Chlamydia caviae in Swiss and Dutch Guinea Pigs—Occurrence and Genetic Diversity
Abstract
1. Introduction
2. Results
2.1. Chlamydiaceae and C. caviae Prevalence Data
2.2. Molecular Typing of C. caviae from the Swiss and Dutch Samples
2.3. Whole Genome Sequencing of C. caviae Isolates
2.4. Other Chlamydial Species in Guinea Pigs and Rabbits
2.5. Clinical Signs in Chlamydiaceae-Positive Guinea Pigs and Rabbits
2.6. Symptoms Reported by Guinea Pig and Rabbit Owners
3. Discussion
3.1. Prevalence Study in Swiss and Dutch Guinea Pigs
3.2. Prevalence Study in Swiss Pet Rabbits
3.3. C. caviae Sequencing
3.4. Clinical Signs in Chlamydia-Positive Animals
3.5. C. psittaci in Guinea Pigs and Rabbits—A New Zoonotic Risk?
3.6. Zoonotic Potential of C. caviae and C. psittaci
4. Materials and Methods
4.1. Sampling of Swiss Guinea Pigs and Rabbits and Swab Preparation
4.2. Sampling of Dutch Guinea Pigs and Swab Preparation
4.3. Chlamydiaceae Screening of Swiss and Dutch Samples
4.4. Typing of Chlamydiaceae-Positive Samples
4.5. Typing of C. psittaci-Positive Swiss Samples
4.6. OmpA Typing of C. caviae-Positive Swiss and Dutch Samples
4.7. Whole Genome Sequencing
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Borel, N.; Polkinghorne, A.; Pospischil, A. A Review on Chlamydial Diseases in Animals: Still a Challenge for Pathologists? Veter. Pathol. 2018, 55, 374–390. [Google Scholar] [CrossRef] [PubMed]
- Burnard, D.; Polkinghorne, A. Chlamydial infections in wildlife–conservation threats and/or reservoirs of ‘spill-over’ infections? Veter. Microbiol. 2016, 196, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Murray, E.S. Guinea Pig Inclusion Conjunctivitis Virus: I. Isolation and Identification as a Member of the Psittacosis-Lymphogranuloma-trachoma Group. J. Infect. Dis. 1964, 114, 1–12. [Google Scholar] [CrossRef]
- McGeoch, D.J. Molecular evolution of the γ–Herpesvirinae. Philos. Trans. R. Soc. B Biol. Sci. 2001, 356, 421–435. [Google Scholar] [CrossRef] [PubMed]
- Mount, D.T.; Bigazzi, P.E.; Barron, A.L. Infection of Genital Tract and Transmission of Ocular Infection to Newborns by the Agent of Guinea Pig Inclusion Conjunctivitis. Infect. Immun. 1972, 5, 921–926. [Google Scholar] [CrossRef] [PubMed]
- Lutz-Wohlgroth, L.; Becker, A.; Brugnera, E.; Huat, Z.L.; Zimmermann, D.; Grimm, F.; Haessig, M.; Greub, G.; Kaps, S.; Spiess, B.; et al. Chlamydiales in Guinea-pigs and Their Zoonotic Potential. J. Veter. Med. Ser. A 2006, 53, 185–193. [Google Scholar] [CrossRef]
- Cheong, H.C.; Lee, C.Y.Q.; Cheok, Y.Y.; Tan, G.M.Y.; Looi, C.Y.; Wong, W.F. Chlamydiaceae: Diseases in Primary Hosts and Zoonosis. Microorganisms 2019, 7, 146. [Google Scholar] [CrossRef]
- Ramakers, B.P.; Heijne, M.; Lie, N.; Le, T.-N.; Van Vliet, M.; Claessen, V.P.; Tolsma, P.J.; De Rosa, M.; Roest, H.I.; Vanrompay, D.; et al. Zoonotic Chlamydia caviae Presenting as Community-Acquired Pneumonia. N. Engl. J. Med. 2017, 377, 992–994. [Google Scholar] [CrossRef]
- Van Grootveld, R.; Bilsen, M.P.; Boelsums, T.L.; Heddema, E.R.; Groeneveld, G.H.; Gooskens, J.; De Boer, M.G. Chlamydia caviae Causing Community-Acquired Pneumonia: An Emerging Zoonosis. Vector-Borne Zoonotic Dis. 2018, 18, 635–637. [Google Scholar] [CrossRef]
- Harrup, A.J.; Rooney, N. Current welfare state of pet guinea pigs in the UK. Veter. Rec. 2020, 186, 282. [Google Scholar] [CrossRef]
- Fawcett, A. Management of husbandry-related problems in guinea pigs. In Pract. 2011, 33, 163–171. [Google Scholar] [CrossRef]
- Spalatin, J.; Fraser, C.E.O.; Connell, R.; Hanson, R.P.; Berman, D.T. Agents of psittacosis-lymphogranuloma venereum group isolated from muskrats and snowshoe hares in Saskatchewan. Can. J. Comp. Med. Veter. Sci. 1966, 30, 260–264. [Google Scholar]
- Iversen, J.O.; Spalatin, J.; Fraser, C.E.O.; Hanson, R.P.; Berman, D.T. The Susceptibility of Muskrats and Snowshoe Hares to Experimental Infection with a Chlamydial Agent. Can. J. Comp. Med. Rev. Can. Med. Comp. 1970, 34, 80–89. [Google Scholar]
- Iversen, J.O.; Spalatin, J.; Fraser, C.E.O.; Hanson, R.P. Ocular involvement with chlamydia psittaci (Strain M56) in rab-bits inoculated intravenously. Can. J. Comp. Med. 1974, 38, 298–302. [Google Scholar] [PubMed]
- Iversen, J.O.; Spalatin, J.; Hanson, R.P. Experimental chlamydiosis in wild and domestic lagomorphs. J. Wildl. Dis. 1976, 12, 215–220. [Google Scholar] [CrossRef]
- Ni, X.; Qin, S.; Lou, Z.; Ning, H.; Sun, X. Seroprevalence and Risk Factors ofChlamydiaInfection in Domestic Rabbits (Oryctolagus cuniculus) in China. BioMed Res. Int. 2015, 2015, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Kilpatrick, A.M.; Altizer, S. Disease Ecology. Nat. Educ. Knowl. 2010, 3, 55. [Google Scholar]
- Vanrompay, D.; Butaye, P.; Sayada, C.; Ducatelle, R.; Haesebrouck, F. Characterization of avian Chlamydia psittaci strains using omp1 restriction mapping and serovar-specific monoclonal antibodies. Res. Microbiol. 1997, 148, 327–333. [Google Scholar] [CrossRef]
- Broecke, B.V.; Mariën, J.; Sabuni, C.A.; Mnyone, L.; Massawe, A.W.; Matthysen, E.; Leirs, H. Relationship between population density and viral infection: A role for personality? Ecol. Evol. 2019, 9, 10213–10224. [Google Scholar] [CrossRef]
- Brunelle, B.W.; Sensabaugh, G.F. The ompA Gene in Chlamydia trachomatis Differs in Phylogeny and Rate of Evolution from Other Regions of the Genome. Infect. Immun. 2006, 74, 578–585. [Google Scholar] [CrossRef]
- Rawre, J.; Juyal, D.; Dhawan, B. Molecular Typing of Chlamydia trachomatis: An Overview. Indian J. Med Microbiol. 2017, 35, 17–26. [Google Scholar] [CrossRef]
- Pannekoek, Y.; Dickx, V.; Beeckman, D.S.A.; Jolley, K.A.; Keijzers, W.C.; Vretou, E.; Maiden, M.C.J.; Vanrompay, D.; Van Der Ende, A. Multi Locus Sequence Typing of Chlamydia Reveals an Association between Chlamydia psittaci Genotypes and Host Species. PLoS ONE 2010, 5, e14179. [Google Scholar] [CrossRef]
- Overgaauw, P.; Avermaete, K.; Mertens, C.; Meijer, M.; Schoemaker, N. Prevalence and zoonotic risks of Trichophyton mentagrophytes and Cheyletiella spp. in guinea pigs and rabbits in Dutch pet shops. Veter. Microbiol. 2017, 205, 106–109. [Google Scholar] [CrossRef]
- Harkinezhad, T.; Geens, T.; Vanrompay, D. Chlamydophila psittaci infections in birds: A review with emphasis on zoonotic consequences. Veter. Microbiol. 2009, 135, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Sanderson, H.; Vasquez, M.; Killion, H.; Vance, M.; Sondgeroth, K.; Fox, J. Fatal Chlamydia psittaci infection in a domestic kitten. J. Veter. Diagn. Investig. 2021, 33, 101–103. [Google Scholar] [CrossRef] [PubMed]
- Sprague, L.D.; Schubert, E.; Hotzel, H.; Scharf, S.; Sachse, K. The detection of Chlamydophila psittaci genotype C infection in dogs. Veter. J. 2009, 181, 274–279. [Google Scholar] [CrossRef]
- Jenkins, C.; Jelocnik, M.; Melinda, L.; O’Rourke, B.; Chicken, C.; Carrick, J.; Polkinghorne, A. An epizootic of Chlamydia psittaci equine reproductive loss associated with suspected spillover from native Australian parrots. Emerg. Microbes Infect. 2018, 7, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Reinhold, P.; Ostermann, C.; Liebler-Tenorio, E.; Berndt, A.; Vogel, A.; Lambertz, J.; Rothe, M.; Rüttger, A.; Schubert, E.; Sachse, K. A Bovine Model of Respiratory Chlamydia psittaci Infection: Challenge Dose Titration. PLoS ONE 2012, 7, e30125. [Google Scholar] [CrossRef] [PubMed]
- Knittler, M.R.; Sachse, K. Chlamydia psittaci: Update on an underestimated zoonotic agent. Pathog. Dis. 2015, 73, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Hogerwerf, L.; Roof, I.; De Jong, M.J.K.; Dijkstra, F.; Van Der Hoek, W. Animal sources for zoonotic transmission of psittacosis: A systematic review. BMC Infect. Dis. 2020, 20, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Favaroni, A.; Trinks, A.; Weber, M.; Hegemann, J.H.; Schnee, C. Pmp Repertoires Influence the Different Infectious Potential of Avian and Mammalian Chlamydia psittaci Strains. Front. Microbiol. 2021, 12, 1–13. [Google Scholar] [CrossRef]
- Chan, J.; Doyle, B.; Branley, J.; Sheppeard, V.; Gabor, M.; Viney, K.; Quinn, H.; Janover, O.; McCready, M.; Heller, J. An outbreak of psittacosis at a veterinary school demonstrating a novel source of infection. One Health 2017, 3, 29–33. [Google Scholar] [CrossRef]
- Jelocnik, M.; Branley, J.; Heller, J.; Alderson, S.; Galea, F.; Polkinghorne, A. Multilocus sequence typing identifies an avian-like Chlamydia psittaci strain involved in equine placentitis and associated with subsequent human psittacosis. Emerg. Microbes Infect. 2017, 6, 1–3. [Google Scholar] [CrossRef]
- Ehricht, R.; Slickers, P.; Goellner, S.; Hotzel, H.; Sachse, K. Optimized DNA microarray assay allows detection and genotyping of single PCR-amplifiable target copies. Mol. Cell. Probes 2006, 20, 60–63. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, B.; Depner, K.; Schirrmeier, H.; Beer, M. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 2006, 136, 200–209. [Google Scholar] [CrossRef]
- Heijne, M.; Van Der Goot, J.A.; Fijten, H.; Van Der Giessen, J.W.; Kuijt, E.; Maassen, C.B.M.; Van Roon, A.; Wit, B.; Koets, A.P.; Roest, H.I.J. A cross sectional study on Dutch layer farms to investigate the prevalence and potential risk factors for different Chlamydia species. PLoS ONE 2018, 13, e0190774. [Google Scholar] [CrossRef]
- Taylor-Brown, A.; Vaughan, L.; Greub, G.; Timms, P.; Polkinghorne, A. Twenty years of research into Chlamydia-like organisms: A revolution in our understanding of the biology and pathogenicity of members of the phylum Chlamydiae. Pathog. Dis. 2015, 73, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Heddema, E.R.; Van Hannen, E.J.; Bongaerts, M.; Dijkstra, F.; Hove, R.-J.T.; De Wever, B.; Vanrompay, D. Typing of Chlamydia psittaci to monitor epidemiology of psittacosis and aid disease control in The Netherlands, 2008 to 2013. Eurosurveillance 2015, 20, 21026. [Google Scholar] [CrossRef][Green Version]
- Pantchev, A.; Sting, R.; Bauerfeind, R.; Tyczka, J.; Sachse, K. New real-time PCR tests for species-specific detection of Chlamydophila psittaci and Chlamydophila abortus from tissue samples. Veter. J. 2009, 181, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Sachse, K.; Laroucau, K.; Hotzel, H.; Schubert, E.; Ehricht, R.; Slickers, P. Genotyping of Chlamydophila psittaci using a new DNA microarray assay based on sequence analysis of ompA genes. BMC Microbiol. 2008, 8, 63. [Google Scholar] [CrossRef] [PubMed]
- Kik, M.; Heijne, M.; Ijzer, J.; Grinwis, G.; Pannekoek, Y.; Gröne, A. Fatal Chlamydia avium Infection in Captive Picazuro Pigeons, The Netherlands. Emerg. Infect. Dis. 2020, 26, 2520–2522. [Google Scholar] [CrossRef]
- Antipov, D.; Korobeynikov, A.; McLean, J.S.; Pevzner, P.A. hybridSPAdes: An algorithm for hybrid assembly of short and long reads. Bioinformatics 2016, 32, 1009–1015. [Google Scholar] [CrossRef] [PubMed]
- Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef] [PubMed]
- Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [PubMed]



displays the methods applied only for the Swiss sample set, whereas
displays the methods applied on both Dutch and Swiss sample set.
depicts the results obtained for each method.
displays the methods applied only for the Swiss sample set, whereas
displays the methods applied on both Dutch and Swiss sample set.
depicts the results obtained for each method.
| Swiss Prevalence Study | |||||||
|---|---|---|---|---|---|---|---|
| Husbandry Number | Type of Husbandry | Number of Animals | Clinical Signs Present (y/n) | Type of Clinical Signs in Guinea Pigs and Rabbits | Chlamydiaceae-Positive Swabs (n)/ Total (n) | Range of Ct Values | C. caviae Confirmed (n)/ Chlamydiaceae-Positive (n) |
| 5 | Breeder | 22 | yes | Subconjunctival fat deposition, serous and mucous ocular discharge, lens opacification, chemosis, crust accumulation | 6/76 | 25.8–35.6 | 3/6 A |
| 8 | Breeder | 11 | yes | Crust accumulation, serous ocular and nasal discharge | 5/23 | 24–34.1 | 5/5 |
| 18 | Private owner | 7 | yes | Crust accumulation | 1/15 | 34.7 | 0/1 B |
| 19 | Private owner | 27 | yes | Hyperemia, crust accumulation | 1/55 | 32 | 0/1 B |
| 21 | Private owner | 11 | yes | Mucous ocular discharge, serous nasal discharge | 1/24 | 36.7 | 0/1 |
| 24 | Breeder | 18 | yes | Mucous and serous nasal discharge, crusts accumulation, corneal opacification | 1/37 | 36.7 | 0/1 B |
| 26 | Private owner | 12 | yes | Serous nasal discharge, mucous ocular discharge, hyperemia, crusts accumulation | 1/26 | 32.3 | 0/1 B |
| 28 | Private owner | 12 | yes | Serous ocular discharge, corneal opacification, subconjunctival fat deposition | 1/25 | 34.6 | 0/1 |
| 57 | Private owner | 1 | no | − | 1/2 | 37.6 | 0/1 |
| Dutch Prevalence Study | |||||||
| Husbandry Number | Type of Husbandry | Number of Animals | Clinical Signs Present (y/n) | Type of Clinical Signs in Guinea Pigs | Chlamydiaceae-Positive Swabs (n)/ Total (n) | Range of Ct Values | C. caviae Confirmed (n)/ Chlamydiaceae-Positive (n) |
| 5 | Show breeder | 28 | no | − | 1/6 | 31.1 | 1/1 |
| 13 | Show breeder | 83 | yes | Mucopurulent ocular discharge, pharyngeal stridor, conjunctivitis, corneal edema, corneal lesions, rhonchi, painful mandibular lymph nodes | 9/20 | 24.6–36.3 | 7/9 |
| 19 | Show breeder | 31 | no | − | 1/7 | 37.7 | 0/1 |
| 28 | Show breeder | 8 | no | − | 1/2 | 37.2 | 0/1 |
| 38 | Trader | 51 | yes | Conjunctivitis, mucous and mucopurulent ocular discharge, blepharospasm, mucous nasal discharge, nasal stridor, enlarged mandibular lymph nodes | 13/13 | 22–36.1 | 11/13 |
| Switzerland | The Netherlands | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Chlamydiaceae-Positive A (Guinea Pigs/Rabbits) | C.caviae-Positive B (Guinea Pigs/Rabbits) | C.psittaci-Positive C (Guinea Pigs/Rabbits) | Chlamydiaceae-Negative (Guinea Pigs/Rabbits) | Total of Collected Samples (Guinea Pigs/Rabbits) | Chlamydiaceae-Positive A | C.caviae-Positive B | Chlamydiaceae-Negative | Total of Collected Samples | |
| Conjunctival samples | 11/3 | 7/0 | 0/2 | 282/118 | 293/121 | 25 | 19 | 175 | 200 |
| Individual samples | 1/1 | 1/0 | 0/1 | 65/10 | 66/11 | 0 | 0 | 0 | 0 |
| Pooled samples | 10/2 | 6/0 | 0/1 | 217/108 | 227/110 | 0 | 0 | 0 | 0 |
| Composite samples | 0/0 | 0/0 | 0/0 | 0/0 | 0/0 | 25 | 19 | 175 | 200 |
| Rectal samples | 4/0 | 1/0 | 2/0 | 256/110 | 260/110 | 0 | 0 | 0 | 0 |
| Total | 15/3 | 8/0 | 2/2 | 538/228 | 553/231 | 25 | 19 | 175 | 200 |
| NL_Conj_Li Chromosome | NL_Conj_Li Plasmid | 04DC41 Chromosome | 04DC41 Plasmid | |
|---|---|---|---|---|
| Size | 1,175,666 | 7532 | 1,175,594 | 7659 |
| Contigs | 1 | 1 | 9 | 1 |
| GC% | 39.27 | 33.48 | 39.26 | 33.32 |
| CDS | 987 | 8 | 988 | 8 |
| rRNA | 3 | 3 | ||
| tRNA | 38 | 38 | ||
| ANI to GPIC | 99.55 | 99.79 | 99.54 | 99.84 |
| Switzerland | The Netherlands | Total Number of Samples | Total Number of Animals | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Husbandries | Animals | Conjunctival Samples | Rectal Samples | Husbandries | Animals | Conjunctival samples | Rectal Samples | |||||||
| Individual | Pooled | Composite | Individual | Pooled | Composite 1 | |||||||||
| Guinea Pigs | 30 | 260 | 66 | 227 | 0 | 260 | 37 | 878 | 0 | 0 | 200 | 0 | 753 | 1138 |
| Rabbits | 34 | 110 | 11 | 110 | 0 | 110 | 0 | 0 | 0 | 0 | 0 | 0 | 231 | 110 |
| Total | 64 2 | 370 | 414 | 370 | 37 | 878 | 200 | 0 | 984 | 1248 | ||||
| Method | Target | Primer and Probe | Sequence (5’–3’) | Final Concentration of Primers and Probe in the PCR Mix | Base Pairs for Each Amplicon | Annealing Temperature | References |
|---|---|---|---|---|---|---|---|
| Chlamydiaceae 23S rRNA qPCR 1 | 23S rRNA 1 | Ch23S-F | CTGAAACCAGTAGCTTATAAGGGGT | 500 nM A/1000 nM B | 111 | 60 °C | [34] |
| Ch23S-R | ACCTCGCCGTTTAACTTAACTCC | ||||||
| Ch23S-p | FAM-CTCATCATGCAAAAGGCACGCCG-TAMRA | 200 nM | |||||
| eGFP 3 | eGFP-1-F | GACCACTACCAGCAGAACAC | 200 nM | 177 | [35] | ||
| eGFP-10-R | CTTGTACAGCTCGTACATGC | ||||||
| eGFP-Hex | HEX-AGCACCCAGTCCGCCCTGAGCA-BHQI | ||||||
| IPC 2 | ChMIX3IPC-template (plasmid) | ACCTCGCCGTTTAACTTAACTCCCTGCGCGGATGCTAATGG CACAAGCGCGTCGTTCGTACCTAGAAGGTTTGAAGCACCTT CCCACATAGTGACCGCTTATAAGCTACTGGTTTCAG | 200 nM | In-house | |||
| IPC-probe | VIC-CGCGTCGTTCGTACC-MGB-NFQ | ||||||
| 16S rRNA PCR 3 | 16S rRNA | 16S IGF | GATGAGGCATGCAAGTCGAACG | 300 nM | 278 | 58 °C | [37] |
| 16S IGR | CCAGTGTTGGCGGTCAATCTCTC | ||||||
| VD4 C. caviae ompA PCR 1 | VD4 of the ompA gene | CCVDF CCVDR | GTCCAGAGCTACATTTGATGC ATTTTGTTGATTTGAAGCGAAGC | 500 nM | 130 | 60 °C | [38] |
| C. psittaci-specific qPCR 3 | ompA | CppsOMP1_For | CACTATGTGGGAAGGTGCTTCA | 900 nM | 76 | 60 °C | [39] |
| CppsOMP1_Rev | CTGCGCGGATGCTAATGG | ||||||
| CppsOMP1 | FAM-CGCTACTTGGTGTGAC-MGB-NFQ | 200 nM | |||||
| eGFP | eGFP_For | GACCACTACCAGCAGAACAC | 400 nM | 132 | [35] | ||
| eGFP_Rev | GAACTCCAGCAGGACCATG | ||||||
| eGFP_probe | AGCACCCAGTCCGCCCTGAGCA | 200 nM | |||||
| OmpA C. psittaci-specific PCR 3 | ompA | ompA F (CTU) | ATGAAAAAACTCTTGAAATCGG | 200 nM | 1050 | 49 °C | [40] |
| ompA rev | TCCTTAGAATCTGAATTGAGC | ||||||
| C. caviae complete ompA gene PCR 1 | ompA | ompA_Fw1 | GAATAGCGAGCACAAAAAGAAAAGA | 500 nM A/400 nM B | 1268 | 59 °C A 60 °C B | [8] |
| ompA_Rv1 | GGTTCTGATAGCGGGACAAAAA | ||||||
| Additional primers | ompA_Fw3 | GCAGAATGGTCCACAAAT#GC | 500 nM | 498 | |||
| ompA_Rv3 | GTTCAATCTATAAGAAAGAGCTAAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ciuria, S.; Brouwer, M.S.M.; de Gier, M.M.; van Zeeland, Y.; Bossers, A.; Prähauser, B.; Schädler, J.; Hatt, J.-M.; Heijne, M.; Borel, N. Chlamydia caviae in Swiss and Dutch Guinea Pigs—Occurrence and Genetic Diversity. Pathogens 2021, 10, 1230. https://doi.org/10.3390/pathogens10101230
Ciuria S, Brouwer MSM, de Gier MM, van Zeeland Y, Bossers A, Prähauser B, Schädler J, Hatt J-M, Heijne M, Borel N. Chlamydia caviae in Swiss and Dutch Guinea Pigs—Occurrence and Genetic Diversity. Pathogens. 2021; 10(10):1230. https://doi.org/10.3390/pathogens10101230
Chicago/Turabian StyleCiuria, Silvia, Michael S. M. Brouwer, Marende M. de Gier, Yvonne van Zeeland, Alex Bossers, Barbara Prähauser, Julia Schädler, Jean-Michel Hatt, Marloes Heijne, and Nicole Borel. 2021. "Chlamydia caviae in Swiss and Dutch Guinea Pigs—Occurrence and Genetic Diversity" Pathogens 10, no. 10: 1230. https://doi.org/10.3390/pathogens10101230
APA StyleCiuria, S., Brouwer, M. S. M., de Gier, M. M., van Zeeland, Y., Bossers, A., Prähauser, B., Schädler, J., Hatt, J.-M., Heijne, M., & Borel, N. (2021). Chlamydia caviae in Swiss and Dutch Guinea Pigs—Occurrence and Genetic Diversity. Pathogens, 10(10), 1230. https://doi.org/10.3390/pathogens10101230

