Molecular Detection and Characterisation of Coxiella burnetii in Koala (Phascolarctos cinereus) Urogenital Tract Swabs †
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Source and Sample Size Calculation
2.2. DNA Extraction and PCR
2.3. Molecular Detection of Host Species and Coxiella burnetii DNA
2.3.1. Detection of Koala DNA (Endogenous Control)
2.3.2. Detection of Coxiella burnetii DNA in Koala Urogenital Swabs
2.3.3. Sample Classification Criteria
2.3.4. Sample Characterisation via Multi-Locus Variable Number of Tandem Repeat Analysis
3. Results
3.1. Quantitative PCR Detection of Koala β-Actin (Endogenous Control)
3.2. Quantitative PCR Detection of Coxiella burnetii DNA
3.3. Multi-Locus Variable Number of Tandem Repeat Genotype Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Weisburg, W.G.; Dobson, M.E.; Samuel, J.E.; Dasch, G.A.; Mallavia, L.P.; Baca, O.; Mandelco, L.; Sechrest, J.E.; Weiss, E.; Woese, C.R. Phylogenetic diversity of the Rickettsiae. J. Bacteriol. 1989, 171, 4202–4206. [Google Scholar] [CrossRef] [PubMed]
- Derrick, E.H. “Q” Fever, a new fever entity: Clinical features, diagnosis and laboratory investigation. Med. J. Aust. 1937, 2, 281–299. [Google Scholar] [CrossRef]
- Hilbink, F.; Penrose, M.; Kovacova, E.; Kazar, J. Q fever is absent from New Zealand. Int. J. Epidemiol. 1993, 22, 945–949. [Google Scholar] [CrossRef] [PubMed]
- Angelakis, E.; Raoult, D. Q fever. Vet. Microbiol. 2010, 140, 297–309. [Google Scholar] [CrossRef] [PubMed]
- Marrie, T.J. Q fever—A review. Can. Vet. J. 1990, 31, 555–563. [Google Scholar]
- Welsh, H.; Lenette, E.H.; Abinanti, F.R.; Winn, J.F.; Kaplan, W. Q fever studies. XXI. The recovery of Coxiella burnetii from the soil and surface water of premises harboring infected sheep. Am. J. Epidemiol. 1959, 70, 14–20. [Google Scholar] [CrossRef]
- Hawker, J.I.; Ayres, J.G.; Blair, I.; Evans, M.R.; Smith, D.L.; Smith, E.G.; Burge, P.S.; Carpenter, M.J.; Caul, E.O.; Coupland, B.; et al. A large outbreak of Q fever in the West Midlands: Windborne spread into a metropolitan area? Commun. Dis. Public Health 1998, 1, 180–187. [Google Scholar]
- Gidding, H.F.; Wallace, C.; Lawrence, G.L.; McIntyre, P.B. Australia’s national Q fever vaccination program. Vaccine 2009, 27, 2037–2041. [Google Scholar] [CrossRef]
- Eldin, C.; Mélenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.L.; Maurin, M.; Raoult, D. From Q Fever to Coxiella burnetii infection: A paradigm change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef]
- Million, M.; Raoult, D. Recent advances in the study of Q fever epidemiology, diagnosis and management. J. Infect. 2015, 71, S2–S9. [Google Scholar] [CrossRef]
- Maurin, M.; Raoult, D. Q Fever. Clin. Microbiol. Rev. 1999, 12, 518–553. [Google Scholar] [CrossRef] [PubMed]
- Garner, M.G.; Longbottom, H.M.; Cannon, R.M.; Plant, A.J. A review of Q fever in Australia 1991–1994. Aust. N. Z. J. Public Health 1997, 21, 722–773. [Google Scholar] [CrossRef] [PubMed]
- Australian Government Department of Health. National Notifiable Diseases Surveillance System. Notifications of Selected Diseases by State Territory and Year. 2021. Available online: http://www9.health.gov.au/cda/source/cda-index.cfm (accessed on 17 August 2021).
- Australian Technical Advisory Group on Immunisation. In The Australian Immunisation Handbook; 2023. Available online: https://immunisationhandbook.health.gov.au/vaccine-preventable-diseases/q-fever (accessed on 4 March 2022).
- Marrie, T.J.; Stein, A.; Janigan, D.; Raoult, D. Route of infection determines the clinical manifestations of acute Q fever. J. Infect. Dis. 1996, 173, 484–487. [Google Scholar] [CrossRef] [PubMed]
- González-Barrio, D.; Ruiz-Fons, F. Coxiella burnetii in wild mammals: A systematic review. Transbound. Emerg. Dis. 2019, 66, 662–671. [Google Scholar] [CrossRef]
- Bennett, M.D.; Woolford, L.; Banazis, M.J.; O’Hara, A.J.; Warren, K.S.; Nicholls, P.K.; Sims, C.; Fenwick, S.G. Coxiella burnetii in western barred bandicoots (Perameles bougainville) from Bernier and Dorre Islands in Western Australia. EcoHealth 2011, 8, 519–524. [Google Scholar] [CrossRef]
- Tozer, S.; Lambert, S.; Strong, C.; Field, H.; Sloots, T.; Nissen, M. Potential animal and environmental sources of Q Fever infection for humans in Queensland. Zoonoses Public Health 2014, 61, 105–112. [Google Scholar] [CrossRef]
- Banazis, M.J.; Bestall, A.S.; Reid, S.A.; Fenwick, S.G. A survey of Western Australian sheep, cattle and kangaroos to determine the prevalence of Coxiella burnetii. Vet. Microbiol. 2010, 143, 337–345. [Google Scholar] [CrossRef]
- Potter, A.S.; Banazis, M.J.; Yang, R.; Reid, S.A.; Fenwick, S.G. Prevalence of Coxiella burnetii in Western Grey Kangaroos (Macropus fuliginosus) in Western Australia. J. Wildl. Dis. 2011, 47, 821–828. [Google Scholar] [CrossRef]
- Pope, J.H.; Scott, W.; Dwyer, R. Coxiella burnetii in kangaroo and kangaroo ticks in Western Queensland. Aust. J. Exp. Biol. Med. Sci. 1960, 38, 17–27. [Google Scholar] [CrossRef]
- Shapiro, A.; Bosward, K.; Mathews, K.; Vincent, G.; Stenos, J.; Tadepalli, M.; Norris, J. Molecular detection of Coxiella burnetii in raw meat intended for pet consumption. Zoonoses Public Health 2020, 67, 443–452. [Google Scholar] [CrossRef]
- Marschner, C.; Flanagan, C.; Higgins, D.P.; Krockenberger, M.B. Validation of ultrasonography in detecting structural disease of the urogenital tract of the koala, Phascolarctos cinereus. Aust. Vet. J. 2014, 92, 177–178. [Google Scholar] [CrossRef] [PubMed]
- Todkill, D.; Fowler, T.; Hawker, J.I. Estimating the incubation period of acute Q fever, a systematic review. Epidemiol. Infect. 2018, 146, 665–672. [Google Scholar] [CrossRef] [PubMed]
- Dhand, N.K.; Khatkar, M.S. Statulator: An Online Statistical Calculator. Sample Size Calculator for Estimating a Single Proportion. 2014. Available online: http://statulator.com/SampleSize/ss1P.html (accessed on 7 May 2019).
- Hulse, L.S.; Hickey, D.; Mitchell, J.M.; Beagley, K.W.; Ellis, W.; Johnston, S.D. Development and application of two multiplex real-time PCR assays for detection and speciation of bacterial pathogens in the koala. J. Vet. Diagn. Investig. 2018, 30, 523–529. [Google Scholar] [CrossRef] [PubMed]
- De Bruin, A.; De Groot, A.; De Heer, L.; Bok, J.; Wielinga, P.R.; Hamans, M.; Van Rotterdam, B.J.; Janse, I. Detection of Coxiella burnetii in complex matrices by using multiplex quantitative PCR during a major Q fever outbreak in The Netherlands. Appl. Environ. Microbiol. 2011, 77, 6516–6523. [Google Scholar] [CrossRef]
- Lockhart, M.G.; Graves, S.R.; Banazis, M.J.; Fenwick, S.G.; Stenos, J. A comparison of methods for extracting DNA from Coxiella burnetii as measured by a duplex qPCR assay. Lett. Appl. Microbiol. 2011, 52, 514–520. [Google Scholar] [CrossRef]
- Bond, K.A.; Vincent, G.; Wilks, C.R.; Franklin, L.; Sutton, B.; Stenos, J.; Cowan, R.; Lim, K.; Athan, E.; Harris, O.; et al. One Health approach to controlling a Q fever outbreak on an Australian goat farm. Epidemiol. Infect. 2016, 144, 1129–1141. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Wittwer, C.T. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Vincent, G.; Stenos, J.; Latham, J.; Fenwick, S.; Graves, S. Novel genotypes of Coxiella burnetii identified in isolates from Australian Q fever patients. Int. J. Med. Microbiol. 2016, 306, 463–470. [Google Scholar] [CrossRef]
- Mathews, K.O.; Savage, C.; Norris, J.M.; Phalen, D.; Malikides, N.; Sheehy, P.A.; Bosward, K.L. Risk factors associated with self-reported Q fever in Australian wildlife rehabilitators: Findings from an online survey. Zoonoses Public Health 2022, 70, 69–80. [Google Scholar] [CrossRef]
- Mathews, K.O.; Toribio, J.A.; Norris, J.M.; Phalen, D.; Wood, N.; Graves, S.R.; Sheehy, P.A.; Bosward, K.L. Coxiella burnetii seroprevalence and Q fever in Australian wildlife rehabilitators. One Health 2021, 12, 100197. [Google Scholar] [CrossRef]
- Duron, O. The IS1111 insertion sequence used for detection of Coxiella burnetii is widespread in Coxiella-like endosymbionts of ticks. FEMS Microbiol. Lett. 2015, 362, fnv132. [Google Scholar] [CrossRef]
- Duron, O.; Noël, V.; McCoy, K.D.; Bonazzi, M.; Sidi-Boumedine, K.; Morel, O.; Vavre, F.; Zenner, L.; Jourdain, E.; Durand, P.; et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog. 2015, 11, e1004892. [Google Scholar] [CrossRef] [PubMed]
- Elsa, J.; Duron, O.; Séverine, B.; González-Acuña, D.; Sidi-Boumedine, K. Molecular methods routinely used to detect Coxiella burnetii in ticks cross-react with Coxiella-like bacteria. Infect. Ecol. Epidemiol. 2015, 5, 29230. [Google Scholar] [CrossRef] [PubMed]
- Brooke, R.J.; Kretzschmar, M.E.; Mutters, N.T.; Teunis, P.F. Human dose response relation for airborne exposure to Coxiella burnetii. BMC Infect. Dis. 2013, 13, 488. [Google Scholar] [CrossRef]
- Vincent, G. Molecular Characterisation of Australian Coxiella burnetii Isolates. Ph.D. Thesis, Murdoch University, Perth, Australia, 2013. [Google Scholar]
- Wildlife Health Australia. Chlamydia in Koalas. 2014. Available online: https://wildlifehealthaustralia.com.au/Portals/0/ResourceCentre/FactSheets/Mammals/Chlamydia_in_koalas.pdf (accessed on 31 March 2024).
Species | Gene Target | Primer/Probe | Sequence (5′-3′) | Final Concentration (nM) | Amplicon Size (bp) | Reference or Accession Number |
---|---|---|---|---|---|---|
Koala (Phascolarctos cinereus) endogenous control | β-actin | Koalaβ-actin-F | CTCAGATTATGTTTGAGACCTTC | 400 | 144 | [26] |
Koalaβ-actin-R | CCTTCATAGATGGGCACA | 400 | ||||
Koalaβ-actin-P | a FAM-ACCATCACCAGAGTCCATCACAAT-BHQ1 b | 200 | ||||
Coxiella burnetii | IS1111 † | IS1111-F | CGCAGCACGTCAAACCG | 300 | 146 | [27] |
IS1111-R | TATCTTTAACAGCGCTTGAACGTC | 300 | ||||
IS1111-P | a FAM-ATGTCAAAAGTAACAAGAATGATCGTAAC-BHQ1 b | 200 | ||||
com1 ‡ | com1-F | AAAACCTCCGCGTTGTCTTCA | 400 | 76 | [28] | |
com1-R | GCTAATGATACTTTGGCAGCGTATTG | 300 | ||||
com1-P | c Cy5-AGAACTGCCCATTTTTGGCGGCCA-BHQ2 d | 200 | ||||
htpAB § | htpAB-F | GTGGCTTCGCGTACATCAGA | 300 | 114 | ||
htpAB-R | CATGGGGTTCATTCCAGCA | 300 | [29] | |||
htpAB-P | e HEX-AGCCAGTACGGTCGCTGTTGTGGT-BHQ1 b | 200 |
Loci | Primer | Sequence (5′-3′) | Final Concentration (nM) | Amplicon Size (bp) | Reference |
---|---|---|---|---|---|
ms24 | ms24-F | a FAM-ATGAAGAAAGGATGGAGGGACT | 400 | 150–300 | |
ms24-R | GCCACACAACTCTGTTTTCAG | ||||
ms28 | ms28-F | a FAM-TAGCAAAGAAATGTGAGGATCG | [31] | ||
ms28-R | ATTGAGCGAGAGAATCCGAATA | ||||
ms33 | ms33-F | a FAM-TAGGCAGAGGACAGAGGACAGT | |||
ms33-R | ATGGATTTAGCCAGCGATAAAA |
Geographical Location | Number of Animals | Sex | ||||||
---|---|---|---|---|---|---|---|---|
Female | Male | Unknown | ||||||
n | % | n | % | n | % | n | % | |
Camden | 75 | 33.3 | 30 | 47.6 | 33 | 52.4 | 12 | 16 |
Lismore | 74 | 32.9 | 21 | 35 | 39 | 65 | 14 | 18.9 |
Port Macquarie | 76 | 33.8 | - | - | - | - | 76 | 100 |
qPCR Assay Cqs and Cut-Offs | |||||||
---|---|---|---|---|---|---|---|
Animal ID | Sex | Endogenous Control (Koala β-Actin) | Coxiella burnetii Multiplex | Target Gene | Sample Classification | ||
IS1111 † ≤ 34 | com1 ‡ ≤ 36 | htpAB § ≤ 35 | |||||
3772-8 | male | 21.6 | Singles | 30.1 | 34.1 | 32.5 | positive |
Triplicates | 29.7 | 34.1 | 32.8 | ||||
29.8 | 33.8 | 33.5 | |||||
30.0 | 34.4 | 33.1 | |||||
18-10145 | unknown | 29.4 | Singles | 33.4 | 36.2 | 34.9 | suspect |
Triplicates | 34 | 38.3 | - | ||||
34 | - | 37 | |||||
33.4 | - | - |
Sample | MLVA Locus | Genotype | ||
---|---|---|---|---|
ms24 | ms28 | ms33 | ||
Nine Mile Reference Strain | 27 | 6 | 9 | Nine Mile Reference Strain |
3772-8 | 17 | 5 | 5 | CbAU06 |
18-10145 | 14 | 5 | 5 | CbAU02 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mathews, K.O.; Phalen, D.; Sheehy, P.A.; Norris, J.M.; Higgins, D.P.; Bosward, K.L. Molecular Detection and Characterisation of Coxiella burnetii in Koala (Phascolarctos cinereus) Urogenital Tract Swabs. Pathogens 2024, 13, 873. https://doi.org/10.3390/pathogens13100873
Mathews KO, Phalen D, Sheehy PA, Norris JM, Higgins DP, Bosward KL. Molecular Detection and Characterisation of Coxiella burnetii in Koala (Phascolarctos cinereus) Urogenital Tract Swabs. Pathogens. 2024; 13(10):873. https://doi.org/10.3390/pathogens13100873
Chicago/Turabian StyleMathews, Karen O., David Phalen, Paul A. Sheehy, Jacqueline M. Norris, Damien P. Higgins, and Katrina L. Bosward. 2024. "Molecular Detection and Characterisation of Coxiella burnetii in Koala (Phascolarctos cinereus) Urogenital Tract Swabs" Pathogens 13, no. 10: 873. https://doi.org/10.3390/pathogens13100873
APA StyleMathews, K. O., Phalen, D., Sheehy, P. A., Norris, J. M., Higgins, D. P., & Bosward, K. L. (2024). Molecular Detection and Characterisation of Coxiella burnetii in Koala (Phascolarctos cinereus) Urogenital Tract Swabs. Pathogens, 13(10), 873. https://doi.org/10.3390/pathogens13100873