DNA Barcoding Using 18S rRNA Gene Fragments for Identification of Tick-Borne Protists in Ticks in the Republic of Korea
Abstract
1. Introduction
2. Materials and Methods
2.1. Tick Collection, Species Identification, Pooling, and DNA Extraction
2.2. DNA Barcoding Using 18S rRNA V4 and V9 Regions
2.3. Bioinformatics Analysis and Taxonomic Analysis
2.4. Validation of DNA Barcoding Result via PCR and Phylogenetic Analysis
Pathogen | Target Gene | Primer | Sequence (5′ to 3′) | Size (bp) | Note | Reference |
---|---|---|---|---|---|---|
Hepatozoon spp. | 18S rRNA | HepF | ATACATGAGCAAAATCTCAAC | ~670 | [35] | |
HepR | CTTATTATTCCATGCTGCAG | |||||
Toxoplasma gondii | B1 | Tg_S1 | TGTTCTGTCCTATCGCAACG | 580 | 1st | [36] |
Tg_AS1 | ACGGATGCAGTTCCTTTCTG | |||||
Tg_S2 | TCTTCCCAGACGTGGATTTC | 530 | 2nd | [36] | ||
Tg_AS2 | CTCGACAATACGCTGCTTGA | |||||
Cytauxzoon spp. | cox1 | Th-For2 | TGGYTKGCTTATTGGTTTGG | 1966 | 1st | [37] |
Piro_mt_R1 | ACTTTGAACACACTGCTCG | |||||
Th-For2 | TGGYTKGCTTATTGGTTTGG | 1656 | 2nd | [37] | ||
Cytaux_260R | AATTCCCATCTCGCTATCACTTTC |
3. Results
3.1. Tick Collection and Species Identification
3.2. DNA Barcoding of 18S rRNA Gene V4 and V9 Regions
3.3. Identification of Tick-Borne Protozoa by PCR
3.4. Sequence Analysis and Phylogenetic Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Greay, T.L.; Gofton, A.W.; Paparini, A.; Ryan, U.M.; Oskam, C.L.; Irwin, P.J. Recent insights into the tick microbiome gained through next-generation sequencing. Parasites Vectors 2018, 11, 12. [Google Scholar] [CrossRef]
- Alkathiri, B.; Lee, S.; Ahn, K.; Cho, Y.S.; Youn, S.Y.; Seo, K.; Umemiya-Shirafuji, R.; Xuan, X.; Kwak, D.; Shin, S.; et al. 16S rRNA metabarcoding for the identification of tick-borne bacteria in ticks in the Republic of Korea. Sci. Rep. 2024, 14, 19708. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Leal, S.; Lopes, M.G.; Marcili, A.; Martins, T.F.; González-Acuña, D.; Labruna, M.B. Anaplasmataceae, Borrelia and Hepatozoon agents in ticks (Acari: Argasidae, Ixodidae) from Chile. Acta. Trop. 2019, 192, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Alkathiri, B.; Ahn, K.; Lee, H.; Cho, Y.S.; Youn, S.Y.; Seo, M.; Kwak, D.; Shin, S.; Lee, S. Molecular epidemiology of Theileria species in ticks and its potential threat to livestock in the Republic of Korea. Acta Trop. 2023, 238, 106780. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhang, H.; Cao, J.; Gong, H.; Zhou, J. Epidemiology of toxoplasmosis: Role of the tick Haemaphysalis longicornis. Infect. Dis. Poverty 2016, 5, 14. [Google Scholar] [CrossRef] [PubMed]
- Skotarczak, B. The role of ticks in transmission cycle of Toxoplasma gondii. Ann. Parasitol. 2016, 62, 185–191. [Google Scholar] [CrossRef]
- Otranto, D.; Brianti, E.; Latrofa, M.S.; Annoscia, G.; Weigl, S.; Lia, R.P.; Gaglio, G.; Napoli, E.; Giannetto, S.; Papadopoulos, E. On a Cercopithifilaria sp. transmitted by Rhipicephalus sanguineus: A neglected, but widespread filarioid of dogs. Parasites Vectors 2012, 5, 1. [Google Scholar] [CrossRef]
- Springer, A.; Glass, A.; Probst, J.; Strube, C. Tick-borne zoonoses and commonly used diagnostic methods in human and veterinary medicine. Parasitol. Res. 2021, 120, 4075–4090. [Google Scholar] [CrossRef]
- Tokarz, R.; Lipkin, W.I. Discovery and surveillance of tick-borne pathogens. J. Med. Entomol. 2021, 58, 1525–1535. [Google Scholar] [CrossRef]
- Yin, X.; Altman, T.; Rutherford, E.; West, K.A.; Wu, Y.; Choi, J.; Beck, P.L.; Kaplan, G.G.; Dabbagh, K.; DeSantis, T.Z. A comparative evaluation of tools to predict metabolite profiles from microbiome sequencing data. Front. Microbiol. 2020, 11, 595910. [Google Scholar] [CrossRef]
- Bradley, I.M.; Pinto, A.J.; Guest, J.S. Design and evaluation of Illumina MiSeq-compatible, 18S rRNA gene-specific primers for improved characterization of mixed phototrophic communities. Appl. Environ. Microbiol. 2016, 82, 5878–5891. [Google Scholar] [CrossRef] [PubMed]
- Kounosu, A.; Murase, K.; Yoshida, A.; Maruyama, H.; Kikuchi, T. Improved 18S and 28S rDNA primer sets for NGS-based parasite detection. Sci. Rep. 2019, 9, 15789. [Google Scholar] [CrossRef]
- Macheriotou, L.; Guilini, K.; Bezerra, T.N.; Tytgat, B.; Nguyen, D.T.; Phuong Nguyen, T.X.; Noppe, F.; Armenteros, M.; Boufahja, F.; Rigaux, A. Metabarcoding free-living marine nematodes using curated 18S and CO1 reference sequence databases for species-level taxonomic assignments. Ecol. Evol. 2019, 9, 1211–1226. [Google Scholar] [CrossRef] [PubMed]
- Chihi, A.; Andersen, L.O.; Aoun, K.; Bouratbine, A.; Stensvold, C.R. Amplicon-based next-generation sequencing of eukaryotic nuclear ribosomal genes (metabarcoding) for the detection of single-celled parasites in human faecal samples. Parasite Epidemiol. Control 2022, 17, e00242. [Google Scholar] [CrossRef]
- Choi, J.H.; Kim, S.L.; Yoo, D.K.; Yi, M.; Oh, S.; Kim, M.; Yun, S.; Yong, T.; Choe, S.; Lee, J.K. Metabarcoding of pathogenic parasites based on copro-DNA analysis of wild animals in South Korea. Heliyon 2024, 10, e30059. [Google Scholar] [CrossRef]
- Moreno, Y.; Moreno-Mesonero, L.; Amorós, I.; Pérez, R.; Morillo, J.A.; Alonso, J.L. Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics. Int. J. Hyg. Environ. Health 2018, 221, 102–111. [Google Scholar] [CrossRef] [PubMed]
- Bonnet, S.; Michelet, L.; Moutailler, S.; Cheval, J.; Hebert, C.; Vayssier-Taussat, M.; Eloit, M. Identification of parasitic communities within European ticks using next-generation sequencing. PLoS Negl. Trop. Dis. 2014, 8, e2753. [Google Scholar] [CrossRef]
- Brinkmann, A.; Hekimoğlu, O.; Dinçer, E.; Hagedorn, P.; Nitsche, A.; Ergünay, K. A cross-sectional screening by next-generation sequencing reveals Rickettsia, Coxiella, Francisella, Borrelia, Babesia, Theileria and Hemolivia species in ticks from Anatolia. Parasites Vectors 2019, 12, 26. [Google Scholar] [CrossRef]
- Seo, J.W.; Han, S.Y.; Sung, S.H.; Jung, E.Y.; Kim, J.H.; Lee, S.J.; Yoo, S.S. Survey on tick distribution and tick-borne pathogens in Daejeon and adjacent areas in South Korea. Ticks Tick. Borne Dis. 2021, 12, 101711. [Google Scholar] [CrossRef]
- Noh, Y.; Lee, Y.S.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Jiang, J.; Richards, A.L.; Lee, H.K.; Kim, S.Y. Molecular detection of Rickettsia species in ticks collected from the southwestern provinces of the Republic of Korea. Parasites Vectors 2017, 10, 20. [Google Scholar] [CrossRef]
- Yun, S.; Lee, Y.; Choi, W.; Kim, H.; Chong, S.; Chang, K.; Coburn, J.M.; Klein, T.A.; Lee, W. Molecular detection of severe fever with thrombocytopenia syndrome and tick-borne encephalitis viruses in ixodid ticks collected from vegetation, Republic of Korea, 2014. Ticks Tick Borne Dis. 2016, 7, 970–978. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Han, B.; Lee, H.; Ju, J.; Shin, H. Current Status of Trypanosoma grosi and Babesia microti in Small Mammals in the Republic of Korea. Animals 2024, 14, 989. [Google Scholar] [CrossRef] [PubMed]
- Yamaguti, N.; Tipton, V.J.; Keegan, H.L.; Toshioka, S. Ticks of Japan, Korea, and the Ryukyu islands. Brigh. Young Univ. Sci. Bull. 1971, 15, 1. [Google Scholar]
- Stoeck, T.; Bass, D.; Nebel, M.; Christen, R.; Jones, M.D.M.; Breiner, H.W.; Richards, T.A. Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Mol. Ecol. 2010, 19, 21–31. [Google Scholar] [CrossRef]
- Amaral-Zettler, L.A.; McCliment, E.A.; Ducklow, H.W.; Huse, S.M. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. PLoS ONE 2009, 4, e6372. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; Foundation for Statistical Computing: Vienna, Austria, 2013. [Google Scholar]
- Seo, M.; Kwon, O.; Kwak, D. Molecular detection and phylogenetic analysis of canine tick-borne pathogens from Korea. Ticks Tick. Borne Dis. 2020, 11, 101357. [Google Scholar] [CrossRef]
- Kim, J.Y.; Kwak, Y.S.; Lee, I.; Yong, T. Molecular detection of Toxoplasma gondii in Haemaphysalis ticks in Korea. Korean J. Parasitol. 2020, 58, 327–331. [Google Scholar] [CrossRef]
- Choi, H.; Kim, J.; Han, J.; Kim, H. Successful Management of Immune-Mediated Hemolytic Anemia Secondary to Infection with Cytauxzoon felis and Feline Immunodeficiency Virus. J. Vet. Clin. 2020, 37, 223–226. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Uiterwijk, M.; Vojta, L.; Šprem, N.; Beck, A.; Jurković, D.; Kik, M.; Duscher, G.G.; Hodžić, A.; Reljić, S.; Sprong, H.; et al. Diversity of Hepatozoon species in wild mammals and ticks in Europe. Parasites Vectors 2023, 16, 27. [Google Scholar] [CrossRef]
- Alfonso, Y.; Fraga, J.; Jiménez, N.; Fonseca, C.; Dorta-Contreras, A.J.; Cox, R.; Capó, V.; Bandera, F.; Pomier, O.; Ginorio, D. Detection of Toxoplasma gondii in cerebrospinal fluid from AIDS patients by nested PCR and rapid identification of type I allele at B1 gene by RFLP analysis. Exp. Parasitol. 2009, 122, 203–207. [Google Scholar] [CrossRef]
- Hornok, S.; Boldogh, S.A.; Takács, N.; Kontschán, J.; Szekeres, S.; Sós, E.; Sándor, A.D.; Wang, Y.; Tuska-Szalay, B. Molecular epidemiological study on ticks and tick-borne protozoan parasites (Apicomplexa: Cytauxzoon and Hepatozoon spp.) from wild cats (Felis silvestris), Mustelidae and red squirrels (Sciurus vulgaris) in central Europe, Hungary. Parasites Vectors 2022, 15, 174. [Google Scholar] [CrossRef]
- Tanaka, R.; Hino, A.; Tsai, I.J.; Palomares-Rius, J.E.; Yoshida, A.; Ogura, Y.; Hayashi, T.; Maruyama, H.; Kikuchi, T. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics. PLoS ONE 2014, 9, e110769. [Google Scholar] [CrossRef]
- Choi, J.; Park, J.S. Comparative analyses of the V4 and V9 regions of 18S rDNA for the extant eukaryotic community using the Illumina platform. Sci. Rep. 2020, 10, 6519. [Google Scholar] [CrossRef]
- Hornok, S.; Tánczos, B.; Fernández de Mera, I.G.; de la Fuente, J.; Hofmann-Lehmann, R.; Farkas, R. High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Vet. Parasitol. 2013, 196, 189–193. [Google Scholar] [CrossRef]
- Najm, N.; Meyer-Kayser, E.; Hoffmann, L.; Pfister, K.; Silaghi, C. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: Molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitol. Res. 2014, 113, 2679–2685. [Google Scholar] [CrossRef]
- Alkathiri, B.; Lee, S. Review of ticks (families: Ixodidae and Argasidae) in the Republic of Korea. J. Biomed. Transl. Res. 2022, 23, 91–108. [Google Scholar]
- Cooper, M.K.; Phalen, D.N.; Donahoe, S.L.; Rose, K.; Šlapeta, J. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia. Vet. Parasitol. 2016, 216, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Jones, C.D.; Okhravi, N.; Adamson, P.; Tasker, S.; Lightman, S. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Investig. Ophthalmol. Vis. Sci. 2000, 41, 634–644. [Google Scholar]
- Mans, B.J.; Pienaar, R.; Latif, A.A.; Potgieter, F.T. Diversity in the 18S SSU rRNA V4 hyper-variable region of Theileria spp. in Cape buffalo (Syncerus caffer) and cattle from southern Africa. Parasitology 2011, 138, 766–779. [Google Scholar] [CrossRef] [PubMed]
- Hino, A.; Maruyama, H.; Kikuchi, T. A novel method to assess the biodiversity of parasites using 18S rDNA Illumina sequencing; parasitome analysis method. Parasitol. Int. 2016, 65, 572–575. [Google Scholar] [CrossRef]
- Sun, Y.; Wang, G.; Li, A.; Wangmu; Chui, X.; Jiang, J.; Wang, Q. Phaeotremella camelliae sp. nov. (Phaeotremellaceae, Tremellales), A Novel Yeasts Isolated from Tea-Oil Fruits in Jiangxi Province, China. Curr. Microbiol. 2020, 77, 3168–3173. [Google Scholar] [CrossRef]
- Werner, S.; Peršoh, D.; Rambold, G. Basidiobolus haptosporus is frequently associated with the gamasid mite Leptogamasus obesus. Fungal Biol. 2012, 116, 90–97. [Google Scholar] [CrossRef]
Tick Species | Developmental Stage | No. of Tested Tick 1 (Pool) | No. of Positive Pool | |
---|---|---|---|---|
H. canis | T. gondii | |||
Haemaphysalis spp. 2 | Larva | 7153 (156) | - | 1 (0.64) |
H. longicornis | Nymph | 4441 (461) | - | 6 (1.30) |
Male | 23 (23) | - | 0/23 | |
Female | 104 (104) | - | 1 (0.96) | |
sub total | 4568 (588) | - | 7 (1.19) | |
H. flava | Nymph | 1355 (153) | - | 5 (4.34) |
Male | 17 (17) | - | 0/17 | |
Female | 17 (17) | - | 2 (11.76) | |
sub total | 1389 (187) | - | 7 (3.74) | |
I. nipponensis | Larva | 70 (6) | - | 0/6 |
Nymph | 16 (11) | - | 1 (9.09) | |
Male | 25 (25) | 1 (4) | 3 (12) | |
Female | 20 (20) | - | 0/20 | |
sub total | 131 (62) | 1 (1.61) | 4 (6.45) | |
A. testudinarium | Larva | 124 (5) | - | 0/5 |
Nymph | 10 (5) | - | 0/5 | |
sub total | 134 (10) | - | 0/10 | |
Total | 13,375 (1003) | 1 (0.09) | 19 (1.89) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alkathiri, B.; Lee, S.; Ahn, K.; Youn, S.Y.; Yoo, M.-S.; Lee, H.-S.; Cho, Y.S.; Jung, J.; Seo, K.; Kim, S.; et al. DNA Barcoding Using 18S rRNA Gene Fragments for Identification of Tick-Borne Protists in Ticks in the Republic of Korea. Pathogens 2024, 13, 941. https://doi.org/10.3390/pathogens13110941
Alkathiri B, Lee S, Ahn K, Youn SY, Yoo M-S, Lee H-S, Cho YS, Jung J, Seo K, Kim S, et al. DNA Barcoding Using 18S rRNA Gene Fragments for Identification of Tick-Borne Protists in Ticks in the Republic of Korea. Pathogens. 2024; 13(11):941. https://doi.org/10.3390/pathogens13110941
Chicago/Turabian StyleAlkathiri, Badriah, Subin Lee, KyuSung Ahn, So Youn Youn, Mi-Sun Yoo, Hyang-Sim Lee, Yun Sang Cho, Jaeyun Jung, Kwangwon Seo, Soochong Kim, and et al. 2024. "DNA Barcoding Using 18S rRNA Gene Fragments for Identification of Tick-Borne Protists in Ticks in the Republic of Korea" Pathogens 13, no. 11: 941. https://doi.org/10.3390/pathogens13110941
APA StyleAlkathiri, B., Lee, S., Ahn, K., Youn, S. Y., Yoo, M.-S., Lee, H.-S., Cho, Y. S., Jung, J., Seo, K., Kim, S., Umemiya-Shirafuji, R., Xuan, X., Kwak, D., Shin, S., & Lee, S.-H. (2024). DNA Barcoding Using 18S rRNA Gene Fragments for Identification of Tick-Borne Protists in Ticks in the Republic of Korea. Pathogens, 13(11), 941. https://doi.org/10.3390/pathogens13110941