Major Etiological Agents Isolated from Neonatal Calf Diarrhea Outbreaks in Northern Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Description of the Calf Rearing Area
2.2. Detection of Etiological Agents Isolated from Neonatal Calf Diarrhea
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Naylor, J.M. Neonatal calf diarrhea. Food Anim. Pract. 2009, 70–77. [Google Scholar] [CrossRef]
- Urie, N.J.; Lombard, J.E.; Shivley, C.B.; Kopral, C.A.; Adams, A.E.; Earleywine, T.J.; Olson, J.D.; Garry, F.B. Preweaned heifer management on US dairy operations: Part V. Factors associated with morbidity and mortality in preweaned dairy heifer calves. J. Dairy Sci. 2018, 101, 9229–9244. [Google Scholar] [CrossRef] [PubMed]
- Gomez, D.E.; Weese, J.S. Viral enteritis in calves. Can. Vet. J. 2017, 58, 1267–1274. [Google Scholar]
- Hao, L.; Chen, C.; Bailey, K.; Wang, L. Bovine kobuvirus—A comprehensive review. Transbound. Emerg. Dis. 2021, 68, 1886–1894. [Google Scholar] [CrossRef]
- SDA-APHIS. Dairy 2014, “Dairy Cattle Management Practices in the United States, 2014—Part III.”; United States Department of Agriculture, Animal and Plant Health Inspection Service, Veterinary Services, National Animal Health Monitoring System: Fort Collins, CO, USA, 2016. Available online: https://www.aphis.usda.gov/sites/default/files/dairy14_dr_partiii.pdf (accessed on 9 August 2025).
- Conrady, B.; Brunauer, M.; Roch, F.F. Cryptosporidium spp. infections in combination with other enteric pathogens in the global calf population. Animals 2021, 11, 1786. [Google Scholar] [CrossRef]
- Holland, R.E. Some infectious causes of diarrhea in young farm animals. Clin. Microbiol. Rev. 1990, 3, 345–375. [Google Scholar] [CrossRef]
- Ortega-Mora, L.M.; Pastor-Fernández, I.; Álvarez-García, G. Cryptosporidiosis in cattle: Recent advances in prevention, Saluvet group, Animal health department, Faculty of veterinary sciences, Complutense university of Madrid. In Proceedings of the World Buiatrics Congress, Cancun, Mexico, 20–24 June 2024; pp. 64–73. [Google Scholar]
- López-Novo, C.; Couso-Pérez, S.; Prieto, A.; Díaz, P.; Panadero, R.; López, C.M.; Díez-Baños, P.; Morrondo, P. Prevalence of Cryptosporidium parvum, Giardia duodenalis and Eimeria spp. in diarrhoeic suckling calves from north-western Spain and analysis of their interactions. Int. J. Vet. Sci. Med. 2025, 13, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Foster, D.M.; Smith, G.W. Pathophysiology of diarrhea in calves. Vet. Clin. N. Am. Food Anim. Pract. 2009, 25, 13–36. [Google Scholar] [CrossRef]
- Kolenda, R.; Burdukiewicz, M.; Schierack, P. A systematic review and meta-analysis of the epidemiology of pathogenic Escherichia coli of calves and the role of calves as reservoirs for human pathogenic E. coli. Front. Cell. Infect. Microbiol. 2015, 5, 23. [Google Scholar] [CrossRef]
- Cho, Y.-I.; Yoon, K.-J. An overview of calf diarrhea—Infectious etiology, diagnosis, and intervention. J. Vet. Sci. 2014, 15, 1–17. [Google Scholar] [CrossRef]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Fitzpatrick, E.S.; Fanning, S.; Hartigan, P.J. Veterinary Microbiology and Microbial Disease; Wiley: Chichester, UK, 2011. [Google Scholar]
- Runnels, P.L.; Moon, H.W.; Schneider, R.A. Development of resistance with host age to adhesion of K99+ Escherichia coli to isolated intestinal epithelial cells. Infect. Immun. 1980, 28, 298–300. [Google Scholar] [CrossRef] [PubMed]
- van Mol, W.; Clinquart, J.; Pas, M.; Bokma, J.; Pardon, B. Pathogen-oriented approaches for neonatal calf diarrhea. Vlaams Diergeneeskd. Tijdschr. 2022, 91, 167–181. [Google Scholar] [CrossRef]
- Peek, S.F.; Mcguirk, S.M.; Sweeney, R.W.; Cummings, K.J. Infectious diseases of the gastrointestinal tract. In Rebhun’s Diseases of Dairy Cattle; 3rd ed.; Elsevier: St. Louis, MO, USA, 2018; pp. 249–356. [Google Scholar] [CrossRef]
- de Graaf, D.C.; Vanopdenbosch, E.; Ortega-Mora, L.M.; Abbassi, H.; Peeters, J.E. A review of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol. 1999, 29, 1269–1287. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Thomson, S.; Hamilton, C.A.; Hope, J.C.; Katzer, F.; Mabbott, N.A.; Morrison, L.J.; Innes, E.A. Bovine cryptosporidiosis: Impact, host-parasite interaction and control strategies. Vet. Res. 2017, 48, 42. [Google Scholar] [CrossRef]
- Hoque, S.; Pinto, P.; Ribeiro, C.A.; Canniere, E.; Daandels, Y.; Dellevoet, M.; Bourgeois, A.; Hammouma, O.; Hunter, P.; Gentekaki, E.; et al. Follow-up investigation into Cryptosporidium prevalence and transmission in Western European dairy farms. Vet. Parasitol. 2023, 318, 109920. [Google Scholar] [CrossRef]
- Adkins, P.R.F. Cryptosporidiosis. Vet. Clin. N. Am. Food Anim. Pract. 2022, 38, 121–131. [Google Scholar] [CrossRef]
- Milnes, A.S.; Binns, S.H.; Oliver, S.L.; Bridger, J.C. Retrospective study of noroviruses in samples of diarrhoea from cattle, using the Veterinary Laboratories Agency’s Farmfile database. Vet. Rec. 2007, 160, 326–330. [Google Scholar] [CrossRef]
- Tråvén, M.; Axén, C.; Svensson, A.; Björkman, C.; Emanuelson, U. Prevalence of Bovine Norovirus and Nebovirus and Risk Factors of Infection in Swedish Dairy Herds. Dairy 2022, 3, 137–147. [Google Scholar] [CrossRef]
- Veterinary Information System: National Database of Farms. Available online: https://www.vetinfo.it (accessed on 3 January 2024).
- Carter, G.R.; Cole, J.R., Jr. (Eds.) Diagnostic Procedure in Veterinary Bacteriology and Mycology; Academic Press: New York, NY, USA, 2012. [Google Scholar]
- Casey, T.A.; Bosworth, B.T. Design and evaluation of a multiplex polymerase chain reaction assay for the simultaneous identification of genes for nine different virulence factors associated with Escherichia coli that cause diarrhea and edema disease in swine. J. Vet. Diagn. Investig. 2009, 21, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Fan, Q.; Liu, J.; Pang, Y.; Deng, X.; Xie, Z.; Liji, X.; Khan, M.I. Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus. BMC Vet. Res. 2012, 8, 133. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.I.; Kim, W.I.; Liu, S.; Kinyon, J.M.; Yoon, K.J. Development of a panel of multiplex real-time polymerase chain reaction assays for simultaneous detection of major agents causing calf diarrhea in feces. J. Vet. Diagn. Investig. 2010, 22, 509–517. [Google Scholar] [CrossRef] [PubMed]
- WOAH. Terrestrial Manual 2022, CHAPTER 3. 10.2. Cryptosporidiosis. Available online: https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.10.02_CRYPTO.pdf (accessed on 1 January 2024).
- Wang, D.; Gao, H.; Zhao, L.; Lv, C.; Dou, W.; Zhang, X.; Liu, Y.; Kang, X.; Guo, K. Detection of the dominant pathogens in diarrheal calves of Ningxia, China in 2021–2022. Front. Vet. Sci. 2023, 10, 1155061. [Google Scholar] [CrossRef]
- Feuerstein, A.; Scuda, N.; Klose, C.; Hoffmann, A.; Melchner, A.; Boll, K.; Rettinger, A.; Fell, S.; Straubinger, R.K.; Riehm, J.M. Antimicrobial resistance, serologic and molecular characterization of E. coli isolated from calves with severe or fatal enteritis in Bavaria, Germany. Antibiotics 2022, 11, 23. [Google Scholar] [CrossRef]
- Blanco, J.; Gonzalez, E.; Garcia, S.; Blanco, M.; Regueiro, B.; Bernardez, I. Production of toxins by Escherichia coli strains isolated from calves with diarrhoea in Galicia (North-western Spain). Vet. Microbiol. 1988, 18, 297–311. [Google Scholar] [CrossRef]
- Geletu, U.S.; Usmael, M.A.; Bari, F.D. Rotavirus in calves and its zoonotic importance. Vet. Med. Int. 2021, 2021, 6639701. [Google Scholar] [CrossRef]
- Björkman, C.; Svensson, C.; Christensson, B.; de Verdier, K. Cryptosporidium parvum and Giardia intestinalis in calf diarrhoea in Sweden. Acta Vet. Scand. 2003, 44, 145–152. [Google Scholar] [CrossRef]
- Reynolds, D.J.; Morgan, J.H.; Chanter, N.; Jones, P.W.; Bridger, J.C.; Debney, T.G.; Bunch, K.J. Microbiology of calf diarrhoea in southern Britain. Vet. Rec. 1986, 119, 34–39. [Google Scholar] [CrossRef]
- Cho, Y.I.; Han, J.I.; Wang, C.; Cooper, V.; Schwartz, K.; Engelken, T.; Yoon, K.J. Case-control study of microbiological etiology associated with calf diarrhea. Vet. Microbiol. 2013, 166, 375–385. [Google Scholar] [CrossRef]
- De la Fuente, R.; Luzón, M.; Ruiz-Santa-Quiteria, J.A.; García, A.; Cid, D.; Orden, J.A.; García, S.; Sanz, R.; Gómez-Bautista, M. Cryptosporidium and concurrent infections with other major enteropathogens in 1- to 30-day-old diarrheic dairy calves in central Spain. Vet. Parasitol. 1999, 80, 179–185. [Google Scholar] [CrossRef] [PubMed]
- Quílez, J.; Sánchez-Acedo, C.; del Cacho, E.; López-Bernad, F.; Causapé, A.; Torres, E.; Chalmers, R.M. Cryptosporidium species and subtype analysis from dairy calves in Spain. Parasitology 2008, 135, 1613–1620. [Google Scholar] [CrossRef] [PubMed]
- De la Fuente, R.; García, A.; Ruiz-Santa-Quiteria, J.A.; Luzón, M.; Cid, D.; García, S.; Orden, J.A.; Gómez Bautista, M. Proportional morbidity rates of enteropathogens among diarrheic dairy calves in central Spain. Prev. Vet. Med. 1998, 36, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Brunauer, M.; Roch, F.-F.; Conrady, B. Prevalence of worldwide neonatal calf diarrhoea caused by bovine rotavirus in combination with bovine coronavirus, Escherichia coli K99 and Cryptosporidium spp.: A Meta-Analysis. Animals 2021, 11, 1014. [Google Scholar] [CrossRef] [PubMed]
- Uhde, F.L.; Kaufmann, T.; Sager, H.; Albini, S.; Zanoni, R.; Schelling, E.; Meylan, M. Prevalence of four enteropathogens in the faeces of young diarrhoeic dairy calves in Switzerland. Vet. Rec. 2008, 163, 362–366. [Google Scholar] [CrossRef] [PubMed]

| Lesion Category | Lesion Subtype | Percentage (%) |
|---|---|---|
| Abomasitis | Absent | 12 |
| Catarrhal | 83 | |
| Abomasal ulceration | 5 | |
| Enteritis | Absent | 0 |
| Catarrhal | 89 | |
| Catarrhal–hemorrhagic | 8 | |
| Fibrinous | 3 | |
| Lymphadenomegaly | Absent | 22 |
| Mesenteric | 74 | |
| Generalized | 4 |
| Primer/Probe Name | Sequence 5′-3′ | Target | Reference |
|---|---|---|---|
| BRV-F5 | TCATTTCAGTTGATGAGACCACC | BRV A (VP6) | [26] |
| BRV-F6 | ATTCAATTCTAAGCGTGAGTCTAC | ||
| BRV-Probe | TexasRed-AATATGACACCAGCGGTAGCGGC-(TexasRed-BHQ2) | ||
| BCoV-fwd | CTAGTAACCAGGCTGATGTCAATACC | BCoV (N) | [27] |
| BCoV-rev | GGCGGAAACCTAGTCGGAATA | ||
| BCoV-Probe | CGGCTGACATTCTCGATC (FAM-MGBNFQ) |
| Mixed Infection | Frequency (%) |
|---|---|
| BRV–Cryptosporidium spp. | 10.2 |
| BRV–BCoV | 8.5 |
| BRV–ETEC | 3.8 |
| BRV–BCoV–Cryptosporidium spp. | 2.4 |
| BCoV–Cryptosporidium spp. | 1.2 |
| BCoV–ETEC | 0.1 |
| ETEC–Cryptosporidium spp. | 0.1 |
| Etiological Agent | Belgium | Wallonia (Belgium) | Netherlands | Northern Ireland | Norway | Switzerland | Italy * |
|---|---|---|---|---|---|---|---|
| CALVES’ AGE RANGE (days) | - | 0–30 | 1–21 | - | 1–30 | 1–20 | 1–10 |
| ETEC | 41% | 30% | 3% | 7% | 3% | 6% | 17.20% |
| BRV | 13% | 26% | 18% | 32% | 10% | 59% | 22.20% |
| BCoV | - | 10% | 3% | 4% | 0% | 6% | 20.20% |
| Cryptosporidium spp. | 23% | 46% | 28% | 35% | 4% | 55% | 32.30% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Torreggiani, C.; Pupillo, G.; Garbarino, C.A.; Rugna, G.; Prosperi, A.; Chiapponi, C.; Luppi, A. Major Etiological Agents Isolated from Neonatal Calf Diarrhea Outbreaks in Northern Italy. Pathogens 2025, 14, 847. https://doi.org/10.3390/pathogens14090847
Torreggiani C, Pupillo G, Garbarino CA, Rugna G, Prosperi A, Chiapponi C, Luppi A. Major Etiological Agents Isolated from Neonatal Calf Diarrhea Outbreaks in Northern Italy. Pathogens. 2025; 14(9):847. https://doi.org/10.3390/pathogens14090847
Chicago/Turabian StyleTorreggiani, Camilla, Giovanni Pupillo, Chiara Anna Garbarino, Gianluca Rugna, Alice Prosperi, Chiara Chiapponi, and Andrea Luppi. 2025. "Major Etiological Agents Isolated from Neonatal Calf Diarrhea Outbreaks in Northern Italy" Pathogens 14, no. 9: 847. https://doi.org/10.3390/pathogens14090847
APA StyleTorreggiani, C., Pupillo, G., Garbarino, C. A., Rugna, G., Prosperi, A., Chiapponi, C., & Luppi, A. (2025). Major Etiological Agents Isolated from Neonatal Calf Diarrhea Outbreaks in Northern Italy. Pathogens, 14(9), 847. https://doi.org/10.3390/pathogens14090847

