef]
- Price, C.W.; Fawcett, P.; Cérémonie, H.; Su, N.; Murphy, C.K.; Youngman, P. Genome-wide analysis of the general stress response in Bacillus subtilis. Mol. Microbiol. 2002, 41, 757–774. [Google Scholar] [CrossRef]
- Helmann, J.D.; Wu, M.F.W.; Kobel, P.A.; Gamo, F.-J.; Wilson, M.; Morshedi, M.M.; Navre, M.; Paddon, C. Global Transcriptional Response of Bacillus subtilis to Heat Shock. J. Bacteriol. 2001, 183, 7318–7328. [Google Scholar] [CrossRef]
- Petersohn, A.; Brigulla, M.; Haas, S.; Jörg, D.; Völker, U.; Hecker, M. Global Analysis of the General Stress Response of Bacillus subtilis Global Analysis of the General Stress Response of Bacillus subtilis. J. Bacteriol. 2001, 183, 5617–5631. [Google Scholar] [CrossRef]
- Arrieta-Ortiz, M.L.; Hafemeister, C.; Bate, A.R.; Chu, T.; Greenfield, A.; Shuster, B.; Barry, S.N.; Gallitto, M.; Liu, B.; Kacmarczyk, T.; et al. An experimentally supported model of the Bacillus subtilis global transcriptional regulatory network. Mol. Syst. Biol. 2015, 11, 839. [Google Scholar] [CrossRef]
- Helmann, J.D.; Márquez, L.M.; Chamberlin, M.J. Cloning, sequencing, and disruption of the Bacillus subtilis sigma 28 gene. J. Bacteriol. 1988, 170, 1568–1574. [Google Scholar] [CrossRef]
- Petersohn, A.; Bernhardt, J.; Gerth, U.; Höper, D.; Koburger, T.; Völker, U.; Hecker, M.; Bernhardt, R.G.; Gerth, U.L.F. Identification of ς B -Dependent Genes in Bacillus subtilis Using a Promoter Consen-sus-Directed Search and Oligonucleotide Hybridization Identification of B -Dependent Genes in Bacillus subtilis Using a Promoter Consensus-Directed Search and Oligonucleo. J. Bacteriol. 1999, 181, 5718–5724. [Google Scholar] [CrossRef]
- Zhu, B.; Stülke, J. SubtiWiki in 2018: From genes and proteins to functional network annotation of the model organism Bacillus subtilis. Nucleic Acids Res. 2018, 46, D743–D748. [Google Scholar] [CrossRef] [PubMed]
- Vohradsky, J. Neural network model of gene expression. FASEB J. 2001, 15, 846–854. [Google Scholar] [CrossRef]
- To, C.C.; Vohradsky, J. Supervised inference of gene-regulatory networks. BMC Bioinform. 2008, 9, 2. [Google Scholar] [CrossRef] [PubMed]
- Vu, T.T.; Vohradsky, J. Nonlinear differential equation model for quantification of transcriptional regulation applied to microarray data of Saccharomyces cerevisiae. Nucleic Acids Res. 2006, 35, 279–287. [Google Scholar] [CrossRef] [PubMed]
- Vu, T.T.; Vohradsky, J. Inference of active transcriptional networks by integration of gene expression kinetics modeling and multisource data. Genomics 2009, 93, 426–433. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ramaniuk, O.; Černý, M.; Krásný, L.; Vohradsky, J. Kinetic modelling and meta-analysis of the B. subtilis SigA regulatory network during spore germination and outgrowth. Biochim. Biophys. Acta Bioenerg. 2017, 1860, 894–904. [Google Scholar] [CrossRef]
- Rabatinová, A.; Šanderová, H.; Matějčková, J.J.; Korelusová, J.; Sojka, L.; Barvík, I.; Papoušková, V.; Sklenář, V.; Žídek, L.; Krásný, L. The Subunit of RNA Polymerase Is Required for Rapid Changes in Gene Expression and Competitive Fitness of the Cell. J. Bacteriol. 2013, 195, 2603–2611. [Google Scholar] [CrossRef]
- Qi, Y.; Hulett, F.M. PhoP-P and RNA polymerase sigmaA holoenzyme are sufficient for transcription of Pho regulon promoters in Bacillus subtilis: PhoP-P activator sites within the coding region stimulate transcription in vitro. Mol. Microbiol. 1998, 28, 1187–1197. [Google Scholar] [CrossRef]
- De Saro, F.J.L.; Woody, A.-Y.M.; Helmann, J.D. Structural Analysis of theBacillus subtilisδ Factor: A protein Polyanion which Displaces RNA from RNA Polymerase. J. Mol. Biol. 1995, 252, 189–202. [Google Scholar] [CrossRef]
- Sojka, L.; Kouba, T.; Barvík, I.; Šanderová, H.; Maderová, Z.; Jonák, J.; Krásný, L. Rapid changes in gene expression: DNA determinants of promoter regulation by the concentration of the transcription initiating NTP in Bacillus subtilis. Nucleic Acids Res. 2011, 39, 4598–4611. [Google Scholar] [CrossRef]
- Meyer, F.M.; Jules, M.; Mehne, F.M.P.; Le Coq, M.; Landmann, J.J.; Görke, B.; Aymerich, S.; Stülke, J. Malate-Mediated Carbon Catabolite Repression in Bacillus subtilis Involves the HPrK/CcpA Pathway. J. Bacteriol. 2011, 193, 6939–6949. [Google Scholar] [CrossRef] [PubMed]
- Saxild, H.H.; Brunstedt, K.; Nielsen, K.I.; Jarmer, H.; Nygaard, P. Definition of the Bacillus subtilisPurR Operator Using Genetic and Bioinformatic Tools and Expansion of the PurR Regulon with glyA, guaC,pbuG, xpt-pbuX, yqhZ-folD, and pbuO. J. Bacteriol. 2001, 183, 6175–6183. [Google Scholar] [CrossRef] [PubMed]
Gene | CLASS | Transcription | Verified TNX | Spacer Length | Motifs | −35 | Spacer | −10 | |
---|---|---|---|---|---|---|---|---|---|
pgcA (yhxB,gtaC,gtaE) | BSU09310 | I | 1 | 1 | 16 | −35, −10 | CGTTTA | TTTTTTGATATCAATT | GGGTAAGAACATATAAAGA |
yjlB | BSU12270 | I | 1 | 1 | 15 | −35, −10 | TGTTTG | GCGAACCGCTATATG | TGGAAGACAAAAAAGGGAG |
nhaX (yheK) | BSU09690 | I | 1 | 1 | 15 | −35, −10 | AGGTTA | ATTGTGCTCAAATTC | GGGTAGTAGTGTTGTAAGA |
cadA (yvgW) | BSU33490 | 0 | 15 | −35, −10 | TGTTTT | TCATTGACACTTTCT | TGGAAAACAACATATAATA | ||
yqhY | BSU24330 | I | 1 | 1 | 16 | −35, −10 | GGTTTC | GCTTGCTAATGAAATT | GGGTATCCTGTAATTATAA |
yflT | BSU07550 | I | 1 | 1 | 14 | −35, −10 | TGTTTC | AGGTACAGACGATC | GGGTATGAAAGAAATATAG |
rsgA (cpgA, yloQ) | BSU15780 | 0 | 14 | −35, −10 | AGATTG | AACCAGGCCAAAAA | GGGTACTATCAAGTAATGG | ||
ctc | BSU00520 | I | 1 | 1 | 15 | −35, −10 | GGTTTA | AATCCTTATCGTTAT | GGGTATTGTTTGTAATAGG |
phoH (yqfE) | BSU25340 | I | 1 | 1 | 15 | −35, −10 | AGTTCA | AGAAGGCATTAAATT | GGGTAAACAGGATGTAGAG |
hpf (yviI,yvyD) | BSU35310 | I | 1 | 15 | −35, −10 | TGTTTC | AGCAGGAATTGTAAA | GGGTAAAAGAGAAATAGAT | |
glyA (glyC,ipc-34d) | BSU36900 | II | 1 | - | −10 | - | - | TGGTAAAAACAAAGAACAG | |
yhfP | BSU10320 | II | 0 | - | −10 | - | - | AGGAAGAAATAAGATGAAC | |
xynA | BSU18840 | III | 0 | 28 | −35, −10 | TGTTTT | AAATGTATACGAGTGCTACCTCAAAGTC | GGAAAAAATATTATAGGAG | |
yhfI | BSU10240 | III | 0 | 24 | −35, −10 | TGTTTA | AAACATGCTTTTTTCAAGAAAAAT | GGGTATATTGAAGGAGGAC | |
pfkA (pfk) | BSU29190 | III | 0 | 35 | −35, −10 | GGTTTC | ATAGGGAGGATGGAGATCCCTTTTCATTGTTTTTA | GGGCAATGATCATGTTATG | |
uppS (yluA) | BSU16530 | III | 0 | 46 | −35, −10 | TGTTTA | CAGGGGGTTTTTTTGTTAATACTGTTGATTACATTGATTATCAGCA | GGGAATGTAACCTTTTTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vohradsky, J.; Schwarz, M.; Ramaniuk, O.; Ruiz-Larrabeiti, O.; Vaňková Hausnerová, V.; Šanderová, H.; Krásný, L. Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth. Microorganisms 2021, 9, 112. https://doi.org/10.3390/microorganisms9010112
Vohradsky J, Schwarz M, Ramaniuk O, Ruiz-Larrabeiti O, Vaňková Hausnerová V, Šanderová H, Krásný L. Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth. Microorganisms. 2021; 9(1):112. https://doi.org/10.3390/microorganisms9010112
Chicago/Turabian StyleVohradsky, Jiri, Marek Schwarz, Olga Ramaniuk, Olatz Ruiz-Larrabeiti, Viola Vaňková Hausnerová, Hana Šanderová, and Libor Krásný. 2021. "Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth" Microorganisms 9, no. 1: 112. https://doi.org/10.3390/microorganisms9010112
APA StyleVohradsky, J., Schwarz, M., Ramaniuk, O., Ruiz-Larrabeiti, O., Vaňková Hausnerová, V., Šanderová, H., & Krásný, L. (2021). Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth. Microorganisms, 9(1), 112. https://doi.org/10.3390/microorganisms9010112