Identification of BoLA Alleles Associated with BLV Proviral Load in US Beef Cows
Abstract
:1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Samples
3.2. Animals PVL Quantification
3.3. BoLA-DRB3 Allele Determination
3.4. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bovine Leukosis Virus (BLV) on U.S. Dairy Operations; U.S. Department of Agriculture, Animal and Plant Health Inspection Service: Riverdale Park, MA, USA, 2007.
- Benitez, O.J.; Norby, B.; Bartlett, P.C.; Maeroff, J.E.; Grooms, D.L. Impact of bovine leukemia virus infection on beef cow longevity. Prev. Vet. Med. 2020, 181, 105055. [Google Scholar] [CrossRef] [PubMed]
- Bovine Leukosis Virus (BLV) in U.S. Beef Cattle; U.S. Department of Agriculture, Animal and Plant Health Inspection Service: Riverdale Park, MA, USA, 1999.
- Erskine, R.J.; Bartlett, P.C.; Byrem, T.M.; Render, C.L.; Febvay, C.; Houseman, J.T. Association between bovine leukemia virus, production, and population age in Michigan dairy herds. J. Dairy Sci. 2012, 95, 727–734. [Google Scholar] [CrossRef]
- Ramirez Vasquez, N.F.; Villar Argaiz, D.; Fernandez Silva, J.; Londono Pino, J.; Chaparro Gutierrez, J.J.; Olivera Angel, M.E. Seroprevalence and risk factors of several bovine viral diseases in dairy farms of the San Pedro de los Milagros, Antioquia, Columbia. CES Med. Vet. Zootec. 2016, 11, 15–25. [Google Scholar] [CrossRef]
- Kobayashi, S.; Tsutsui, T.; Yamamoto, T.; Hayama, Y.; Kameyama, K.; Konishi, M.; Murakami, K. Risk factors associated with within-herd transmission of bovine leukemia virus on dairy farms in Japan. BMC Vet. Res. 2010, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, S.; Tsutsui, T.; Yamamoto, T.; Hayama, Y.; Muroga, N.; Konishi, M.; Kameyama, K.I.; Murakami, K. The role of neighboring infected cattle in bovine leukemia virus transmission risk. J. Vet. Med. Sci. 2015, 77, 861–863. [Google Scholar] [CrossRef]
- Ferrer, J.F.; Marshak, R.R.; Abt, D.A.; Kenyon, S.J. Persistent lymphocytosis in cattle: Its cause, nature and relation to lymphosarcoma. Ann. Rech. Vet. 1978, 9, 851–857. [Google Scholar]
- Burny, A.; Bruck, C.; Cleuter, Y.; Couez, D.; Deschamps, J.; Ghysdael, J.; Grégoire, D.; Kettmann, R.; Mammerickx, M.; Marbaix, G. Bovine leukemia virus, a versatile agent with various pathogenic effects in various animal species. Cancer Res. 1985, 45, 4578s–4582s. [Google Scholar]
- White, T.L.; Moore, D.A. Reasons for whole carcass condemnations of cattle in the United States and implications for producer education and veterinary intervention. J. Am. Vet. Med. Assoc. 2009, 235, 937–941. [Google Scholar] [CrossRef]
- Rezac, D.J.; Thomson, D.U.; Siemens, M.G.; Prouty, F.L.; Reinhardt, C.D.; Bartle, S.J. A survey of gross pathologic conditions in cull cows at slaughter in the Great Lakes region of the United States. J. Dairy Sci. 2014, 97, 4227–4235. [Google Scholar] [CrossRef]
- Panei, C.J.; Takeshima, S.N.; Omori, T.; Nunoya, T.; Davis, W.C.; Ishizaki, H.; Matoba, K.; Aida, Y. Estimation of bovine leukemia virus (BLV) proviral load harbored by lymphocyte subpopulations in BLV-infected cattle at the subclinical stage of enzootic bovine leucosis using BLV-CoCoMo-qPCR. BMC Vet. Res. 2013, 9, 95. [Google Scholar] [CrossRef]
- Kobayashi, T.; Inagaki, Y.; Ohnuki, N.; Sato, R.; Murakami, S.; Imakawa, K. Increasing Bovine leukemia virus (BLV) proviral load is a risk factor for progression of Enzootic bovine leucosis: A prospective study in Japan. Prev. Vet. Med. 2019, 178, 104680. [Google Scholar] [CrossRef] [PubMed]
- Janeway, C.A.J.; Travers, P.; Walport, M. Immunobiology: The Immune System in Health and Disease, 5th ed.; Garland Science: New York, NY, USA, 2001. [Google Scholar]
- Maccari, G.; Robinson, J.; Ballingall, K.; Guethlein, L.A.; Grimholt, U.; Kaufman, J.; Ho, C.S.; de Groot, N.G.; Flicek, P.; Bontrop, R.E.; et al. IPD-MHC 2.0: An improved inter-species database for the study of the major histocompatibility complex. Nucleic Acids Res. 2017, 45, D860–D864. [Google Scholar] [CrossRef]
- Lohr, C.E.; Sporer, K.R.B.; Brigham, K.A.; Pavliscak, L.A.; Mason, M.M.; Borgman, A.; Pavliscak, L.A.; Mason, M.M.; Borgman, A.; Ruggiero, V.J.; et al. Phenotypic Selection of Dairy Cattle Infected with Bovine Leukemia Virus Demonstrates Immunogenetic Resilience through NGS-Based Genotyping of BoLA MHC Class II Genes. Pathogens 2022, 11, 104. [Google Scholar] [CrossRef] [PubMed]
- Lo, C.W.; Borjigin, L.; Saito, S.; Fukunaga, K.; Saitou, E.; Okazaki, K.; Mizutani, T.; Wada, S.; Takeshima, S.N.; Aida, Y. BoLA-DRB3 Polymorphism is Associated with Differential Susceptibility to Bovine Leukemia Virus-Induced Lymphoma and Proviral Load. Viruses 2020, 12, 352. [Google Scholar] [CrossRef] [PubMed]
- Takeshima, S.N.; Ohno, A.; Aida, Y. Bovine leukemia virus proviral load is more strongly associated with bovine major histocompatibility complex class II DRB3 polymorphism than with DQA1 polymorphism in Holstein cow in Japan. Retrovirology 2019, 16, 14. [Google Scholar] [CrossRef]
- Salim, B.; Takeshima, S.N.; Nakao, R.; Moustafa, M.A.M.; Ahmed, M.A.; Kambal, S.; Mwacharo, J.M.; Alkhaibari, A.M.; Giovambattista, G. BoLA-DRB3 gene haplotypes show divergence in native Sudanese cattle from taurine and indicine breeds. Sci. Rep. 2021, 11, 17202. [Google Scholar] [CrossRef]
- Ordonez, D.; Bohorquez, M.D.; Avendano, C.; Patarroyo, M.A. Comparing class II MHC DRB3 diversity in Columbian simmental and simbrah cattle across worldwide bovine populations. Front. Genet. 2022, 13, 772885. [Google Scholar] [CrossRef]
- de Araujo Neto, F.R.; Vieira, D.A.; Santos, D.J.A.; Pessoa, M.C.; Borquis, R.R.A.; de Oliveira, H.N.; Marques, L.F.A. Population structure of Simmental beef cattle using pedigree analysis. Trop. Anim. Health Prod. 2020, 52, 1513–1517. [Google Scholar] [CrossRef]
- Makanjuola, B.O.; Miglior, F.; Abdalla, E.A.; Maltecca, C.; Schenkel, F.S.; Baes, C.F. Effect of genomic selection on rate of inbreeding and coancestry and effective population size of Holstein and Jersey cattle populations. J. Dairy Sci. 2020, 103, 5183–5199. [Google Scholar] [CrossRef]
- Hutchinson, H.C.; Norby, B.; Droscha, C.J.; Sordillo, L.M.; Coussens, P.M.; Bartlett, P.C. Bovine leukemia virus detection and dynamics following experimental inoculation. Res. Vet. Sci. 2020, 133, 269–275. [Google Scholar] [CrossRef]
- Pavliscak, L.A.; Nirmala, J.; Singh, V.K.; Sporer, K.R.B.; Taxis, T.M.; Kumar, P.; Goyal, S.M.; Mor, S.K.; Schroeder, D.C.; Wells, S.J.; et al. Tracing Viral Transmission and Evolution of Bovine Leukemia Virus through Long Read Oxford Nanopore Sequencing of the Proviral Genome. Pathogens 2021, 10, 1191. [Google Scholar] [CrossRef] [PubMed]
- Saama, P.M.; Jacob, J.B.; Kehrli, M.E.; Freeman, A.E.; Kelm, S.C.; Kuck, A.L.; Tempelman, R.J.; Burton, J.L. Genetic variation in bovine mononuclear leukocyte responses to dexamethasone. J. Dairy Sci. 2004, 87, 3928–3937. [Google Scholar] [CrossRef] [Green Version]
- Van Arendonk, J.A.M.; Bink MC, A.M.; Bijma, P.; Bovenhuis, H.; DeKoning, D.J.; Brascamp, E.W. Use of phenotype and molecular data for genetic evaluation of livestock. In From Jay L. Lush to Genomics: Visions for Animal Breeding and Genetics; Iowa State University: Ames, IA, USA, 1999; pp. 60–69. [Google Scholar]
Allele | Total Count 1 | # of Animals 2 | Allele Frequency | Estimated Allelic Effect 3 | p–Value 4 | Lymphocyte Count (#/μL) 5 |
---|---|---|---|---|---|---|
*010:01 | 1 | 1 | 0.003 | 0.53 | 0.60 | 3934 ± 0 |
*001:01 | 5 | 5 | 0.016 | 1.52 | 0.68 | 6957.80 ± 2369.64 |
*011:01 | 1 | 1 | 0.003 | 0.93 | 0.95 | 6823 ± 0 |
*015:01 | 3 | 2 | 0.010 | 1.20 | 0.86 | 6033 ± 782 |
*016:01 | 4 | 3 | 0.013 | 0.95 | 0.96 | 4789.50 ± 625.97 |
*018:01 | 99 | 74 | 0.315 | 1.90 | 0.21 | 8494.57 ± 379.70 |
*002:01 | 92 | 66 | 0.293 | 0.33 | 0.04 ** | 5628.72 ± 258.81 |
*026:01 | 66 | 46 | 0.210 | 2.55 | 0.08 * | 8394.68 ± 434.96 |
*032:01 | 6 | 6 | 0.019 | 1.31 | 0.79 | 8193.17 ± 1651.94 |
*033:01 | 10 | 9 | 0.032 | 0.08 | 0.01 ** | 6531 ± 1236.41 |
*037:01 | 1 | 1 | 0.003 | 0.64 | 0.71 | 6602 ± 0 |
*048:02 | 4 | 2 | 0.013 | 1.54 | 0.65 | 5832.50 ± 405.59 |
*006:01 | 2 | 1 | 0.006 | 1.72 | 0.61 | 14475 ± 0 |
*007:01 | 7 | 4 | 0.022 | 1.40 | 0.68 | 5670.71 ± 336.23 |
*008:01 | 7 | 5 | 0.002 | 1.66 | 0.56 | 7296.43 ± 995.11 |
*009:01 | 3 | 2 | 0.010 | 1.01 | 0.99 | 7044 ± 1618 |
*009:02 | 2 | 1 | 0.006 | 1.76 | 0.60 | 9641 ± 0 |
Primer | Direction | Sequence 1 | Length (bp) 2 | Tm 3 |
---|---|---|---|---|
DRB3.1F | Forward | ACACTGACGACATGGTTCTACA TCGTGGAGCG ATCCTCTCTCGCAGCACATTTCC | 55 | 70.5 |
DRB3.4F | Forward | ACACTGACGACATGGTTCTACA TGCCTGGTGG ATCCTCTCTCGCAGCACATTTCC | 55 | 70.8 |
DRB3.R | Reverse | TACGGTAGCAGAGACTTGGTCT TCGCCGCTGCACAGTGAAACTCTC | 46 | 70 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
LaHuis, C.H.; Benitez, O.J.; Droscha, C.J.; Singh, S.; Borgman, A.; Lohr, C.E.; Bartlett, P.C.; Taxis, T.M. Identification of BoLA Alleles Associated with BLV Proviral Load in US Beef Cows. Pathogens 2022, 11, 1093. https://doi.org/10.3390/pathogens11101093
LaHuis CH, Benitez OJ, Droscha CJ, Singh S, Borgman A, Lohr CE, Bartlett PC, Taxis TM. Identification of BoLA Alleles Associated with BLV Proviral Load in US Beef Cows. Pathogens. 2022; 11(10):1093. https://doi.org/10.3390/pathogens11101093
Chicago/Turabian StyleLaHuis, Ciarra H., Oscar J. Benitez, Casey J. Droscha, Sukhdeep Singh, Andrew Borgman, Chaelynne E. Lohr, Paul C. Bartlett, and Tasia M. Taxis. 2022. "Identification of BoLA Alleles Associated with BLV Proviral Load in US Beef Cows" Pathogens 11, no. 10: 1093. https://doi.org/10.3390/pathogens11101093
APA StyleLaHuis, C. H., Benitez, O. J., Droscha, C. J., Singh, S., Borgman, A., Lohr, C. E., Bartlett, P. C., & Taxis, T. M. (2022). Identification of BoLA Alleles Associated with BLV Proviral Load in US Beef Cows. Pathogens, 11(10), 1093. https://doi.org/10.3390/pathogens11101093