Nasal Carriage of Antimicrobial-Resistant Staphylococci by Fallow Deer (Dama dama) Taken in a Natural Park of Tuscany, Central Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sampling
2.2. Staphylococcus spp. Isolation and Characterization
2.3. Antimicrobial Susceptibility Tests
2.4. Detection of Virulence and Antimicrobial Resistance Genes
2.5. Statistical Analyses
3. Results
3.1. Isolation and Typing of Staphylococci
3.2. Antimicrobial Resistance
3.3. Molecular Analyses
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Schwendener, S.; Perreten, V. The bla and mec families of β-lactam resistance genes in the genera Macrococcus, Mammaliicoccus and Staphylococcus: An in-depth analysis with emphasis on Macrococcus. J. Antimicrob. Chemother. 2022, 77, 1796–1827. [Google Scholar] [CrossRef] [PubMed]
- Sousa, M.; Silva, V.; Silva, A.; Silva, N.; Ribeiro, J.; Tejedor-Junco, M.T.; Capita, R.; Chenouf, N.S.; Alonso-Calleja, C.; Rodrigues, T.M.; et al. Staphylococci among wild european rabbits from the azores: A potential zoonotic issue? J. Food Prot. 2020, 83, 1110–1114. [Google Scholar] [CrossRef] [PubMed]
- Haag, A.F.; Fitzgerald, J.R.; Penadés, J.R. Staphylococcus aureus in Animals. Microbiol. Spectr. 2019, 7, 10–1128. [Google Scholar] [CrossRef]
- Sasaki, T.; Tsubakishita, S.; Tanaka, Y.; Sakusabe, A.; Ohtsuka, M.; Hirotaki, S.; Kawakami, T.; Fukata, T.; Hiramatsu, K. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J. Clin. Microbiol. 2010, 48, 765–769. [Google Scholar] [CrossRef]
- Becker, K.; Both, A.; Weißelberg, S.; Heilmann, C.; Rohde, H. Emergence of coagulase-negative staphylococci. Expert Rev. Anti-Infect. Ther. 2020, 18, 349–366. [Google Scholar] [CrossRef]
- Becker, K.; Ballhausen, B.; Köck, R.; Kriegeskorte, A. Methicillin resistance in Staphylococcus isolates: The “mec alphabet” with specific consideration of mecC, a mec homolog associated with zoonotic S. aureus lineages. Int. J. Med. Microbiol. 2014, 304, 794–804. [Google Scholar] [CrossRef]
- Osman, K.; Alvarez-Ordóñez, A.; Ruiz, L.; Badr, J.; ElHofy, F.; Al-Maary, K.S.; Moussa, I.M.I.; Hessain, A.M.; Orabi, A.; Saad, A.; et al. Antimicrobial resistance and virulence characterization of Staphylococcus aureus and coagulase-negative staphylococci from imported beef meat. Ann. Clin. Microbiol. Antimicrob. 2017, 16, 35. [Google Scholar] [CrossRef]
- Al-Haqan, A.; Boswihi, S.S.; Pathan, S.; Udo, E.E. Antimicrobial resistance and virulence determinants in coagulase-negative staphylococci isolated mainly from preterm neonates. PLoS ONE 2020, 15, e0236713. [Google Scholar] [CrossRef]
- Yu, Z.; Wang, Y.; Chen, Y.; Huang, M.; Wang, Y.; Shen, Z.; Xia, Z.; Li, G. Antimicrobial resistance of bacterial pathogens isolated from canine urinary tract infections. Vet. Microbiol. 2020, 241, 108540. [Google Scholar] [CrossRef]
- Bertelloni, F.; Cagnoli, G.; Ebani, V.V. Virulence and antimicrobial resistance in canine Staphylococcus spp. Isolates. Microorganisms 2021, 9, 515. [Google Scholar] [CrossRef]
- Lubna; Hussain, T.; Shami, A.; Rafiq, N.; Khan, S.; Kabir, M.; Khan, N.U.; Khattak, I.; Kamal, M.; Usman, T. Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle. Antibiotics 2023, 12, 673. [Google Scholar] [CrossRef] [PubMed]
- Morais, C.; Costa, S.S.; Leal, M.; Ramos, B.; Andrade, M.; Ferreira, C.; Abrantes, P.; Pomba, C.; Couto, I. Genetic diversity and antimicrobial resistance profiles of Staphylococcus pseudintermedius associated with skin and soft-tissue infections in companion animals in Lisbon, Portugal. Front. Microbiol. 2023, 14, 1100. [Google Scholar] [CrossRef] [PubMed]
- Bertelloni, F.; Cagnoli, G.; Bresciani, F.; Scotti, B.; Lazzerini, L.; Marcucci, M.; Colombani, G.; Ebani, V.V. Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms. Antibiotics 2023, 12, 636. [Google Scholar] [CrossRef] [PubMed]
- Marek, A.; Stepień-Pyśniak, D.; Pyzik, E.; Adaszek, Ł.; Wilczyński, J.; Winiarczyk, S. Occurrence and characterization of Staphylococcus bacteria isolated from poultry in Western Poland. Berl. Munch. Tierarztl. Wochenschr. 2016, 129, 147–152. [Google Scholar] [PubMed]
- Mlynarczyk-Bonikowska, B.; Kowalewski, C.; Krolak-Ulinska, A.; Marusza, W. Molecular Mechanisms of Drug Resistance in Staphylococcus aureus. Int. J. Mol. Sci. 2022, 23, 8088. [Google Scholar] [CrossRef]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2022 Zoonoses Report. EFSA J. 2023, 21, 222. [Google Scholar]
- Cieza, M.Y.R.; Bonsaglia, E.C.R.; Rall, V.L.M.; dos Santos, M.V.; Silva, N.C.C. Staphylococcal Enterotoxins: Description and Importance in Food. Pathogens 2024, 13, 676. [Google Scholar] [CrossRef]
- Kmieciak, W.; Szewczyk, E.M. Are zoonotic Staphylococcus pseudintermedius strains a growing threat for humans? Folia Microbiol. (Praha). 2018, 63, 743–747. [Google Scholar] [CrossRef]
- Santos, S.C.L.; Saraiva, M.M.S.; Moreira Filho, A.L.B.; Silva, N.M.V.; De Leon, C.M.G.; Pascoal, L.A.F.; Givisiez, P.E.N.; Gebreyes, W.A.; Oliveira, C.J.B. Swine as reservoirs of zoonotic borderline oxacillin-resistant Staphylococcus aureus ST398. Comp. Immunol. Microbiol. Infect. Dis. 2021, 79, 101697. [Google Scholar] [CrossRef]
- Nagase, N.; Sasaki, A.; Yamashita, K.; Shimizu, A.; Wakita, Y.; Kitai, S.; Kawano, J. Isolation and Species Distribution of Staphylococci from Animal and Human Skin. J. Vet. Med. Sci. 2002, 64, 245–250. [Google Scholar] [CrossRef]
- Monecke, S.; Gavier-Widén, D.; Hotzel, H.; Peters, M.; Guenther, S.; Lazaris, A.; Loncaric, I.; Müller, E.; Reissig, A.; Ruppelt-Lorz, A.; et al. Diversity of Staphylococcus aureus Isolates in European Wildlife. PLoS ONE 2016, 11, e0168433. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Seijas, C.; Mascarós, P.; Lizana, V.; Martí-Marco, A.; Arnau-Bonachera, A.; Chillida-Martínez, E.; Cardells, J.; Selva, L.; Viana, D.; Corpa, J.M. Genomic Characterization of Staphylococcus aureus in Wildlife. Animals 2023, 13, 1064. [Google Scholar] [CrossRef] [PubMed]
- Sahin-Tóth, J.; Albert, E.; Juhász, A.; Ghidán, Á.; Juhász, J.; Horváth, A.; Steward, M.C.; Dobay, O. Prevalence of Staphylococcus aureus in wild hedgehogs (Erinaceus europaeus) and first report of mecC-MRSA in Hungary. Sci. Total Environ. 2022, 815, 152858. [Google Scholar] [CrossRef] [PubMed]
- Dube, F.; Söderlund, R.; Lampinen Salomonsson, M.; Troell, K.; Börjesson, S. Benzylpenicillin-producing Trichophyton erinacei and methicillin resistant Staphylococcus aureus carrying the mecC gene on European hedgehogs—A pilot-study. BMC Microbiol. 2021, 21, 212. [Google Scholar] [CrossRef]
- Porrero, M.C.; Mentaberre, G.; Sánchez, S.; Fernández-Llario, P.; Casas-Díaz, E.; Mateos, A.; Vidal, D.; Lavín, S.; Fernández-Garayzábal, J.F.; Domínguez, L. Carriage of Staphylococcus aureus by Free-Living Wild Animals in Spain. Appl. Environ. Microbiol. 2014, 80, 4865. [Google Scholar] [CrossRef]
- Suzuki, Y.; Ishitsuka, T.; Takagi, M.; Sasaki, Y.; Kakuda, T.; Kobayashi, K.; Kubota, H.; Ono, H.K.; Kabeya, H.; Irie, T.; et al. Isolation and genetic characterization of Staphylococcus aureus from wild animal feces and game meats. Folia Microbiol. 2023, 69, 347–360. [Google Scholar] [CrossRef]
- Gnat, S.; Trościańczyk, A.; Nowakiewicz, A.; Majer-Dziedzic, B.; Ziółkowska, G.; Dziedzic, R.; Zieba, P.; Teodorowski, O. Experimental studies of microbial populations and incidence of zoonotic pathogens in the faeces of red deer (Cervus elaphus). Lett. Appl. Microbiol. 2015, 61, 446–452. [Google Scholar] [CrossRef]
- Ramos, B.; Rosalino, L.M.; Palmeira, J.D.; Torres, R.T.; Cunha, M.V. Antimicrobial resistance in commensal Staphylococcus aureus from wild ungulates is driven by agricultural land cover and livestock farming. Environ. Pollut. 2022, 303, 119116. [Google Scholar] [CrossRef]
- Tîrziu, E.; Bulucea, A.V.; Imre, K.; Nichita, I.; Muselin, F.; Dumitrescu, E.; Tîrziu, A.; Mederle, N.G.; Moza, A.; Bucur, I.M.; et al. The Behavior of Some Bacterial Strains Isolated from Fallow Deer Compared to Antimicrobial Substances in Western Romania. Antibiotics 2023, 12, 743. [Google Scholar] [CrossRef]
- Luzzago, C.; Lauzi, S.; Ehricht, R.; Monecke, S.; Corlatti, L.; Pedrotti, L.; Piccinini, R. Survey of Staphylococcus aureus carriage by free-living red deer (Cervus elaphus): Evidence of human and domestic animal lineages. Transbound. Emerg. Dis. 2022, 69, e1659. [Google Scholar] [CrossRef]
- Scopetani, C.; Chelazzi, D.; Martellini, T.; Pellinen, J.; Ugolini, A.; Sarti, C.; Cincinelli, A. Occurrence and characterization of microplastic and mesoplastic pollution in the Migliarino San Rossore, Massaciuccoli Nature Park (Italy). Mar. Pollut. Bull. 2021, 171, 112712. [Google Scholar] [CrossRef] [PubMed]
- Del Frate, M.; Bongi, P.; Tanzillo, L.; Russo, C.; Benini, O.; Sieni, S.; Scandura, M.; Apollonio, M. A Predator on the Doorstep: Kill Site Selection by a Lone Wolf in a Peri-Urban Park in a Mediterranean Area. Animals 2023, 13, 480. [Google Scholar] [CrossRef] [PubMed]
- Chapman, D.; Chapman, N. Fallow Deer: Their History, Distribution and Biology, 2nd ed.; Coch-y-bonddu Books: Machynlleth, UK, 1997. [Google Scholar]
- M02-A12; Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard—Twelfth Edition. CLSI (Clinical and Laboratory Standards Institute): Wayne, PA, USA, 2015.
- M07-A10; Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard—Tenth Edition. CLSI (Clinical and Laboratory Standards Institute): Wayne, PA, USA, 2015.
- CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated From Animals, 5th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standars Institute: Wayne, PA, USA, 2020. [Google Scholar]
- EUCAST (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 13.0; EUCAST (The European Committee on Antimicrobial Susceptibility Testing): Växjö, Sweden, 2023. [Google Scholar]
- CLSI (Clinical and Laboratory Standards Institute). M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application, 28th ed.; CLSI Supplement M100; CLSI (Clinical and Laboratory Standards Institute): Wayne, PA, USA, 2018. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; Roth, R.; Peters, G. Rapid and Specific Detection of Toxigenic Staphylococcus aureus: Use of Two Multiplex PCR Enzyme Immunoassays for Amplification and Hybridization of Staphylococcal Enterotoxin Genes, Exfoliative Toxin Genes, and Toxic Shock Syndrome Toxin 1 Gene. J. Clin. Microbiol. 1998, 36, 2548–2553. [Google Scholar] [CrossRef]
- Schnellmann, C.; Gerber, V.; Rossano, A.; Jaquier, V.; Panchaud, Y.; Doherr, M.G.; Thomann, A.; Straub, R.; Perreten, V. Presence of New mecA and mph(C) Variants Conferring Antibiotic Resistance in Staphylococcus spp. Isolated from the Skin of Horses before and after Clinic Admission. J. Clin. Microbiol. 2006, 44, 4444–4454. [Google Scholar] [CrossRef]
- Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562. [Google Scholar] [CrossRef]
- Silva, V.; Caniça, M.; Ferreira, E.; Vieira-Pinto, M.; Saraiva, C.; Pereira, J.E.; Capelo, J.L.; Igrejas, G.; Poeta, P. Multidrug-Resistant Methicillin-Resistant Coagulase-Negative Staphylococci in Healthy Poultry Slaughtered for Human Consumption. Antibiotics 2022, 11, 365. [Google Scholar] [CrossRef]
- Zhang, K.; McClure, J.A.; Elsayed, S.; Louie, T.; Conly, J.M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5026–5033. [Google Scholar] [CrossRef]
- Cuny, C.; Layer, F.; Strommenger, B.; Witte, W. Rare Occurrence of Methicillin-Resistant Staphylococcus aureus CC130 with a Novel mecA Homologue in Humans in Germany. PLoS ONE 2011, 6, e24360. [Google Scholar] [CrossRef]
- Bucur, I.M.; Moza, A.C.; Pop, M.; Nichita, I.; Gaspar, C.M.; Cojocaru, R.; Gros, R.V.; Boldea, M.V.; Tirziu, A.; Tirziu, E. Hunting Dynamics and Identification of Potentially Pathogenic Bacteria in European Fallow Deer (Dama dama) across Three Hunting Reserves in Western Romania. Microorganisms 2024, 12, 1236. [Google Scholar] [CrossRef]
- Rey Pérez, J.; Zálama Rosa, L.; García Sánchez, A.; Hermoso de Mendoza Salcedo, J.; Alonso Rodríguez, J.M.; Cerrato Horrillo, R.; Zurita, S.G.; Gil Molino, M. Multiple Antimicrobial Resistance in Methicillin-Resistant Staphylococcus sciuri Group Isolates from Wild Ungulates in Spain. Antibiotics 2021, 10, 920. [Google Scholar] [CrossRef] [PubMed]
- Ivbule, M.; Miklaševičs, E.; Čupane, L.; Berziņa, L.; Baliņš, A.; Valdovska, A. MRSA in pig population. Pol. J. Microbiol. 2017, 66, 383–392. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Flores, A.; Potel-Alvarellos, C.; Francisco-Tomé, M.; Constenla-Caramés, L.; Pérez-Roth, E.; López-Cotón, C.; Comesaña-Da Vila, E.; Eiroa-de la Puente, L.; Álvarez-Fernández, M. Methicillin-resistant Staphylococcus aureus in swine housed indoors in Galicia, Spain. Enferm. Infecc. Microbiol. Clin. 2020, 38, 16–20. [Google Scholar] [CrossRef]
- Zhao, N.; Cheng, D.; Yang, Z.; Liu, Y.; Wang, Y.; Jian, Y.; Wang, H.; Li, M.; Bae, T.; Liu, Q. Virulence adaption to environment promotes the age-dependent nasal colonization of Staphylococcus aureus. Emerg. Microbes Infect. 2022, 11, 1402–1415. [Google Scholar] [CrossRef]
- WHO (World Health Organization). AWaRe (Access, Watch, Reserve) Classification of Antibiotics for Evaluation and Monitoring of Use, 2023. In The Selection and Use of Essential Medicines 2023: Executive Summary of the Report of the 24th WHO Expert Committee on the Selection and Use of Es. Available online: https://www.who.int/publications/i/item/WHO-MHP-HPS-EML-2023.04 (accessed on 1 January 2024).
- Ryan, C.A.; McNeal, C.D.; Credille, B.C. Ceftiofur use and antimicrobial stewardship in the horse. Equine Vet. J. 2023, 55, 944–961. [Google Scholar] [CrossRef]
- Gaire, T.N.; Salas, J.; Dunmire, K.M.; Paulk, C.B.; Tokach, M.D.; Nagaraja, T.G.; Volkova, V.V. Faecal concentrations of ceftiofur metabolites in finisher pigs administered intramuscularly with ceftiofur. Vet. Med. Sci. 2021, 7, 1800–1806. [Google Scholar] [CrossRef]
- WHO (World Health Organization). WHO’s List of Medically Important Antimicrobials: A Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
- Lauková, A.; Bino, E.; Kubašová, I.; Strompfová, V.; Miltko, R.; Belzecki, G.; Pogány Simonová, M. Characterisation of Faecal Staphylococci from Roe Deer (Capreolus capreolus) and Red Deer (Cervus elaphus) and Their Susceptibility to Gallidermin. Probiotics Antimicrob. Proteins 2020, 12, 302–310. [Google Scholar] [CrossRef]
- Ruiz-Ripa, L.; Gómez, P.; Alonso, C.A.; Camacho, M.C.; Ramiro, Y.; de la Puente, J.; Fernández-Fernández, R.; Quevedo, M.Á.; Blanco, J.M.; Báguena, G.; et al. Frequency and Characterization of Antimicrobial Resistance and Virulence Genes of Coagulase-Negative Staphylococci from Wild Birds in Spain. Detection of tst-Carrying S. sciuri Isolates. Microorganisms 2020, 8, 1317. [Google Scholar] [CrossRef]
- Grabowski, Ł.; Gaffke, L.; Pierzynowska, K.; Cyske, Z.; Choszcz, M.; Węgrzyn, G.; Węgrzyn, A. Enrofloxacin—The Ruthless Killer of Eukaryotic Cells or the Last Hope in the Fight against Bacterial Infections? Int. J. Mol. Sci. 2022, 23, 3648. [Google Scholar] [CrossRef]
- Nemeghaire, S.; Argudín, M.A.; Feßler, A.T.; Hauschild, T.; Schwarz, S.; Butaye, P. The ecological importance of the Staphylococcus sciuri species group as a reservoir for resistance and virulence genes. Vet. Microbiol. 2014, 171, 342–356. [Google Scholar] [CrossRef]
- Abdullahi, I.N.; Fernández-Fernández, R.; Juárez-Fernández, G.; Martínez-álvarez, S.; Eguizábal, P.; Zarazaga, M.; Lozano, C.; Torres, C. Wild animals are reservoirs and sentinels of Staphylococcus aureus and MRSA clones: A problem with “one health” concern. Antibiotics 2021, 10, 1556. [Google Scholar] [CrossRef] [PubMed]
- Banaszkiewicz, S.; Tabiś, A.; Wałecki, B.; Łyżwińska, K.; Bystroń, J.; Bania, J. spa Types and Staphylococcal Enterotoxin Production of Staphylococcus aureus Isolated from Wild Boar. Microb. Ecol. 2023, 1, 2184–2191. [Google Scholar] [CrossRef] [PubMed]
- Hahaj-Siembida, A.; Nowakiewicz, A.; Korzeniowska-Kowal, A.; Szecówka, K.; Trościańczyk, A.; Zięba, P.; Kania, M.G. Red foxes (Vulpes vulpes) as a specific and underappreciated reservoir of resistant and virulent coagulase-positive Staphylococcus spp. strains. Res. Vet. Sci. 2023, 166, 105111. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer | Oligonucleotide Sequence (5′-3′) | Annealing Temperature | Amplicon Size (bp) | Reference |
---|---|---|---|---|---|
sea | SEA-3 | CCTTTGGAAACGGTTAAAACG | 55 °C | 127 | [40] |
SEA-4 | TCTGAACCTTCCCATCAAAAAC | ||||
seb | SEB-1 | TCGCATCAAACTGACAAACG | 477 | ||
SEB-4 | GCAGGTACTCTATAAGTGCCTGC | ||||
sec | SEC-3 | CTCAAGAACTAGACATAAAAGCTAGG | 271 | ||
SEC-4 | TCAAAATCGGATTAACATTATCC | ||||
sed | SED-3 | CTAGTTTGGTAATATCTCCTTTAAACG | 319 | ||
SED-4 | TTAATGCTATATCTTATAGGGTAAACATC | ||||
see | SEE-3 | CAGTACCTATAGATAAAGTTAAAACAAGC | 178 | ||
SEE-2 | TAACTTACCGTGGACCCTTC | ||||
tst1 | TST-3 | AAGCCCTTTGTTGCTTGCG | 447 | ||
TST-6 | ATCGAACTTTGGCCCATACTTT | ||||
mecA | MecA147-F | GTGAAGATATACCAAGTGATT | 50 °C | 147 | [44] |
MecA147-R | ATGCGCTATAGATTGAAAGGAT | ||||
mecC | mecLGA251 f | GCTCCTAATGCTAATGCA | 50 °C | 304 | [45] |
mecLGA251 r | TAAGCAATAATGACTACC | ||||
blaZ | blaZ-F | CAGTTCACATGCCAAAGAG | 50 °C | 772 | [41] |
blaZ-R | TACACTCTTGGCGGTTTC | ||||
ermA | ermA-F | TCTAAAAAGCATGTAAAAGAA | 52 °C | 645 | [42] |
ermA-R | CTTCGATAGTTTATTAATATTAG | ||||
ermB | ermB-F | GAAAAGTACTCAACCAAATA | 639 | ||
ermB-R | AGTAACGGTACTTAAATTGTTTA | ||||
ermC | ermC-F | TCAAAACATAATATAGATAAA | 642 | ||
ermC-R | GCTAATATTGTTTAAATCGTCAAT | ||||
msr(A/B) | msr(A/B)-F | GCAAATGGTGTAGGTAAGACAACT | 55 °C | 399 | [42] |
msr(A/B)-R | ATCATGTGATGTAAACAAAAT | ||||
mph(C) | mphC-F1 | ATGACTCGACATAATGAAAT | 45 °C | 900 | [41] |
mphC-R1 | CTACTCTTTCATACCTAACTC | ||||
aac(6′)- Ie- | aac(6′)- Ie- | CCAAGAGCAATAAGGGCATA | 60 °C | 220 | [43] |
aph(2″)- Ia_F | |||||
aph(2″)- Ia | aac(6′)- Ie- | CACTATCATAACCACTACCG | |||
aph(2″)- Ia_R |
Staphylococcus Species | Animal Age | Total of Isolates | ||||||
---|---|---|---|---|---|---|---|---|
Young (<1 Year) | Juvenile (>1 and <2 Years) | Adult (>2 Years) | ||||||
Number | % | Number | % | Number | % | Number | % | |
S. aureus | 27 | 40.30 | 5 | 33.33 | 34 | 36.17 | 66 | 37.50 |
S. hyicus | 20 | 29.85 | 1 | 6.67 | 13 | 13.83 | 34 | 19.32 |
S. sciuri | 5 | 7.46 | 8 | 53.33 | 19 | 20.21 | 32 | 18.18 |
S. chromogenes | 6 | 8.96 | 0 | 0.00 | 21 | 22.34 | 27 | 15.34 |
S. xylosus | 4 | 5.97 | 1 | 6.67 | 6 | 6.38 | 11 | 6.25 |
S. warneri | 4 | 5.97 | 0 | 0.00 | 1 | 1.06 | 5 | 2.84 |
S. devriesei | 1 | 1.49 | 0 | 0.00 | 0 | 0.00 | 1 | 0.57 |
Total | 67 | 15 | 94 | 176 |
Susceptible | Intermediate | Resistant | ||||
---|---|---|---|---|---|---|
N° | % | N° | % | N° | % | |
Penicillin | 124 | 70.45 | 0 | 0.00 | 52 | 29.55 |
Amoxicillin–clavulanate | 175 | 99.43 | 0 | 0.00 | 1 | 0.57 |
Cefoxitin | 172 | 97.73 | 0 | 0.00 | 4 | 2.27 |
Ceftiofur | 131 | 74.43 | 37 | 21.02 | 8 | 4.55 |
Chloramphenicol | 147 | 83.52 | 21 | 11.93 | 8 | 4.55 |
Tetracycline | 153 | 86.93 | 18 | 10.23 | 5 | 2.84 |
Enrofloxacin | 107 | 60.80 | 50 | 28.41 | 19 | 10.80 |
Ciprofloxacin | 127 | 72.16 | 35 | 19.89 | 14 | 7.95 |
Gentamicin | 154 | 87.50 | 10 | 5.68 | 12 | 6.82 |
Amikacin | 140 | 79.55 | 0 | 0.00 | 36 | 20.45 |
Trimethoprim–sulfamethoxazole | 154 | 87.50 | 8 | 4.55 | 14 | 7.95 |
Erythromycin | 58 | 32.95 | 109 | 61.93 | 9 | 5.11 |
Rifampicin | 119 | 67.61 | 17 | 9.66 | 40 | 22.73 |
Number of Isolates | ||||||||
---|---|---|---|---|---|---|---|---|
Resistance Profile | S. aureus | S. chromogenes | S. hyicus | S. xylosus | S. sciuri | S. warneri | S. devriesei | TOT |
No resistance | 37 | 17 | 17 | 5 | 10 | 4 | 1 | 91 |
AK | 3 | 1 | 1 | 5 | ||||
P | 1 | 4 #(2) | 10 | 3 | 3 | 21 | ||
CIP | 1 | 1 | ||||||
EFT | 1 | 1 | 2 | |||||
RD | 5 | 1 | 1 | 7 | ||||
SXT | 1 | 1 | ||||||
AK-SXT | 1 | 1 | ||||||
P-EFT | 1 | 1 | ||||||
P-RD | 1 | 1 | 1 | 3 | 6 | |||
P-SXT | 1 # | 1 | ||||||
CIP-AK | 1 | 1 | ||||||
ENR-AK | 1 | 1 | 2 | |||||
ENR-CIP | 1 | 1 | ||||||
ENR-RD | 1 | 1 | ||||||
P-AMC-FOX | 1 | 1 | ||||||
CN-AK-SXT | 1 | 1 | ||||||
P-AK-RD * | 1 | 4 | 5 | |||||
P-E-RD * | 1 | 1 | ||||||
P-ENR-E * | 1 | 1 | ||||||
TE-AK-RD * | 1 | 1 | ||||||
P-AK-SXT-RD * | 1 | 1 | 2 | |||||
P-CN-AK-RD * | 1 | 1 | ||||||
P-EFT-AK-RD * | 1 | 1 | ||||||
P-ENR-AK-RD * | 1 | 1 | ||||||
P-ENR-CIP-RD * | 1 | 1 | ||||||
C-CN-AK-E * | 1 | 1 | ||||||
CIP-CN-AK-RD * | 1 | 1 | ||||||
EFT-C-CN-AK * | 1 | 1 | ||||||
ENR-CIP-AK-RD * | 1 | 1 | ||||||
P-EFT-ENR-AK-RD * | 1 | 1 | ||||||
P-ENR-CIP-SXT-RD * | 1 | 1 | ||||||
P-ENR-CN-AK-RD * | 1 | 1 | ||||||
P-FOX-ENR-CIP-RD * | 1 | 1 | ||||||
P-C-TE-CN-AK-SXT * | 1 | 1 | ||||||
P-CIP-CN-AK-SXT-RD * | 1 | 1 | ||||||
P-EFT-C-CN-AK-RD * | 1 | 1 | ||||||
P-ENR-CIP-AK-SXT-RD * | 1 | 1 | ||||||
FOX-EFT-ENR-AK-E-RD * | 1 | 1 | ||||||
FOX-TE-ENR-SXT-E-RD * | 1 | 1 | ||||||
C-ENR-CIP-CN-AK-SXT-E * | 2 | 2 | ||||||
P-C-TE-ENR-CIP-AK-E-RD * | 1 | 1 | ||||||
C-TE-ENR-CIP-CN-AK-SXT-E-RD * | 1 | 1 | ||||||
Total | 66 | 27 | 34 | 11 | 32 | 5 | 1 | 176 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cagnoli, G.; Bertelloni, F.; Bongi, P.; Piva, S.; Del Frate, M.; Scarpellini, R.; Apollonio, M.; Ebani, V.V. Nasal Carriage of Antimicrobial-Resistant Staphylococci by Fallow Deer (Dama dama) Taken in a Natural Park of Tuscany, Central Italy. Microorganisms 2024, 12, 2323. https://doi.org/10.3390/microorganisms12112323
Cagnoli G, Bertelloni F, Bongi P, Piva S, Del Frate M, Scarpellini R, Apollonio M, Ebani VV. Nasal Carriage of Antimicrobial-Resistant Staphylococci by Fallow Deer (Dama dama) Taken in a Natural Park of Tuscany, Central Italy. Microorganisms. 2024; 12(11):2323. https://doi.org/10.3390/microorganisms12112323
Chicago/Turabian StyleCagnoli, Giulia, Fabrizio Bertelloni, Paolo Bongi, Silvia Piva, Marco Del Frate, Raffaele Scarpellini, Marco Apollonio, and Valentina Virginia Ebani. 2024. "Nasal Carriage of Antimicrobial-Resistant Staphylococci by Fallow Deer (Dama dama) Taken in a Natural Park of Tuscany, Central Italy" Microorganisms 12, no. 11: 2323. https://doi.org/10.3390/microorganisms12112323
APA StyleCagnoli, G., Bertelloni, F., Bongi, P., Piva, S., Del Frate, M., Scarpellini, R., Apollonio, M., & Ebani, V. V. (2024). Nasal Carriage of Antimicrobial-Resistant Staphylococci by Fallow Deer (Dama dama) Taken in a Natural Park of Tuscany, Central Italy. Microorganisms, 12(11), 2323. https://doi.org/10.3390/microorganisms12112323