Lactobacillus salivarius CML352 Isolated from Chinese Local Breed Chicken Modulates the Gut Microbiota and Improves Intestinal Health and Egg Quality in Late-Phase Laying Hens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Isolation and Identification of Lactobacillus from Chicken Gut Contents
2.3. DNA Extraction
2.4. In Vitro Study
2.4.1. Acid and Bile Salt Tolerance Assay
2.4.2. Auto and Co-Aggregation Assay
2.4.3. Hydrophobicity Assay
2.4.4. Antibacterial Ability Test
2.4.5. Hemolytic Activity
2.5. Genomic and Phylogenetic Analysis of the Selected Strain
2.6. Fermentation and Vacuum Lyophilization of Lactobacillus Powder
2.7. In Vivo Study
2.7.1. Animal Husbandry and Feeding Conditions
2.7.2. Sample Collection
2.7.3. Laying Performance and Egg Quality
2.7.4. The Analysis of Cecal Microbiota
2.7.5. Assay of Antioxidant Enzymes in Serum
2.7.6. Quantitative RT-PCR Analysis of Gene Expression
2.8. Statistical Analysis
3. Results
3.1. Isolation and Identification of Lactic Acid Bacteria from Chinese Local Breed Chickens
3.2. Genomic and Phylogenetic Analysis of L. salivarius CML352
3.3. L. salivarius CML352 Modulated the Gut Microbiota Composition and Function of Laying Hens
3.4. Effects of L. salivarius CML352 on Intestinal Epithelial Barrier, Immunity, and Antioxidant Activity
3.5. Effects of L. salivarius CML352 on Production Performance and Egg Quality
4. Discussion
4.1. Probiotic Properties Assessment
4.2. Effect of L. salivarius CML352 on Cecal Microbiota of Layers
4.3. Effect of L. salivarius CML352 on Intestinal Epithelial Barrier, Immunity, and Antioxidant Activity
4.4. Effect of L. salivarius CML352 on the Production Performance of Layers
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van den Brand, H.; Parmentier, H.K.; Kemp, B. Effects of housing system (outdoor vs cages) and age of laying hens on egg characteristics. Br. Poult. Sci. 2004, 45, 745–752. [Google Scholar] [CrossRef] [PubMed]
- Rattanawut, J.; Pimpa, O.; Yamauchi, K.-E. Effects of dietary bamboo vinegar supplementation on performance, eggshell quality, ileal microflora composition, and intestinal villus morphology of laying hens in the late phase of production. Anim. Sci. J. Nihon Chikusan Gakkaiho 2018, 89, 1572–1580. [Google Scholar] [CrossRef] [PubMed]
- Yegani, M.; Korver, D.R. Factors Affecting Intestinal Health in Poultry. Poult. Sci. 2008, 87, 2052–2063. [Google Scholar] [CrossRef]
- Anderson, R.C.; Dalziel, J.E.; Gopal, P.K.; Bassett, S.; Ellis, A.; Roy, N.C. The Role of Intestinal Barrier Function in Early Life in the Development of Colitis. In Colitis; InTech: Rijeka, Croatia, 2012. [Google Scholar] [CrossRef] [Green Version]
- Pan, D.; Yu, Z. Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes 2014, 5, 108–119. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Morrison, M.; Yu, Z. Bacterial census of poultry intestinal microbiome. Poult. Sci. 2013, 92, 671–683. [Google Scholar] [CrossRef] [PubMed]
- Nishino, K.; Nishida, A.; Inoue, R.; Kawada, Y.; Ohno, M.; Sakai, S.; Inatomi, O.; Bamba, S.; Sugimoto, M.; Kawahara, M.; et al. Analysis of endoscopic brush samples identified mucosa-associated dysbiosis in inflammatory bowel disease. J. Gastroenterol. 2017, 53, 95–106. [Google Scholar] [CrossRef] [Green Version]
- Karlsson, F.; Tremaroli, V.; Nielsen, J.; Bäckhed, F. Assessing the Human Gut Microbiota in Metabolic Diseases. Diabetes 2013, 62, 3341–3349. [Google Scholar] [CrossRef] [Green Version]
- Chu, D.M.; Ma, J.; Prince, A.L.; Antony, K.M.; Seferovic, M.D.; Aagaard, K.M. Maturation of the infant microbiome community structure and function across multiple body sites and in relation to mode of delivery. Nat. Med. 2017, 23, 314–326. [Google Scholar] [CrossRef] [Green Version]
- Zommiti, M.; Chikindas, M.L.; Ferchichi, M. Probiotics—Live Biotherapeutics: A Story of Success, Limitations, and Future Prospects—Not Only for Humans. Probiotics Antimicrob. Proteins 2020, 12, 1266–1289. [Google Scholar] [CrossRef]
- Zommiti, M.; Ferchichi, M. Probiotics and Prebiotics in Animal Feed; Academic Press: Cambridge, MA, USA, 2021; pp. 233–261. [Google Scholar] [CrossRef]
- Gaggìa, F.; Mattarelli, P.; Biavati, B. Probiotics and prebiotics in animal feeding for safe food production. Int. J. Food Microbiol. 2010, 141, S15–S28. [Google Scholar] [CrossRef]
- Cherdyntseva, T.A.; Kotova, I.B.; Netrusov, A.I. The Isolation, Identification and Analyses of Lactobacillus Genus Bacteria with Probiotic Potential. Adv. Exp. Med. Biol. 2016, 897, 103–111. [Google Scholar] [CrossRef]
- Bouzaine, T.; Dauphin, R.D.; Thonart, P.; Urdaci, M.C.; Hamdi, M. Adherence and colonization properties of Lactobacillus rhamnosus TB1, a broiler chicken isolate. Lett. Appl. Microbiol. 2005, 40, 391–396. [Google Scholar] [CrossRef] [PubMed]
- Gaspar, C.; Donders, G.G.; Palmeira-De-Oliveira, R.; Queiroz, J.A.; Tomaz, C.; Martinez-De-Oliveira, J.; Palmeira-de-Oliveira, A. Bacteriocin production of the probiotic Lactobacillus acidophilus KS400. AMB Express 2018, 8, 153. [Google Scholar] [CrossRef]
- Isolauri, E.; Sütas, Y.; Kankaanpää, P.; Arvilommi, H.; Salminen, S. Probiotics: Effects on immunity. Am. J. Clin. Nutr. 2001, 73, 444s–450s. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alaqil, A.A.; Abbas, A.O.; El-Beltagi, H.S.; El-Atty, H.K.A.; Mehaisen, G.M.K.; Moustafa, E.S. Dietary Supplementation of Probiotic Lactobacillus acidophilus Modulates Cholesterol Levels, Immune Response, and Productive Performance of Laying Hens. Animals 2020, 10, 1588. [Google Scholar] [CrossRef]
- Anjum, M.; Khan, G.; Afzal, A. Effect of dietary supplementation of multi-strain probiotic on broiler growth performance. Pak. Vet. J. 2005, 25, 25–29. [Google Scholar]
- Kers, J.G.; Velkers, F.C.; Fischer, E.A.J.; Hermes, G.D.A.; Stegeman, J.A.; Smidt, H. Host and Environmental Factors Affecting the Intestinal Microbiota in Chickens. Front. Microbiol. 2018, 9, 235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suárez, J.E. Autochthonous microbiota, probiotics and prebiotics. Nutr. Hosp. 2015, 31 (Suppl. S1), 3–9. [Google Scholar] [CrossRef] [PubMed]
- Fuller, R. Nature of the Determinant Responsible for the Adhesion of Lactobacilli to Chicken Crop Epithelial Cells. J. Gen. Microbiol. 1975, 87, 245–250. [Google Scholar] [CrossRef] [Green Version]
- Lin, W.-C.; Ptak, C.P.; Chang, C.-Y.; Ian, M.-K.; Chia, M.-Y.; Chen, T.-H.; Kuo, C.-J. Autochthonous Lactic Acid Bacteria Isolated From Dairy Cow Feces Exhibiting Promising Probiotic Properties and In Vitro Antibacterial Activity Against Foodborne Pathogens in Cattle. Front. Vet. Sci. 2020, 7, 239. [Google Scholar] [CrossRef]
- Yamashita, M.M.; Ferrarezi, J.V.; Pereira, G.D.V.; Bandeira, G.; da Silva, B.C.; Pereira, S.A.; Martins, M.L.; Mouriño, J.L.P. Autochthonous vs allochthonous probiotic strains to Rhamdia quelen. Microb. Pathog. 2020, 139, 103897. [Google Scholar] [CrossRef] [PubMed]
- Yelnetty, A.; Ta, T.E. Indigenous Lactic Acid Bacteria Isolated from Spontaneously Fermented Goat Milk as Potential Probiotics. Pak. J. Biol. Sci. 2020, 23, 883–890. [Google Scholar] [CrossRef] [PubMed]
- Varada, V.V.; Tyagi, A.K.; Banakar, P.S.; Das, A.; Tyagi, N.; Mallapa, R.H.; Kumar, S. Autochthonous Limosilactobacillus reuteri BFE7 and Ligilactobacillus salivarius BF17 probiotics consortium supplementation improves performance, immunity, and selected gut health indices in Murrah buffalo calves. Vet. Res. Commun. 2022, 46, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Yun, H.S.; Cho, K.W.; Oh, S.; Kim, S.H.; Chun, T.; Kim, B.; Whang, K.Y. Evaluation of probiotic characteristics of newly isolated Lactobacillus spp.: Immune modulation and longevity. Int. J. Food Microbiol. 2011, 148, 80–86. [Google Scholar] [CrossRef]
- Leite, A.M.; Miguel, M.A.; Peixoto, R.S.; Ruas-Madiedo, P.; Paschoalin, V.M.; Mayo, B.; Delgado, S. Probiotic potential of selected lactic acid bacteria strains isolated from Brazilian kefir grains. J. Dairy Sci. 2015, 98, 3622–3632. [Google Scholar] [CrossRef] [Green Version]
- Todorov, S.D.; Botes, M.; Guigas, C.; Schillinger, U.; Wiid, I.; Wachsman, M.B.; Holzapfel, W.H.; Dicks, L.M. Boza, a natural source of probiotic lactic acid bacteria. J. Appl. Microbiol. 2008, 104, 465–477. [Google Scholar] [CrossRef]
- Abbasiliasi, S.; Tan, J.S.; Bashokouh, F.; Ibrahim, T.A.T.; Mustafa, S.; Vakhshiteh, F.; Sivasamboo, S.; Ariff, A.B. In vitro assessment of Pediococcus acidilactici Kp10 for its potential use in the food industry. BMC Microbiol. 2017, 17, 121. [Google Scholar] [CrossRef] [Green Version]
- Muhammad, Z.; Ramzan, R.; Abdelazez, A.; Amjad, A.; Afzaal, M.; Zhang, S.; Pan, S. Assessment of the Antimicrobial Potentiality and Functionality of Lactobacillus plantarum Strains Isolated from the Conventional Inner Mongolian Fermented Cheese Against Foodborne Pathogens. Pathogens 2019, 8, 71. [Google Scholar] [CrossRef] [Green Version]
- Śliżewska, K.; Chlebicz-Wójcik, A.; Nowak, A. Probiotic Properties of New Lactobacillus Strains Intended to Be Used as Feed Additives for Monogastric Animals. Probiotics Antimicrob. Proteins 2021, 13, 146–162. [Google Scholar] [CrossRef]
- Chen, H.; Chen, S.; Li, C.; Shu, G. Response Surface Optimization of Lyoprotectant for Lactobacillus bulgaricus during Vacuum Freeze-Drying. Prep. Biochem. Biotechnol. 2015, 45, 463–475. [Google Scholar] [CrossRef]
- Chong, J.; Liu, P.; Zhou, G.; Xia, J. Using Microbiome Analyst for comprehensive statistical, functional, and meta-analysis of microbiome data. Nat. Protoc. 2020, 15, 799–821. [Google Scholar] [CrossRef]
- Li, Z.; Wang, W.; Liu, D.; Guo, Y. Effects of Lactobacillus acidophilus on gut microbiota composition in broilers challenged with Clostridium perfringens. PLoS ONE 2017, 12, e0188634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, W.; Sun, C.; Yuan, J.; Yang, N. Gut metagenomic analysis reveals prominent roles of Lactobacillus and cecal microbiota in chicken feed efficiency. Sci. Rep. 2017, 7, 45308. [Google Scholar] [CrossRef] [PubMed]
- Armas, F.; Camperio, C.; Marianelli, C. In Vitro Assessment of the Probiotic Potential of Lactococcus lactis LMG 7930 against Ruminant Mastitis-Causing Pathogens. PLoS ONE 2017, 12, e0169543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhai, Q.; Shen, X.; Cen, S.; Zhang, C.; Tian, F.; Zhao, J.; Zhang, H.; Xue, Y.; Chen, W. Screening of Lactobacillus salivarius strains from the feces of Chinese populations and the evaluation of their effects against intestinal inflammation in mice. Food Funct. 2020, 11, 221–235. [Google Scholar] [CrossRef] [PubMed]
- Smirnoff, N.; Wheeler, G.L. Ascorbic Acid in Plants: Biosynthesis and Function. Crit. Rev. Biochem. Mol. Biol. 2000, 35, 291–314. [Google Scholar] [CrossRef]
- Samuel, B.S.; Gordon, J.I. A humanized gnotobiotic mouse model of host–archaeal–bacterial mutualism. Proc. Natl. Acad. Sci. USA 2006, 103, 10011–10016. [Google Scholar] [CrossRef] [Green Version]
- Bhat, M.I.; Singh, V.K.; Sharma, D.; Kapila, S.; Kapila, R. Adherence capability and safety assessment of an indigenous probiotic strain Lactobacillus rhamnosus MTCC-5897. Microb. Pathog. 2019, 130, 120–130. [Google Scholar] [CrossRef]
- Fontana, L.; Bermudez-Brito, M.; Plaza-Diaz, J.; Muñoz-Quezada, S.; Gil, A. Sources, isolation, characterisation and evaluation of probiotics. Br. J. Nutr. 2013, 109 (Suppl. S2), S35–S50. [Google Scholar] [CrossRef] [Green Version]
- Fernández, S.; Fraga, M.; Silveyra, E.; Trombert, A.; Rabaza, A.; Pla, M.; Zunino, P. Probiotic properties of native Lactobacillus spp. strains for dairy calves. Benef. Microbes 2018, 9, 613–624. [Google Scholar] [CrossRef] [Green Version]
- Yamazaki, M.; Ohtsu, H.; Yakabe, Y.; Kishima, M.; Abe, H. In vitroscreening of lactobacilli isolated from chicken excreta to control Salmonella Enteritidis and Typhimurium. Br. Poult. Sci. 2012, 53, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Van Coillie, E.; Goris, J.; Cleenwerck, I.; Grijspeerdt, K.; Botteldoorn, N.; Van Immerseel, F.; De Buck, J.; Vancanneyt, M.; Swings, J.; Herman, L.; et al. Identification of lactobacilli isolated from the cloaca and vagina of laying hens and characterization for potential use as probiotics to control Salmonella Enteritidis. J. Appl. Microbiol. 2007, 102, 1095–1106. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Kumar, D. Characterization of Lactobacillus isolated from dairy samples for probiotic properties. Anaerobe 2015, 33, 117–123. [Google Scholar] [CrossRef] [PubMed]
- García-Ruiz, A.; de Llano, D.G.; Esteban-Fernández, A.; Requena, T.; Bartolomé, B.; Moreno-Arribas, M.V. Assessment of probiotic properties in lactic acid bacteria isolated from wine. Food Microbiol. 2014, 44, 220–225. [Google Scholar] [CrossRef]
- Ehrmann, M.A.; Kurzak, P.; Bauer, J.; Vogel, R.F. Characterization of lactobacilli towards their use as probiotic adjuncts in poultry. J. Appl. Microbiol. 2002, 92, 966–975. [Google Scholar] [CrossRef]
- Suvarna, S.; Dsouza, J.; Ragavan, M.L.; Das, N. Potential probiotic characterization and effect of encapsulation of probiotic yeast strains on survival in simulated gastrointestinal tract condition. Food Sci. Biotechnol. 2018, 27, 745–753. [Google Scholar] [CrossRef]
- Adimpong, D.B.; Nielsen, D.S.; Sørensen, K.I.; Derkx, P.M.; Jespersen, L. Genotypic characterization and safety assessment of lactic acid bacteria from indigenous African fermented food products. BMC Microbiol. 2012, 12, 75. [Google Scholar] [CrossRef] [Green Version]
- Touret, T.; Oliveira, M.; Semedo-Lemsaddek, T. Putative probiotic lactic acid bacteria isolated from sauerkraut fermentations. PLoS ONE 2018, 13, e0203501. [Google Scholar] [CrossRef] [Green Version]
- Argyri, A.A.; Zoumpopoulou, G.; Karatzas, K.A.G.; Tsakalidou, E.; Nychas, G.-J.E.; Panagou, E.Z.; Tassou, C.C. Selection of potential probiotic lactic acid bacteria from fermented olives by in vitro tests. Food Microbiol. 2013, 33, 282–291. [Google Scholar] [CrossRef]
- Zommiti, M.; Connil, N.; Hamida, J.B.; Ferchichi, M. Probiotic Characteristics of Lactobacillus curvatus DN317, a Strain Isolated from Chicken Ceca. Probiotics Antimicrob. Proteins 2017, 9, 415–424. [Google Scholar] [CrossRef]
- Zommiti, M.; Almohammed, H.; Ferchichi, M. Purification and Characterization of a Novel Anti-Campylobacter Bacteriocin Produced by Lactobacillus curvatus DN317. Probiotics Antimicrob. Proteins 2016, 8, 191–201. [Google Scholar] [CrossRef] [PubMed]
- Štšepetova, J.; Taelma, H.; Smidt, I.; Hütt, P.; Lapp, E.; Aotäht, E.; Mändar, R. Assessment of phenotypic and genotypic antibiotic susceptibility of vaginal Lactobacillus sp. J. Appl. Microbiol. 2017, 123, 524–534. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, W.; Ci, W.; Zheng, Y.; Han, X.; Huang, J.; Zhu, J. Effects of Dietary Supplementation with Lactobacillus acidophilus and Bacillus subtilis on Mucosal Immunity and Intestinal Barrier Are Associated with Its Modulation of Gut Metabolites and Microbiota in Late-Phase Laying Hens. Probiotics Antimicrob. Proteins 2022, 14, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Sweeney, T.E.; Morton, J.M. The Human Gut Microbiome: A review of the effect of obesity and surgically induced weight loss. JAMA Surg. 2013, 148, 563–569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, H.; Gan, J.; Zeng, D.; Li, J.; Yu, H.; Zhao, H.; Yang, Y.; Tan, S.; Li, G.; Luo, C.; et al. Specific Microbial Taxa and Functional Capacity Contribute to Chicken Abdominal Fat Deposition. Front. Microbiol. 2021, 12, 643025. [Google Scholar] [CrossRef]
- Toscano, M.; De Grandi, R.; Stronati, L.; De Vecchi, E.; Drago, L. Effect of Lactobacillus rhamnosus HN001 and Bifidobacterium longum BB536 on the healthy gut microbiota composition at phyla and species level: A preliminary study. World J. Gastroenterol. 2017, 23, 2696–2704. [Google Scholar] [CrossRef]
- Li, N.; Yang, J.; Zhang, J.; Liang, C.; Wang, Y.; Chen, B.; Zhao, C.; Wang, J.; Zhang, G.; Zhao, D.; et al. Correlation of Gut Microbiome between ASD Children and Mothers and Potential Biomarkers for Risk Assessment. Genomics Proteom. Bioinform. 2019, 17, 26–38. [Google Scholar] [CrossRef]
- Wu, F.; Guo, X.; Zhang, J.; Zhang, M.; Ou, Z.; Peng, Y. Phascolarctobacterium faecium abundant colonization in human gastrointestinal tract. Exp. Ther. Med. 2017, 14, 3122–3126. [Google Scholar] [CrossRef] [Green Version]
- Goker, M.; Gronow, S.; Zeytun, A.; Nolan, M.; Lucas, S.; Lapidus, A.; Hammon, N.; Deshpande, S.; Cheng, J.F.; Pitluck, S.; et al. Complete genome sequence of Odoribacter splanchnicus type strain (1651/6). Stand. Genomic Sci. 2011, 4, 200–209. [Google Scholar] [CrossRef] [Green Version]
- Willemsen, L.E.M.; Koetsier, M.A.; Van Deventer, S.J.H.; Van Tol, E.A.F. Short chain fatty acids stimulate epithelial mucin 2 expression through differential effects on prostaglandin E1 and E2 production by intestinal myofibroblasts. Gut 2003, 52, 1442–1447. [Google Scholar] [CrossRef] [Green Version]
- Kang, C.-H.; Kim, J.-S.; Park, H.M.; Kim, S.; Paek, N.-S. Antioxidant activity and short-chain fatty acid production of lactic acid bacteria isolated from Korean individuals and fermented foods. 3 Biotech. 2021, 11, 217. [Google Scholar] [CrossRef] [PubMed]
- Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin-Gallausiaux, C.; Marinelli, L.; Blottière, H.M.; Larraufie, P.; Lapaque, N. SCFA: Mechanisms and functional importance in the gut. In Proceedings of the Nutrition Society; Cambridge University Press (CUP): Cambridge, UK, 2021; Volume 80, pp. 37–49. [Google Scholar] [CrossRef]
- Parada Venegas, D.; De La Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allaire, J.M.; Crowley, S.M.; Law, H.T.; Chang, S.-Y.; Ko, H.-J.; Vallance, B.A. The Intestinal Epithelium: Central Coordinator of Mucosal Immunity. Trends Immunol. 2018, 39, 677–696. [Google Scholar] [CrossRef]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
- Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The Gut Microbiota of Laying Hens and Its Manipulation with Prebiotics and Probiotics to Enhance Gut Health and Food Safety. Appl. Environ. Microbiol. 2020, 86, e00600-20. [Google Scholar] [CrossRef]
- Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef]
- Wang, L.; Li, L.; Lv, Y.; Chen, Q.; Feng, J.; Zhao, X. Lactobacillus plantarum Restores Intestinal Permeability Disrupted by Salmonella Infection in Newly-hatched Chicks. Sci. Rep. 2018, 8, 2229. [Google Scholar] [CrossRef]
- Hansson, G.C. Role of mucus layers in gut infection and inflammation. Curr. Opin. Microbiol. 2011, 15, 57–62. [Google Scholar] [CrossRef] [Green Version]
- Burger-van Paassen, N.; Vincent, A.; Puiman, P.J.; Van Der Sluis, M.; Bouma, J.; Boehm, G.; van Goudoever, J.B.; Van Seuningen, I.; Renes, I.B. The regulation of intestinal mucin MUC2 expression by short-chain fatty acids: Implications for epithelial protection. Biochem. J. 2009, 420, 211–219. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Wang, J.; He, T.; Becker, S.; Zhang, G.; Li, D.; Ma, X. Butyrate: A Double-Edged Sword for Health? Adv. Nutr. 2018, 9, 21–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Z.; Yang, K.; Zhang, A.; Chang, W.; Zheng, A.; Chen, Z.; Cai, H.; Liu, G. Effects of Lactobacillus acidophilus on the growth performance, immune response, and intestinal barrier function of broiler chickens challenged with Escherichia coli O157. Poult. Sci. 2021, 100, 101323. [Google Scholar] [CrossRef] [PubMed]
- Koenen, M.E.; Kramer, J.; Van Der Hulst, R.; Heres, L.; Jeurissen, S.H.M.; Boersma, W.J.A. Immunomodulation by probiotic lactobacilli in layer- and meat-type chickens. Br. Poult. Sci. 2004, 45, 355–366. [Google Scholar] [CrossRef]
- McGuckin, M.A.; Lindén, S.K.; Sutton, P.; Florin, T.H. Mucin dynamics and enteric pathogens. Nat. Rev. Microbiol. 2011, 9, 265–278. [Google Scholar] [CrossRef] [PubMed]
- Sureshkumar, S.; Lee, H.C.; Jung, S.K.; Kim, D.; Oh, K.B.; Yang, H.; Jo, Y.J.; Lee, H.S.; Lee, S.; Byun, S.J. Inclusion of Lactobacillus salivarius strain revealed a positive effect on improving growth performance, fecal microbiota and immunological responses in chicken. Arch. Microbiol. 2021, 203, 847–853. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ishfaq, M.; Guo, Y.; Chen, C.; Li, J. Assessment of Probiotic Properties of Lactobacillus salivarius Isolated from Chickens as Feed Additives. Front. Vet. Sci. 2020, 7, 415. [Google Scholar] [CrossRef]
- Leng, Y.; Zhang, Y.; Zhang, Y.; Xue, X.; Wang, T.; Kang, Y. Ischemic post-conditioning attenuates the intestinal injury induced by limb ischemia/reperfusion in rats. Braz. J. Med. Biol. Res. Rev. Bras. Pesqui. Med. Biol. 2011, 44, 411–417. [Google Scholar] [CrossRef]
- Yang, X.; Li, L.; Duan, Y.; Yang, X. Antioxidant activity of Lactobacillus plantarum JM113 in vitro and its protective effect on broiler chickens challenged with deoxynivalenol. J. Anim. Sci. 2017, 95, 837–846. [Google Scholar] [CrossRef]
- Chooruk, A.; Piwat, S.; Teanpaisan, R. Antioxidant activity of various oral Lactobacillus strains. J. Appl. Microbiol. 2017, 123, 271–279. [Google Scholar] [CrossRef]
- Ramasamy, K.; Abdullah, N.; Jalaludin, S.; Wong, M.; Ho, Y.W. Effects of Lactobacillus cultures on performance of laying hens, and total cholesterol, lipid and fatty acid composition of egg yolk. J. Sci. Food Agric. 2009, 89, 482–486. [Google Scholar] [CrossRef]
- Naseem, S.; Willits, N.; King, A.J. Varying combinations of Lactobacillus species: Impact on laying hens’ performance, nitrogenous compounds in manure, serum profile, and uric acid in the liver. Transl. Anim. Sci. 2021, 5, txab018. [Google Scholar] [CrossRef] [PubMed]
- Mohan, B.; Kadirvel, R.; Natarajan, A.; Bhaskaran, M. Effect of probiotic supplementation on growth, nitrogen utilisation and serum cholesterol in broilers. Br. Poult. Sci. 1996, 37, 395–401. [Google Scholar] [CrossRef] [PubMed]
- Lv, J.; Guo, L.; Chen, B.; Hao, K.; Ma, H.; Liu, Y.; Min, Y. Effects of different probiotic fermented feeds on production performance and intestinal health of laying hens. Poult. Sci. 2022, 101, 101570. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Calculated Nutrient Analysis | ||
---|---|---|---|
Ratio, % | Nutrient Levels | Content, % | |
Corn [7.8%] 1 | 63.81 | Metabolizable energy (MJ/kg) | 2.777 |
Soybean meal [43%] 1 | 20.0 | Crude protein (%) | 16.445 |
Limestone | 8.3 | Calcium (%) | 3.5 |
Corn gluten meal [60%] 1 | 3.5 | Available phosphorus (%) | 0.365 |
Dicalcium phosphate | 1.5 | Lysine (%) | 1.216 |
Soybean oil | 1.3 | Methionine (%) | 0.441 |
L-lysine-HCl [78%] 2 | 0.649 | Methionine + cystine | 0.7 |
NaCl | 0.35 | ||
Mineral premix | 0.25 | ||
DL-methionine | 0.185 | ||
Choline chloride 50% 2 | 0.1 | ||
Vitamin premix 3 | 0.02 | ||
Ethoxyquin MAX 4 | 0.02 | ||
Phytase 10,000 5 | 0.016 | ||
Lactobacillus strain | +/− 6 | ||
Total | 100 |
Primer Sequence | |
---|---|
Muc2 | F: 5′ATTGTGGTAACACCAACATTCATC3′ R:5′CTTTATAATGTCAGCACCAACTTCTC3′ |
Occludin | F: 5′ACGGCAGCACCTACCTCAA3′ R: 5′GGGCGAAGAAGCAGATGAG3′ |
ZO-1 | F: 5′GAATGATGGTTGGTATGGTGCG3′ R: 5′GGGCGAAGAAGCAGATGAG3′ |
Claudin-2 | F: 5′TCAGAAGTGTGTCTACTGTCCG3′ R: 5′AACTCACTCTTGGGCTTCTG3′ |
NF-κB | F: 5′CTCTCCCAGCCCATCTATGA3′ R: 5′CCTCAGCCCAGAAACGAAC3′ |
MyD88 | F: 5′AGAAGGTGTCGGAGGATGGT3′ R: 5′GCTGGATGCTATTGCCTCGCTG3′ |
TNF-α | F: 5′GGATGGATGGAGGTGAAAGTAG3′ R: 5′TGATCCTGAAGAGGAGAGAGAA3′ |
TGF-β | F: 5′TCATCACCAGGACAGCGTTA3′ R: 5′TGTGATGGAGCCATTCATGT3′ |
IFN-γ | F: 5′AAAGCCGCACATCAAACACA3′ R: 5′GCCATCAGGAAGGTTGTTTTTC3′ |
IL-2 | F: 5′GCAGTGTTACCTGGGAGAAGTG3′ R: 5′TCTTGCATTCACTTCCGGTGT3′ |
IL-1β | F: 5′GAAGTGCTTCGTGCTGGAGT3′ R: 5′ACTGGCATCTGCCCAGTTC3′ |
TLR4 | F: 5′CCACTATTCGGTTGGTGGAC3′ R: 5′ACAGCTTCTCAGCAGGCAAT3′ |
β-actin | F: 5′ACTGGCACCTAGCACAATGA3′ R: 5′CTGCTTGCTGATCCACATCT3′ |
Phylum | Genus | Species | Chicken Breed | Origin | |
---|---|---|---|---|---|
Lactobacillus salivarius | |||||
CML316 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Green Shell layer | Beijing |
CML320 | Firmicutes | Lactobacillus | Lactobacillus salivarius | 817 chicken | Yunfu, Guangdong |
CML322 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Aixiang chicken | Yunfu, Guangdong |
CML327 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Tuer chicken | Yunfu, Guangdong |
CML331 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Yuqingxiang chicken | Yunfu, Guangdong |
CML338 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Mahuanggong chicken | Yunfu, Guangdong |
CML342 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Jianghan chicken | Wuhan, Hubei |
CML345 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Pingguo chicken | Jinan, Shandong |
CML346 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Langya chicken | Langya, Shandong |
CML348 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Luhua chicken | Wenshang, Shandong |
CML350 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Shiqi chicken | Jinan, Shandong |
CML351 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Shouguang chicken | Shouguan, Shandong |
CML352 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Shanzhongxian chicken | Xuancheng, Anhui |
CML354 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Bairi chicken | Jining Shandong |
CML111 | Firmicutes | Lactobacillus | Lactobacillus salivarius | Hy-line brown | Zhuozhou, Hebei |
Lactobacillus gallinarum | |||||
CML330 | Firmicutes | Lactobacillus | Lactobacillus gallinarum | 817 chicken | Yunfu, Guangdong |
CML329 | Firmicutes | Lactobacillus | Lactobacillus gallinarum | Tuer chicken | Yunfu, Guangdong |
CML334 | Firmicutes | Lactobacillus | Lactobacillus gallinarum | Yuqingxiang chicken | Yunfu, Guangdong |
CML190 | Firmicutes | Lactobacillus | Lactobacillus gallinarum | Hy-line brown | Zhuozhou, Hebei |
Ligilactobacillus agilis | |||||
CML313 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Nongda third chicken | Beijing |
CML318 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | 817 chicken | Yunfu, Guangdong |
CML326 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Tuer chicken | Yunfu, Guangdong |
CML323 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Aixiang chicken | Yunfu, Guangdong |
CML336 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Yuqingxiang chicken | Yunfu, Guangdong |
CML341 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Jianghan chicken | Wuhan, Hubei |
CML337 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Mahuanggong chicken | Yunfu, Guangdong |
CML104 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Hy-line brown | Zhuozhou, Hebei |
CML200 | Firmicutes | Ligilactobacillus | Ligilactobacillus agilis | Hy-line Grey | Zhuozhou, Hebei |
Lactobacillus johnsonii | |||||
CML312 | Firmicutes | Lactobacillus | Lactobacillus johnsonii | Nongda third chicken | Beijing |
CML325 | Firmicutes | Lactobacillus | Lactobacillus johnsonii | Tuer chicken | Yunfu, Guangdong |
CML333 | Firmicutes | Lactobacillus | Lactobacillus johnsonii | Yuqingxiang chicken | Yunfu, Guangdong |
CML189 | Firmicutes | Lactobacillus | Lactobacillus johnsonii | Hy-line brown | Zhuozhou, Hebei |
Limosilactobacillus reuteri | |||||
CML189 | Firmicutes | Limosilactobacillus | Limosilactobacillus reuteri | Hy-line brown | Zhuozhou, Hebei |
CML143 | Firmicutes | Limosilactobacillus | Limosilactobacillus reuteri | Hy-line Grey | Zhuozhou, Hebei |
CML321 | Firmicutes | Limosilactobacillus | Limosilactobacillus reuteri | Aixiang chicken | Yunfu, Guangdong |
CML328 | Firmicutes | Limosilactobacillus | Limosilactobacillus reuteri | Tuer chicken | Yunfu, Guangdong |
CML335 | Firmicutes | Limosilactobacillus | Limosilactobacillus reuteri | Yuqingxiang chicken | Yunfu, Guangdong |
Lactobacillus crispatus | |||||
CML319 | Firmicutes | Lactobacillus | Lactobacillus crispatus | 817 chicken | Yunfu, Guangdong |
CML324 | Firmicutes | Lactobacillus | Lactobacillus crispatus | Tuer chicken | Yunfu, Guangdong |
CML332 | Firmicutes | Lactobacillus | Lactobacillus crispatus | Yuqingxiang chicken | Yunfu, Guangdong |
CML343 | Firmicutes | Lactobacillus | Lactobacillus crispatus | Jianghan chicken | Wuhan, Hubei |
CML400 | Firmicutes | Lactobacillus | Lactobacillus crispatus | Hy-line brown | Zhuozhou, Hebei |
Lactobacillus saerimneri | |||||
CML314 | Firmicutes | Lactobacillus | Lactobacillus saerimneri | Nongda third chicken | Beijing |
CML317 | Firmicutes | Lactobacillus | Lactobacillus saerimneri | Green Shell layer | Beijing |
CML344 | Firmicutes | Lactobacillus | Lactobacillus saerimneri | 817 chicken | Yunfu, Guangdong |
CML398 | Firmicutes | Lactobacillus | Lactobacillus saerimneri | Hy-line brown | Zhuozhou, Hebei |
Others | |||||
CML158 | Firmicutes | Lactobacillus | Limosilactobacillus mucosae | Hy-line brown | Zhuozhou, Hebei |
CML174 | Firmicutes | Lactobacillus | Limosilactobacillus panis | Hy-line brown | Zhuozhou, Hebei |
CML176 | Firmicutes | Lactobacillus | Lactobacillus kitasatonis | Hy-line brown | Zhuozhou, Hebei |
CML177 | Firmicutes | Lactobacillus | Limosilactobacillus pontis | Hy-line brown | Zhuozhou, Hebei |
CML180 | Firmicutes | Lactobacillus aviarius | Lactobacillus aviarius subsp. aviarius | Hy-line brown | Zhuozhou, Hebei |
CML184 | Firmicutes | Lactobacillus | Limosilactobacillus vaginalis | Hy-line brown | Zhuozhou, Hebei |
CML185 | Firmicutes | Lactobacillus | Limosilactobacillus coleohominis | Hy-line brown | Zhuozhou, Hebei |
CML187 | Firmicutes | Lactobacillus | Lactobacillus helveticus | Hy-line brown | Zhuozhou, Hebei |
CML188 | Firmicutes | Lactobacillus | Limosilactobacillus ingluviei | Hy-line brown | Zhuozhou, Hebei |
CML202 | Firmicutes | Limosilactobacillus | Limosilactobacillus oris | Hy-line brown | Zhuozhou, Hebei |
CML193 | Firmicutes | Lactobacillus | Limosilactobacillus frumenti | Hy-line brown | Zhuozhou, Hebei |
Scheme 0. | Species | 0 h Living Bacteria (lg CFU/mL) | 2 h Living Bacteria (lg CFU/mL) | Survival Rate (%) |
---|---|---|---|---|
CML319 | Lactobacillus johnsonii | 5.15 ± 0.04 | 5.06 ± 0.03 | 98.12 |
CML313 | Ligilactobacillus agilis | 5.86 ± 0.06 | 5.62 ± 0.09 | 95.87 |
CML350 | Lactobacillus salivarius | 5.28 ± 0.08 | 5.05 ± 0.17 | 95.68 |
CML352 | Lactobacillus salivarius | 5.20 ± 0.13 | 4.89 ± 0.07 | 93.96 |
CML346 | Lactobacillus salivarius | 5.07 ± 0.02 | 4.73 ± 0.01 | 93.39 |
CML312 | Lactobacillus johnsonii | 5.36 ± 0.02 | 4.97 ± 0.05 | 92.79 |
CML344 | Lactobacillus saerimneri | 5.60 ± 0.14 | 5.11 ± 0.05 | 91.27 |
CML345 | Lactobacillus salivarius | 5.49 ± 0.32 | 4.98 ± 0.07 | 90.67 |
CML104 | Ligilactobacillus agilis | 4.51 ± 0.07 | 4.06 ± 0.06 | 89.98 |
CML341 | Ligilactobacillus agilis | 4.51 ± 0.06 | 5.25 ± 0.10 | 86.89 |
CML333 | Lactobacillus johnsonii | 6.04 ± 0.15 | 3.59 ± 0.06 | 85.78 |
CML398 | Lactobacillus saerimneri | 4.19 ± 0.11 | 3.26 ± 0.14 | 82.32 |
CML323 | Ligilactobacillus agilis | 3.96 ± 0.06 | 4.35 ± 0.07 | 81.97 |
CML348 | Lactobacillus salivarius | 5.31 ± 0.03 | 4.18 ± 0.02 | 80.51 |
Strain Number | Species | Treatments | |
---|---|---|---|
0.3% Bile Salt Survival Rate (%) | 0.5% Bile Salt Survival Rate (%) | ||
CML319 | Lactobacillus johnsonii | 88.29 | 31.91 |
CML313 | Ligilactobacillus agilis | 42.70 | 41.25 |
CML352 | Lactobacillus salivarius | 64.24 | 47.08 |
CML350 | Lactobacillus salivarius | 30.81 | 27.79 |
CML346 | Lactobacillus salivarius | 66.64 | 39.83 |
CML398 | Lactobacillus saerimneri | 56.45 | 21.34 |
CML344 | Lactobacillus saerimneri | 52.85 | 45.67 |
CML104 | Ligilactobacillus agilis | 47.88 | 32.36 |
Strain Number | Species | Auto-Aggregation (%) | Co-Aggregation (%) | Hydrophobicity | ||
---|---|---|---|---|---|---|
Escherichia coli | Salmonella typhimurium | Clostridium perfringens | ||||
CML319 | Lactobacillus johnsonii | 84.14 | 48.49 | 56.21 abc | 49.05 b | 41.13 ab |
CML344 | Ligilactobacillus saerimneri | 81.16 | 48.34 | 49.33 bc | 48.26 b | 49.08 ab |
CML352 | Ligilactobacillus salivarius | 84.70 | 47.12 | 47.92 c | 46.54 b | 57.66 a |
CML398 | Ligilactobacillus saerimneri | 80.40 | 47.36 | 54.02 abc | 45.51 b | 41.66 ab |
CML104 | Ligilactobacillus agilis | 78.55 | 48.44 | 57.95 ab | 56.38 a | 21.21 b |
CML350 | Ligilactobacillus salivarius | 79.89 | 48.42 | 61.72 a | 48.57 b | 50.37 ab |
Strain | Species | Inhibition Zone | Hemolysis | ||
---|---|---|---|---|---|
Escherichia coli | Salmonella typhimurium | Clostridium perfringens | |||
CML319 | Lactobacillus johnsonii | − | − | ++ | α |
CML350 | Ligilactobacillus salivarius | + | ++ | +++ | α |
CML352 | Ligilactobacillus salivarius | ++ | + | +++ | α |
CML344 | Ligilactobacillus saerimneri | ++ | ++ | +++ | γ |
CML104 | Ligilactobacillus agilis | + | + | ++ | α |
CML398 | Ligilactobacillus saerimneri | + | + | +++ | γ |
Control | MRS | − | − | − | |
AMP | +++ | +++ | +++ |
Items | Treatments | SEM 2 | p-Value | |
---|---|---|---|---|
Control | CML352 | |||
Egg production, % | ||||
Weeks 56–59 | 90.44 | 90.18 | 0.079 | 0.891 |
Weeks 60–63 | 89.69 | 87.72 | 0.729 | 0.389 |
Weeks 64–67 | 84.95 | 82.86 | 0.896 | 0.345 |
Weeks 56–67 | 88.35 | 86.92 | 0.579 | 0.299 |
Average egg weight, g | ||||
Weeks 56–59 | 62.46 a | 63.16 ab | 0.433 | 0.090 |
Weeks 60–63 | 63.27 a | 64.20 ab | 0.075 | 0.084 |
Weeks 64–67 | 63.56 | 63.86 | 0.016 | 0.632 |
Weeks 56–67 | 63.10 a | 63.74 b | 0.720 | 0.022 |
Average daily feed intake, g/hen per day | ||||
Weeks 56–59 | 117.71 | 117.50 | 0.596 | 0.752 |
Weeks 60–63 | 112.35 | 112.38 | 0.291 | 0.975 |
Weeks 64–67 | 104.12 a | 98.33 b | 0.416 | 0.000 |
Weeks 56–67 | 111.40 | 109.41 | 0.518 | 0.719 |
Feed conversion ratio, g/g | ||||
Weeks 56–59 | 2.08 | 2.06 | 0.062 | 0.669 |
Weeks 60–63 | 1.99 | 2.00 | 0.868 | 0.734 |
Weeks 64–67 | 1.94 | 1.87 | 0.836 | 0.241 |
Weeks 56–67 | 2.00 | 1.98 | 0.691 | 0.789 |
Items | Treatments | p-Value | |
---|---|---|---|
Control | CML352 | ||
The average weight/kg | 2.08 ± 0.01 | 2.00 ± 0.04 | 0.070 |
Abdominal fat proportion/% | 5.19 ± 0.41 | 3.29 ± 0.69 | 0.037 |
Items | Treatments | p-Value | |
---|---|---|---|
Control | CML352 | ||
eggshell strength/Pa | 3.43 ± 0.10 | 3.68 ± 0.08 | 0.042 |
Haugh unit | 78.84 ± 1.68 | 82.08 ± 0.88 | 0.090 |
yolk proportion/% | 0.27 ± 0.00 | 0.28 ± 0.00 | 0.605 |
eggshell thickness/mm | 0.32 ± 0.01 | 0.34 ± 0.00 | 0.023 |
albumen height/mm | 6.67 ± 0.21 | 6.94 ± 0.13 | 0.286 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, C.; Wei, F.; Yang, X.; Feng, Y.; Liu, D.; Hu, Y. Lactobacillus salivarius CML352 Isolated from Chinese Local Breed Chicken Modulates the Gut Microbiota and Improves Intestinal Health and Egg Quality in Late-Phase Laying Hens. Microorganisms 2022, 10, 726. https://doi.org/10.3390/microorganisms10040726
Xu C, Wei F, Yang X, Feng Y, Liu D, Hu Y. Lactobacillus salivarius CML352 Isolated from Chinese Local Breed Chicken Modulates the Gut Microbiota and Improves Intestinal Health and Egg Quality in Late-Phase Laying Hens. Microorganisms. 2022; 10(4):726. https://doi.org/10.3390/microorganisms10040726
Chicago/Turabian StyleXu, Chang, Fuxiao Wei, Xinyue Yang, Yuqing Feng, Dan Liu, and Yongfei Hu. 2022. "Lactobacillus salivarius CML352 Isolated from Chinese Local Breed Chicken Modulates the Gut Microbiota and Improves Intestinal Health and Egg Quality in Late-Phase Laying Hens" Microorganisms 10, no. 4: 726. https://doi.org/10.3390/microorganisms10040726