A Six Years (2010–2016) Longitudinal Survey of the Four Serotypes of Dengue Viruses in Lao PDR
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Human Samples Collection
2.3. Dengue Viruses Screening and Viral RNA Extraction
2.4. Envelope Gene Sequencing
2.5. Phylogenetic Analysis
3. Results
3.1. Serotype Circulation of DENV during 2010–2016 in Lao PDR
3.2. DENV Sequences Analysis
3.3. DENV-1 Phylogeny
3.4. DENV-2 Phylogeny
3.5. DENV-3 Phylogeny
3.6. DENV-4 Phylogeny
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Messina, J.P.; Brady, O.J.; Scott, T.W.; Zou, C.; Pigott, D.M.; Duda, K.A.; Bhatt, S.; Katzelnick, L.; Howes, R.E.; Battle, K.E.; et al. Global Spread of Dengue Virus Types: Mapping the 70 Year History. Trends Microbiol. 2014, 22, 138–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhatt, S.; Gething, P.W.; Brady, O.J.; Messina, J.P.; Farlow, A.W.; Moyes, C.L.; Drake, J.M.; Brownstein, J.S.; Hoen, A.G.; Sankoh, O.; et al. The Global Distribution and Burden of Dengue. Nature 2013, 496, 504–507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kok, B.H.; Lim, H.T.; Lim, C.P.; Lai, N.S.; Leow, C.Y.; Leow, C.H. Dengue Virus Infection—a Review of Pathogenesis, Vaccines, Diagnosis and Therapy. Virus Res. 2022, 324, 199018. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization Dengue and Severe Dengue WPRO. Available online: https://www.who.int/westernpacific/health-topics/dengue-and-severe-dengue (accessed on 13 December 2022).
- Brady, O.J.; Gething, P.W.; Bhatt, S.; Messina, J.P.; Brownstein, J.S.; Hoen, A.G.; Moyes, C.L.; Farlow, A.W.; Scott, T.W.; Hay, S.I. Refining the Global Spatial Limits of Dengue Virus Transmission by Evidence-Based Consensus. PLoS Negl. Trop. Dis. 2012, 6, e1760. [Google Scholar] [CrossRef]
- Soo, K.-M.; Khalid, B.; Ching, S.-M.; Chee, H.-Y. Meta-Analysis of Dengue Severity during Infection by Different Dengue Virus Serotypes in Primary and Secondary Infections. PLoS ONE 2016, 11, e0154760. [Google Scholar] [CrossRef] [Green Version]
- Katzelnick, L.C.; Fonville, J.M.; Gromowski, G.D.; Arriaga, J.B.; Green, A.; James, S.L.; Lau, L.; Montoya, M.; Wang, C.; VanBlargan, L.A.; et al. Dengue Viruses Cluster Antigenically but Not as Discrete Serotypes. Science 2015, 349, 1338–1343. [Google Scholar] [CrossRef] [Green Version]
- Gubler, D.J. Dengue and Dengue Hemorrhagic Fever. Clin. Microbiol. Rev. 1998, 11, 480–496. [Google Scholar] [CrossRef] [Green Version]
- Weaver, S.C.; Vasilakis, N. Molecular Evolution of Dengue Viruses: Contributions of Phylogenetics to Understanding the History and Epidemiology of the Preeminent Arboviral Disease. Infect. Genet. Evol. 2009, 9, 523–540. [Google Scholar] [CrossRef] [Green Version]
- Hamel, R.; Surasombatpattana, P.; Wichit, S.; Dauvé, A.; Donato, C.; Pompon, J.; Vijaykrishna, D.; Liegeois, F.; Vargas, R.M.; Luplertlop, N.; et al. Phylogenetic Analysis Revealed the Co-Circulation of Four Dengue Virus Serotypes in Southern Thailand. PLoS ONE 2019, 14, e0221179. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Roche, R.; Gould, E.A. Understanding the Dengue Viruses and Progress towards Their Control. Available online: https://www.hindawi.com/journals/bmri/2013/690835/ (accessed on 14 September 2020).
- Rico-Hesse, R. Microevolution and virulence of dengue viruses. Adv. Virus Res. 2003, 59, 315–341. [Google Scholar]
- Messina, J.P.; Brady, O.J.; Golding, N.; Kraemer, M.U.G.; Wint, G.R.W.; Ray, S.E.; Pigott, D.M.; Shearer, F.M.; Johnson, K.; Earl, L.; et al. The Current and Future Global Distribution and Population at Risk of Dengue. Nat. Microbiol. 2019, 4, 1508–1515. [Google Scholar] [CrossRef] [PubMed]
- Fukunaga, T.; Phommasack, B.; Bounlu, K.; Saito, M.; Tadano, M.; Makino, Y.; Insisiengmay, S. Epidemiological situation of dengue infection in Lao PDR. Trop. Med. 1994, 35, 219–227. [Google Scholar]
- Dubot-Pérès, A.; Vongphrachanh, P.; Denny, J.; Phetsouvanh, R.; Linthavong, S.; Sengkeopraseuth, B.; Khasing, A.; Xaythideth, V.; Moore, C.E.; Vongsouvath, M.; et al. An Epidemic of Dengue-1 in a Remote Village in Rural Laos. PLoS Negl. Trop. Dis. 2013, 7, e2360. [Google Scholar] [CrossRef] [Green Version]
- Lao, M.; Caro, V.; Thiberge, J.-M.; Bounmany, P.; Vongpayloth, K.; Buchy, P.; Duong, V.; Vanhlasy, C.; Hospied, J.-M.; Thongsna, M.; et al. Co-Circulation of Dengue Virus Type 3 Genotypes in Vientiane Capital, Lao PDR. PLoS ONE 2014, 9, e115569. [Google Scholar] [CrossRef]
- Soukaloun, D. Dengue Infection in Lao PDR. Southeast Asian J. Trop. Med. Public Health 2014, 45 (Suppl. 1), 113–119. [Google Scholar]
- Castonguay-Vanier, J.; Klitting, R.; Sengvilaipaseuth, O.; Piorkowski, G.; Baronti, C.; Sibounheuang, B.; Vongsouvath, M.; Chanthongthip, A.; Thongpaseuth, S.; Mayxay, M.; et al. Molecular Epidemiology of Dengue Viruses in Three Provinces of Lao PDR, 2006–2010. PLoS Negl. Trop. Dis. 2018, 12, e0006203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calvez, E.; Somlor, S.; Viengphouthong, S.; Balière, C.; Bounmany, P.; Keosenhom, S.; Caro, V.; Grandadam, M. Rapid Genotyping Protocol to Improve Dengue Virus Serotype 2 Survey in Lao PDR. PLoS ONE 2020, 15, e0237384. [Google Scholar] [CrossRef] [PubMed]
- Calvez, E.; Pommelet, V.; Somlor, S.; Pompon, J.; Viengphouthong, S.; Bounmany, P.; Chindavong, T.A.; Xaybounsou, T.; Prasayasith, P.; Keosenhom, S.; et al. Trends of the Dengue Serotype-4 Circulation with Epidemiological, Phylogenetic, and Entomological Insights in Lao PDR between 2015 and 2019. Pathogens 2020, 9, 728. [Google Scholar] [CrossRef] [PubMed]
- Khampapongpane, B.; Lewis, H.C.; Ketmayoon, P.; Phonekeo, D.; Somoulay, V.; Khamsing, A.; Phengxay, M.; Sisouk, T.; Vongphrachanh, P.; Bryant, J.E. National Dengue Surveillance in the Lao People’s Democratic Republic, 2006–2012: Epidemiological and Laboratory Findings. West. Pac. Surveill. Response J. WPSAR 2014, 5, 7–13. [Google Scholar] [CrossRef] [Green Version]
- Calvez, E.; Bounmany, P.; Balière, C.; Somlor, S.; Viengphouthong, S.; Xaybounsou, T.; Keosenhom, S.; Fangkham, K.; Brey, P.T.; Caro, V.; et al. Using Background Sequencing Data to Anticipate DENV-1 Circulation in the Lao PDR. Microorganisms 2021, 9, 2263. [Google Scholar] [CrossRef]
- Warrilow, D.; Northill, J.A.; Pyke, A.; Smith, G.A. Single Rapid TaqMan Fluorogenic Probe Based PCR Assay That Detects All Four Dengue Serotypes. J. Med. Virol. 2002, 66, 524–528. [Google Scholar] [CrossRef] [PubMed]
- Ito, M.; Takasaki, T.; Yamada, K.-I.; Nerome, R.; Tajima, S.; Kurane, I. Development and Evaluation of Fluorogenic TaqMan Reverse Transcriptase PCR Assays for Detection of Dengue Virus Types 1 to 4. J. Clin. Microbiol. 2004, 42, 5935–5937. [Google Scholar] [CrossRef] [Green Version]
- Guzmán, M.G.; Kourí, G. Advances in Dengue Diagnosis. Clin. Diagn. Lab. Immunol. 1996, 3, 621–627. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Stamatakis, A.; Hoover, P.; Rougemont, J. A Rapid Bootstrap Algorithm for the RAxML Web Servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef]
- Zhang, J.; Shu, Y.; Shan, X.; Li, D.; Ma, D.; Li, T.; Long, S.; Wang, X.; Pan, Y.; Chen, J.; et al. Co-Circulation of Three Dengue Virus Serotypes Led to a Severe Dengue Outbreak in Xishuangbanna, a Border Area of China, Myanmar, and Laos, in 2019. Int. J. Infect. Dis. 2021, 107, 15–17. [Google Scholar] [CrossRef]
- Blacksell, S.D.; Bell, D.; Kelley, J.; Mammen, M.P.; Gibbons, R.V.; Jarman, R.G.; Vaughn, D.W.; Jenjaroen, K.; Nisalak, A.; Thongpaseuth, S.; et al. Prospective Study To Determine Accuracy of Rapid Serological Assays for Diagnosis of Acute Dengue Virus Infection in Laos. Clin. Vaccine Immunol. 2007, 14, 1458–1464. [Google Scholar] [CrossRef] [Green Version]
- Limkittikul, K.; Brett, J.; L’Azou, M. Epidemiological Trends of Dengue Disease in Thailand (2000–2011): A Systematic Literature Review. PLoS Negl. Trop. Dis. 2014, 8, e3241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phadungsombat, J.; Lin, M.Y.-C.; Srimark, N.; Yamanaka, A.; Nakayama, E.E.; Moolasart, V.; Suttha, P.; Shioda, T.; Uttayamakul, S. Emergence of Genotype Cosmopolitan of Dengue Virus Type 2 and Genotype III of Dengue Virus Type 3 in Thailand. PLoS ONE 2018, 13, e0207220. [Google Scholar] [CrossRef] [Green Version]
- Vu, T.T.H.; Holmes, E.C.; Duong, V.; Nguyen, T.Q.; Tran, T.H.; Quail, M.; Churcher, C.; Parkhill, J.; Cardosa, J.; Farrar, J.; et al. Emergence of the Asian 1 Genotype of Dengue Virus Serotype 2 in Viet Nam: In Vivo Fitness Advantage and Lineage Replacement in South-East Asia. PLoS Negl. Trop. Dis. 2010, 4, e757. [Google Scholar] [CrossRef]
- Hapuarachchi, H.C.; Koo, C.; Rajarethinam, J.; Chong, C.-S.; Lin, C.; Yap, G.; Liu, L.; Lai, Y.-L.; Ooi, P.L.; Cutter, J.; et al. Epidemic Resurgence of Dengue Fever in Singapore in 2013–2014: A Virological and Entomological Perspective. BMC Infect. Dis. 2016, 16, 300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Senavong, P.; Yamamoto, E.; Keomoungkhoune, P.; Prasith, N.; Somoulay, V.; Kariya, T.; Saw, Y.M.; Pongvongsa, T.; Hamajima, N. Factors Associated with Severe Dengue in Savannakhet Province, Lao People’s Democratic Republic. Nagoya J. Med. Sci. 2021, 83, 749–763. [Google Scholar] [CrossRef] [PubMed]
- Kyaw, A.K.; Ngwe Tun, M.M.; Moi, M.L.; Nabeshima, T.; Soe, K.T.; Thwe, S.M.; Myint, A.A.; Maung, K.T.T.; Aung, W.; Hayasaka, D.; et al. Clinical, Virological and Epidemiological Characterization of Dengue Outbreak in Myanmar, 2015. Epidemiol. Infect. 2017, 145, 1886–1897. [Google Scholar] [CrossRef] [PubMed]
Dengue Type | Primer Name | Sequence (5′-3′) | Size of Amplicon (bp) | Reference | |
---|---|---|---|---|---|
DENGUE 1 | DENV1-FG1 | Den1-771F | CCTCTGAAGGCGCTTGGAA | 780 | This study |
Den1-1551R | CCATTGTTTGTGGACGAGCC | This study | |||
DENV1-FG2 | Den1-1112F | TGCATTGAAGCCAAAATATCAAA | 1442 | This study | |
Den1-2554R | CTCCCATGCCTTCCCAATG | This study | |||
DENV1-FG3 | Den1-2189F | GCATGGGACTTCGGCTCTATAGG | 1293 | This study | |
Den1-3482R | CTGACCCTGCAGAGACCATTGA | This study | |||
DENGUE 2 | DENV2-FG1 | Den2-279F | AACAGCAGGGATATC | 1389 | This study |
Den2-1668R | ATGGCGATTTTTGAAACTCA | This study | |||
DENV2-FG2 | Den2-1137F | CTGTATAGAAGCAAAGCTGACC | 610 | This study | |
Den2-1747R | GTAAGTTTCCTGATGACATC | This study | |||
DENV2-FG3 | Den2-1860F | TGTGAAGGAAATAGCAGA | 599 | This study | |
Den2-2459R | AGTTCTTTGTTTTTCCAGCT | This study | |||
DENV2-FG4 | Den2-2297F | TTATGAAAATCCTCATAGGA | 1209 | This study | |
Den2-3506R | AGTGAAAAGTTGTCAATCTG | This study | |||
DENGUE 3 | DENV3-FG1 | Den3-1F | AGTTGTTAGTCTACGTG | 1012 | [16] |
Den3-1013R | GGTAGTCACACACCCCCCGTG | [16] | |||
DENV3-FG2 | Den3-815F | GCCCTTAGGCACCCAGGGTT | 937 | [16] | |
Den3-1752R | CCCGCGAAAATGCTTGTGC | [16] | |||
DENV3-FG3 | Den3-1398F | CGCAAGGAGTCACGGCTGAG | 1141 | [16] | |
Den3-2539R | GCCTGCAATGGCTGTTGCC | [16] | |||
DENGUE 4 | DENV4-FG1 | Den4-848F | GGCAGGATTTATGGCTTACATG | 640 | This study |
Den4-1488R | CGAGTGTTAGTTCTCCATAG | This study | |||
DENV4-FG2 | Den4-1398F | GACACATCCAATCATGGAG | 686 | This study | |
Den4-2084R | AACACCTATCACTATGTAGC | This study | |||
DENV4-FG3 | Den4-1954F | TCCCCATAGAGATAAGAGATG | 661 | This study | |
Den4-2615R | GGTTGATCTAATTCCACAG | This study |
Key 1 | Location | Month-Year of Collection | Serotype | Genotype | GenBank Accession Number | |
---|---|---|---|---|---|---|
Country | Province | |||||
2010-1949 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628181 |
2010-1952 | Lao PDR | Vientiane capital | XX 2-2010 | DENV-1 | I | MN628182 |
2010-1953 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628183 |
2010-2100 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628192 |
2010-2104 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628193 |
2010-2106 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628194 |
2010-2107 | Lao PDR | Vientiane capital | Sept-2010 | DENV-1 | I | MN628195 |
2010-2338 | Lao PDR | Vientiane capital | Oct-2010 | DENV-1 | I | MN628196 |
2010-2342 | Lao PDR | Vientiane capital | Oct-2010 | DENV-1 | I | MN628197 |
2010-2497 | Lao PDR | Vientiane capital | Oct-2010 | DENV-1 | I | MN628198 |
2010-3196 | Lao PDR | Vientiane capital | Dec-2010 | DENV-1 | I | MN628189 |
2010-3197 | Lao PDR | Vientiane capital | Dec-2010 | DENV-1 | I | MN628191 |
2011-0010 | Lao PDR | Vientiane capital | XX 1-2011 | DENV-1 | I | MN628185 |
2012-0005 | Lao PDR | Vientiane capital | Apr-2012 | DENV-1 | I | MN628184 |
2012-0107 | Lao PDR | Vientiane capital | Jul-2012 | DENV-1 | I | MN628200 |
2012-0113 | Lao PDR | Vientiane capital | Jul-2012 | DENV-1 | I | MN628201 |
2012-0177 | Lao PDR | Vientiane capital | Aug-2012 | DENV-1 | I | MN628199 |
2012-0210 | Lao PDR | Vientiane capital | Aug-2012 | DENV-1 | I | MN628206 |
2012-0227 | Lao PDR | Vientiane capital | Aug-2012 | DENV-1 | I | MN628204 |
2012-0258 | Lao PDR | Vientiane capital | Sept-2012 | DENV-1 | I | MN628186 |
2012-0259 | Lao PDR | Vientiane capital | Sept-2012 | DENV-1 | I | MN628205 |
2012-0260 | Lao PDR | Vientiane capital | Sept-2012 | DENV-1 | I | MN628202 |
2012-0269 | Lao PDR | Vientiane capital | Sept-2012 | DENV-1 | I | MN628203 |
2012-0331 | Lao PDR | Vientiane capital | Oct-2012 | DENV-1 | I | MN628187 |
2012-0436 | Lao PDR | Vientiane capital | Nov-2012 | DENV-1 | I | MN628188 |
2014-3216 | Lao PDR | Vientiane capital | Sept-2014 | DENV-1 | I | MN628190 |
2015-3021 | Lao PDR | Vientiane capital | May-2015 | DENV-1 | I | MN628211 |
2015-3048 | Lao PDR | Vientiane capital | Jun-2015 | DENV-1 | I | MN628212 |
2015-3059 | Lao PDR | Attapeu | Jul-2015 | DENV-1 | I | MN628213 |
2015-3062 | Lao PDR | Attapeu | Jul-2015 | DENV-1 | I | MN628214 |
2015-3074 | Lao PDR | Attapeu | Jan-2015 | DENV-1 | I | MN628215 |
2015-3080 | Lao PDR | Attapeu | Apr-2015 | DENV-1 | I | MN628216 |
2015-3098 | Lao PDR | Attapeu | Jul-2015 | DENV-1 | I | MN628217 |
2015-3122 | Lao PDR | Attapeu | Aug-2015 | DENV-1 | I | MN628209 |
2015-3127 | Lao PDR | Vientiane capital | Aug-2015 | DENV-1 | I | MN628218 |
2015-3135 | Lao PDR | Attapeu | Aug-2015 | DENV-1 | I | MN628230 |
2015-3145 | Lao PDR | Vientiane capital | Aug-2015 | DENV-1 | I | MN628219 |
2015-3173 | Lao PDR | Attapeu | Sept-2015 | DENV-1 | I | MN628208 |
2015-3177 | Lao PDR | Attapeu | Sept-2015 | DENV-1 | I | MN628207 |
2015-3178 | Lao PDR | Attapeu | Sept-2015 | DENV-1 | I | MN628220 |
2015-3187 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628221 |
2015-3189 | Lao PDR | Attapeu | Sept-2015 | DENV-1 | I | MN628222 |
2015-3195 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628223 |
2015-3204 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628224 |
2015-3205 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628210 |
2015-3213 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628225 |
2015-3214 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628226 |
2015-3228 | Lao PDR | Vientiane capital | Sept-2015 | DENV-1 | I | MN628227 |
2015-3414 | Lao PDR | Vientiane capital | Nov-2015 | DENV-1 | I | MN628228 |
2015-3416 | Lao PDR | Vientiane capital | Nov-2015 | DENV-1 | I | MN628229 |
2016-3908 | Lao PDR | Luangprabang | XX 1-2016 | DENV-1 | I | MN628231 |
2010-1947 | Lao PDR | Vientiane capital | Sept-2010 | DENV-2 | Asian I | MN628249 |
2010-2108 | Lao PDR | Vientiane capital | Sept-2010 | DENV-2 | Asian I | MN628250 |
2010-2340 | Lao PDR | Vientiane capital | Oct-2010 | DENV-2 | Asian I | MN628251 |
2010-2498 | Lao PDR | Vientiane capital | Oct-2010 | DENV-2 | Asian I | MN628245 |
2010-2500 | Lao PDR | Vientiane capital | Oct-2010 | DENV-2 | Asian I | MN628246 |
2010-2723 | Lao PDR | Vientiane capital | Oct-2010 | DENV-2 | Asian I | MN628242 |
2010-2724 | Lao PDR | Vientiane capital | Oct-2010 | DENV-2 | Asian I | MN628233 |
2010-3023 | Lao PDR | Vientiane capital | Nov-2010 | DENV-2 | Asian I | MN628243 |
2010-3024 | Lao PDR | Vientiane capital | Nov-2010 | DENV-2 | Asian I | MN628244 |
2012-0136 | Lao PDR | Vientiane capital | Aug-2012 | DENV-2 | Asian I | MN628252 |
2012-0181 | Lao PDR | Vientiane capital | Aug-2012 | DENV-2 | Asian I | MN628237 |
2012-0237 | Lao PDR | Vientiane capital | Sept-2012 | DENV-2 | Asian I | MN628232 |
2012-0254 | Lao PDR | Vientiane capital | Sept-2012 | DENV-2 | Asian I | MN628234 |
2012-0265 | Lao PDR | Vientiane capital | Sept-2012 | DENV-2 | Asian I | MN628247 |
2012-0309 | Lao PDR | Vientiane capital | Oct-2012 | DENV-2 | Asian I | MN628248 |
2012-0388 | Lao PDR | Vientiane capital | Nov-2012 | DENV-2 | Asian I | MN628236 |
2012-0404 | Lao PDR | Vientiane capital | Nov-2012 | DENV-2 | Asian I | MN628240 |
2012-0423 | Lao PDR | Vientiane capital | Nov-2012 | DENV-2 | Asian I | MN628235 |
2012-0425 | Lao PDR | Vientiane capital | Nov-2012 | DENV-2 | Asian I | MN628238 |
2012-0449 | Lao PDR | Vientiane capital | Nov-2012 | DENV-2 | Asian I | MN628239 |
2012-0468 | Lao PDR | Vientiane capital | Dec-2012 | DENV-2 | Asian I | MN628241 |
2012-0226 | Lao PDR | Vientiane capital | Aug-2012 | DENV-3 | II | MN628254 |
2016-3913 | Lao PDR | Saravane | Jun-2016 | DENV-3 | III | MN628253 |
2013-2769 | Lao PDR | Vientiane capital | Oct-2013 | DENV-4 | I | MN628258 |
2015-3131 | Lao PDR | Vientiane capital | Aug-2015 | DENV-4 | I | MN628257 |
2016-3897 | Lao PDR | Saravane | Jun-2016 | DENV-4 | I | MN628256 |
2016-3981 | Lao PDR | Bolikhamxay | Jul-2016 | DENV-4 | I | MN628255 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Balière, C.; Calvez, E.; Thiberge, J.-M.; Somlor, S.; Vandenbogaert, M.; Grandadam, M.; Caro, V. A Six Years (2010–2016) Longitudinal Survey of the Four Serotypes of Dengue Viruses in Lao PDR. Microorganisms 2023, 11, 243. https://doi.org/10.3390/microorganisms11020243
Balière C, Calvez E, Thiberge J-M, Somlor S, Vandenbogaert M, Grandadam M, Caro V. A Six Years (2010–2016) Longitudinal Survey of the Four Serotypes of Dengue Viruses in Lao PDR. Microorganisms. 2023; 11(2):243. https://doi.org/10.3390/microorganisms11020243
Chicago/Turabian StyleBalière, Charlotte, Elodie Calvez, Jean-Michel Thiberge, Somphavanh Somlor, Mathias Vandenbogaert, Marc Grandadam, and Valérie Caro. 2023. "A Six Years (2010–2016) Longitudinal Survey of the Four Serotypes of Dengue Viruses in Lao PDR" Microorganisms 11, no. 2: 243. https://doi.org/10.3390/microorganisms11020243
APA StyleBalière, C., Calvez, E., Thiberge, J.-M., Somlor, S., Vandenbogaert, M., Grandadam, M., & Caro, V. (2023). A Six Years (2010–2016) Longitudinal Survey of the Four Serotypes of Dengue Viruses in Lao PDR. Microorganisms, 11(2), 243. https://doi.org/10.3390/microorganisms11020243