E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population and Specimen Collection
2.2. HR HPV Detection and Genotyping
2.3. E6/E7 mRNA HPV Detection
2.4. Statistical Analysis
3. Results
3.1. Cervical Cytology
3.2. HR HPV DNA in Cervical Samples
3.3. E6/E7 mRNA in Cervical Samples
3.4. Prevalence of HR HPV Based on E6/E7 mRNA HPV Expression in Different Cytological Groups
3.5. Prevalence of E6/E7 mRNA HR HPV Expression According to Age
3.6. Comparison of Tests for the Detection of HR HPV Genotypes and Their Oncogenic Activity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Araldi, R.P.; Muro, S.; Assaf, R.; De Carvalho, R.F.; Caldas, M.A.; de Carvalho, R.; de Souza, J.M.; Magnelli, R.F.; Grando, D.; Roperto, F.P.; et al. Papillomaviruses: A Systematic Review. Genet. Mol. Biol. 2017, 21, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Gheit, T. Mucosal and Cutaneous Human Papillomavirus Infections and Cancer Biology. Front. Oncol. 2019, 9, 355. [Google Scholar] [CrossRef] [PubMed]
- Mehta, K.; Lamins, L. High-Risk Human Papillomaviruses and DNA Repair. In Viruses and Human Cancer: From Basic Science to Clinical Prevention (Recent Results in Cancer Research); Wu, T.-C., Chang, M.-H., Jeang, K.-T., Eds.; Springer Nature: Cham, Switzerland, 2021; pp. 141–155. ISBN 9783030573614. [Google Scholar]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Rancic, N.K.; Miljkovic, P.M.; Deljanin, Z.M.; Marinkov-Zivkovic, E.M.; Stamenkovic, B.N.; Bojanovic, M.R.; Jovanovic, M.M.; Miljkovic, D.P.; Stankovic, S.M.; Otasevic, S.A. Knowledge about HPV Infection and the HPV Vaccine among Parents in Southeastern Serbia. Medicina 2022, 58, 1–11. [Google Scholar] [CrossRef]
- Bruni, L.; Albero, G.; Serrano, B.; Mena, M.; Collado, J.; Gómez, D.; Muñoz, J.; Bosch, F.; de Sanjosé, S. Human Papillomavirus and Related Diseases in Serbia. Available online: https://hpvcentre.net/statistics/reports/SRB.pdf (accessed on 22 January 2022).
- Bruni, L.; Albero, G.; Serrano, B.; Mena, M.; Collado, J.; Gómez, D.; Muñoz, J.; Bosch, F.; de Sanjosé, S. Human Papillomavirus and Related Diseases in the World. Available online: https://hpvcentre.net/statistics/reports/XWX.pdf (accessed on 22 January 2022).
- Rosenblum, H.G.; Lewis, R.M.; Gargano, J.W.; Querec, T.D.; Unger, E.R.; Markowitz, L.E. Declines in Prevalence of Human Papillomavirus Vaccine-Type Infection Among Females after Introduction of Vaccine—United States, 2003–2018. MMWR Surveill. Summ. 2021, 70, 415–420. [Google Scholar] [CrossRef]
- Lee, L.Y.; Garland, S.M. Human Papillomavirus Vaccination: The Population Impact. F1000Research 2017, 6, 866. [Google Scholar] [CrossRef]
- Bouvard, V.; Baan, R.; Straif, K.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Benbrahim-Tallaa, L.; Guha, N.; Freeman, C.; Galichet, L.; et al. A Review of Human Carcinogens--Part B: Biological Agents. Lancet Oncol. 2009, 10, 321–322. [Google Scholar] [CrossRef]
- Egawa, N.; Doorbar, J. The Low-Risk Papillomaviruses. Virus Res. 2017, 231, 119–127. [Google Scholar] [CrossRef]
- Wang, S.S.; Hildesheim, A. Chapter 5: Viral and Host Factors in Human Papillomavirus Persistence and Progression. J. Natl. Cancer Inst. Monogr. 2003, 2003, 35–40. [Google Scholar] [CrossRef]
- McBride, A.A. Mechanisms and Strategies of Papillomavirus Replication. Biol. Chem. 2017, 398, 919–927. [Google Scholar] [CrossRef]
- Williams, V.M.; Filippova, M.; Soto, U.; Duerksen-Hughes, P.J. HPV-DNA Integration and Carcinogenesis: Putative Roles for Inflammation and Oxidative Stress. Future Virol. 2011, 6, 45–57. [Google Scholar] [CrossRef]
- Fernandes, J.V.; de Medeiros Fernandes, T.A.A. Human Papillomavirus: Biology and Pathogenesis. In Human Papillomavirus and Related Diseases—From Bench to Bedside—A Clinical Perspective; Broeck, D.D., Vanden, Eds.; InTech Europe: Rijeka, Croatia, 2012; pp. 3–40. ISBN 978-953-307-860-1. [Google Scholar]
- Münger, K.; Howley, P.M. Human Papillomavirus Immortalization and Transformation Functions. Virus Res. 2002, 89, 213–228. [Google Scholar] [CrossRef] [PubMed]
- Wentzensen, N.; Arbyn, M.; Berkhof, J.; Bower, M.; Canfell, K.; Einstein, M.; Farley, C.; Monsonego, J.; Franceschi, S. Eurogin 2016 Roadmap: How HPV Knowledge Is Changing Screening Practice. Int. J. Cancer 2017, 140, 2192–2200. [Google Scholar] [CrossRef] [PubMed]
- Burger, E.A.; Kornør, H.; Klemp, M.; Lauvrak, V.; Kristiansen, I.S. HPV MRNA Tests for the Detection of Cervical Intraepithelial Neoplasia: A Systematic Review. Gynecol. Oncol. 2011, 120, 430–438. [Google Scholar] [CrossRef]
- Lindh, M.; Görander, S.; Andersson, E.; Horal, P.; Mattsby-Balzer, I.; Ryd, W. Real-Time Taqman PCR Targeting 14 Human Papilloma Virus Types. J. Clin. Virol. 2007, 40, 321–324. [Google Scholar] [CrossRef] [PubMed]
- Moscicki, A.B.; Ma, Y.; Wibbelsman, C.; Darragh, T.M.; Powers, A.; Farhat, S.; Shiboski, S. Rate of and Risks for Regression of Cervical Intraepithelial Neoplasia 2 in Adolescents and Young Women. Obstet. Gynecol. 2010, 116, 1373–1380. [Google Scholar] [CrossRef]
- Boulet, G.A.V.; Horvath, C.A.J.; Berghmans, S.; Bogers, J. Human Papillomavirus in Cervical Cancer Screening: Important Role as Biomarker. Cancer Epidemiol. Biomarkers Prev. 2008, 17, 810–817. [Google Scholar] [CrossRef]
- Wright, T.C. Cervical Cancer Screening in the 21st Century: Is It Time to Retire the Pap Smear? Clin. Obstet. Gynecol. 2007, 50, 313–323. [Google Scholar] [CrossRef]
- Derbie, A.; Mekonnen, D.; Woldeamanuel, Y.; Van Ostade, X.; Abebe, T. HPV E6/E7 MRNA Test for the Detection of High Grade Cervical Intraepithelial Neoplasia (CIN2+): A Systematic Review. Infect. Agent. Cancer 2020, 15, 9. [Google Scholar] [CrossRef]
- Tüney, İ.; Altay, A.; Ergünay, K.; Önder, S.Ç.; Usubütün, A.; Salman, M.C.; Bozdayi, G.; Karabulut, E.; Badur, O.S.; Yüce, K.; et al. Hpv Types and E6/E7 MRNA Expression in Cervical Samples from Turkish Women with Abnormal Cytology in Ankara, Turkey. Turkish J. Med. Sci. 2017, 47, 194–200. [Google Scholar] [CrossRef]
- Poljak, M.; Oštrbenk Valenčak, A.; Gimpelj Domjanič, G.; Xu, L.; Arbyn, M. Commercially Available Molecular Tests for Human Papillomaviruses: A Global Overview. Clin. Microbiol. Infect. 2020, 26, 1144–1150. [Google Scholar] [CrossRef] [PubMed]
- Kovacevic, G.; Nikolic, N.; Jovanovic-Galovic, A.; Hrnjakovic-Cvjetkovic, I.; Vuleta, D.; Patic, A.; Radovanov, J.; Milosevic, V. Frequency of Twelve Carcinogenic Human Papilloma Virus Types among Women from the South Backa Region, Vojvodina, Serbia. Turkish J. Med. Sci. 2016, 46, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Kovacevic, G.; Milosevic, V.; Nikolic, N.; Patic, A.; Dopudj, N.; Radovanov, J.; Cvjetkovic, I.H.; Petrovic, V.; Petrovic, M. The Prevalence of 30 HPV Genotypes Detected by EUROArray HPV in Cervical Samples among Unvaccinated Women from Vojvodina Province, Serbia. PLoS ONE 2021, 16, e0249134. [Google Scholar] [CrossRef] [PubMed]
- Milutin-Gašperov, N.; Sabol, I.; Halec, G.; Matovina, M.; Grce, M. Retrospective Study of the Prevalence of High-Risk Human Papillomaviruses among Croatian Women. Coll. Antropol. 2007, 31, 89–96. [Google Scholar]
- Grozdanov, P.; Zlatkov, V.; Ganchev, G.; Karagiosov, I.; Toncheva, D.; Galabov, A.S. HPV Prevalence and Type Distribution in Women with Normal or Abnormal Pap Smear in Bulgaria. J. Med. Virol. 2014, 86, 1905–1910. [Google Scholar] [CrossRef]
- Schettino, M.T.; De Franciscis, P.; Schiattarella, A.; La Manna, V.; Della Gala, A.; Caprio, F.; Tammaro, C.; Ammaturo, F.P.; Guler, T.; Yenigün, E.H. Prevalence of HPV Genotypes in South Europe: Comparisons between an Italian and a Turkish Unvaccinated Population. J. Environ. Public Health 2019, 2019, 8769735. [Google Scholar] [CrossRef]
- Bruni, L.; Diaz, M.; Castellsagué, X.; Ferrer, E.; Bosch, F.X.; De Sanjosé, S. Cervical Human Papillomavirus Prevalence in 5 Continents: Meta-Analysis of 1 Million Women with Normal Cytological Findings. J. Infect. Dis. 2010, 202, 1789–1799. [Google Scholar] [CrossRef]
- Sabol, I.; Gašperov, N.M.; Matovina, M.; Božinovic, K.; Grubišic, G.; Fistonic, I.; Belci, D.; Alemany, L.; Džebro, S.; Dominis, M.; et al. Cervical HPV Type-Specific Pre-Vaccination Prevalence and Age Distribution in Croatia. PLoS ONE 2017, 12, e0180480. [Google Scholar] [CrossRef]
- Guan, P.; Howell-Jones, R.; Li, N.; Bruni, L.; De Sanjosé, S.; Franceschi, S.; Clifford, G.M. Human Papillomavirus Types in 115,789 HPV-Positive Women: A Meta-Analysis from Cervical Infection to Cancer. Int. J. Cancer 2012, 131, 2349–2359. [Google Scholar] [CrossRef]
- Karadža, M.; Lepej, S.Ž.; Planinić, A.; Grgić, I.; Ćorušić, A.; Planinić, P.; Ćorić, M.; Hošnjak, L.; Komloš, K.F.; Poljak, M.; et al. Distribution of Human Papillomavirus Genotypes in Women with High-Grade Cervical Intraepithelial Lesions and Cervical Carcinoma and Analysis of Human Papillomavirus-16 Genomic Variants. Croat. Med. J. 2021, 62, 68–79. [Google Scholar] [CrossRef]
- Bowden, S.J.; Fiander, A.N.; Hibbitts, S. HPV 51: A Candidate for Type-Replacement Following Vaccination? medRxiv 2021. [Google Scholar] [CrossRef]
- Schmitt, M.; Depuydt, C.; Benoy, I.; Bogers, J.; Antoine, J.; Arbyn, M.; Pawlita, M. Prevalence and Viral Load of 51 Genital Human Papillomavirus Types and Three Subtypes. Int. J. Cancer 2013, 132, 2395–2403. [Google Scholar] [CrossRef]
- Yuce, K.; Pinar, A.; Salman, M.C.; Alp, A.; Sayal, B.; Dogan, S.; Hascelik, G. Detection and Genotyping of Cervical HPV with Simultaneous Cervical Cytology in Turkish Women: A Hospital-Based Study. Arch. Gynecol. Obstet. 2012, 286, 203–208. [Google Scholar] [CrossRef]
- Mollers, M.; Boot Hein, J.; Vriend Henrike, J.; King Audrey, J.; van den Broek Ingrid, V.F.; van Bergen Jan, E.A.M.; Brink Antoinette, A.T.P.; Wolffs Petra, F.G.; Hoebe Christian, J.P.A.; Meijer Chris, J.L.M.; et al. Prevalence, Incidence and Persistence of Genital HPV Infections in a Large Cohort of Sexually Active Young Women in the Netherlands. Vaccine 2013, 31, 394–401. [Google Scholar] [CrossRef] [PubMed]
- Piana, A.; Sotgiu, G.; Cocuzza, C.; Musumeci, R.; Marras, V.; Pischedda, S.; Deidda, S.; Muresu, E.; Castiglia, P. High HPV-51 Prevalence in Invasive Cervical Cancers: Results of a Pre-Immunization Survey in North Sardinia, Italy. PLoS ONE 2013, 8, 6–11. [Google Scholar] [CrossRef]
- Dalgo Aguilar, P.; Loján González, C.; Córdova Rodríguez, A.; Acurio Paéz, K.; Arévalo, A.P.; Bobokova, J. Prevalence of High-Risk Genotypes of Human Papillomavirus: Women Diagnosed with Premalignant and Malignant Pap Smear Tests in Southern Ecuador. Infect. Dis. Obstet. Gynecol. 2017, 2017, 12–14. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.; Liao, Y.; Hu, Y.; Shen, H.; Wan, Y.; Wu, Y. HPV Prevalence and Genotype Distribution Among Women From Hengyang District of Hunan Province, China. Front. Public Heal. 2021, 9, 1346. [Google Scholar] [CrossRef] [PubMed]
- Sladič, M.; Taneska, P.; Cvjetičanin, B.; Velikonja, M.; Smrkolj, V.; Smrkolj, Š. Cervical Intraepithelial Neoplasia Grade 3 in a HPV-Vaccinated Patient: A Case Report. Medicina 2022, 58, 339. [Google Scholar] [CrossRef] [PubMed]
- Učakar, V.; Poljak, M.; Klavs, I. Pre-Vaccination Prevalence and Distribution of High-Risk Human Papillomavirus (HPV) Types in Slovenian Women: A Cervical Cancer Screening Based Study. Vaccine 2012, 30, 116–120. [Google Scholar] [CrossRef]
- Ursu, R.; Onofriescu, M.; Nemescu, D.; Iancu, L.S. HPV Prevalence and Type Distribution in Women with or without Cervical Lesions in the Northeast Region of Romania. Virol. J. 2011, 8, 558. [Google Scholar] [CrossRef]
- Oliveira, C.R.; Niccolai, L.M. Monitoring HPV Vaccine Impact on Cervical Disease: Status and Future Directions for the Era of Cervical Cancer Elimination. Prev. Med. 2021, 144, 106363. [Google Scholar] [CrossRef] [PubMed]
- Bruno, M.T.; Ferrara, M.; Fava, V.; Rapisarda, A.; Coco, A. HPV Genotype Determination and E6/E7 MRNA Detection for Management of HPV Positive Women. Virol. J. 2018, 15, 52. [Google Scholar] [CrossRef] [PubMed]
- Pan, D.; Zhang, C.Q.; Liang, Q.L.; Hong, X.C. An Efficient Method That Combines the ThinPrep Cytologic Test with E6/E7 MRNA Testing for Cervical Cancer Screening. Cancer Manag. Res. 2019, 11, 4773–4780. [Google Scholar] [CrossRef] [PubMed]
- Pruski, D.; Millert-Kalinska, S.; Lewek, A.; Kedzia, W. Sensitivity and Specificity of HR HPV E6/E7 MRNA Test in Detecting Cervical Squamous Intraepithelial Lesion and Cervical Cancer. Ginekol. Pol. 2019, 90, 66–71. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Xu, X. The Diagnostic Value of HPV E6/E7 MRNA Test in Young Women with Cervical Squamous Intraepithelial Lesion: A Retrospective Analysis. Research Square. Res. Sq. 2021, 4, 1–14. [Google Scholar] [CrossRef]
- Rossi, P.G.; Bisanzi, S.; Allia, E.; Mongia, A.; Carozzi, F.; Gillio-Tos, A.; De Marco, L.; Ronco, G.; Gustinucci, D.; Del Mistro, A.; et al. Determinants of Viral Oncogene E6-E7 MRNA Overexpression in a Population- Based Large Sample of Women Infected by High-Risk Human Papillomavirus Types. J. Clin. Microbiol. 2017, 55, 1056–1065. [Google Scholar] [CrossRef]
- Argyri, E.; Tsimplaki, E.; Daskalopoulou, D.; Stravopodis, D.J.; Kouikoglou, O.; Terzakis, E.; Panotopoulou, E. E6/E7 MRNA Expression of High-Risk HPV Types in 849 Greek Women. Anticancer Res. 2013, 33, 4007–4012. [Google Scholar]
- Baron, C.; Henry, M.; Tamalet, C.; Villeret, J.; Richet, H.; Carcopino, X. Relationship Between HPV 16, 18, 31, 33, 45 DNA Detection and Quantitation and E6/E7 MRNA Detection Among a Series of Cervical Specimens With Various Degrees of Histological Lesions. J. Med. Virol. 2015, 87, 1389–1396. [Google Scholar] [CrossRef]
- Dabeski, D.; Duvlis, S.; Basheska, N.; Antovska, V.; Stojovski, M.; Trajanova, M.; Dimitrov, G.; Dabeski, A.; Gureva-Gjorgievska, N. Comparison Between HPV DNA Testing and HPV E6/E7 MRNA Testing in Women with Squamous Cell Abnormalities of the Uterine Cervix. Prilozi 2019, 40, 51–58. [Google Scholar] [CrossRef]
- Salimović-Bešić, I.; Tomić-Čiča, A.; Smailji, A.; Hukić, M. Comparison of the Detection of HPV-16, 18, 31, 33, and 45 by Type-Specific DNA- and E6/E7 MRNA-Based Assays of HPV DNA Positive Women with Abnormal Pap Smears. J. Virol. Methods 2013, 194, 222–228. [Google Scholar] [CrossRef]
- Fontecha, N.; Basaras, M.; Hernáez, S.; Andía, D.; Cisterna, R. Assessment of Human Papillomavirus E6/E7 Oncogene Expression as Cervical Disease Biomarker. BMC Cancer 2016, 16, 852. [Google Scholar] [CrossRef]
- Quint, W.; Jenkins, D.; Molijn, A.; Struijk, L.; Van De Sandt, M.; Doorbar, J.; Mols, J.; Van Hoof, C.; Hardt, K.; Struyf, F.; et al. One Virus, One Lesion—Individual Components of CIN Lesions Contain a Specific HPV Type. J. Pathol. 2012, 227, 62–71. [Google Scholar] [CrossRef] [PubMed]
- van den Heuvel, C.N.A.M.; Loopik, D.L.; Ebisch, R.M.F.; Elmelik, D.; Andralojc, K.M.; Huynen, M.; Bulten, J.; Bekkers, R.L.M.; Massuger, L.F.A.G.; Melchers, W.J.G.; et al. RNA-Based High-Risk HPV Genotyping and Identification of High-Risk HPV Transcriptional Activity in Cervical Tissues. Mod. Pathol. 2020, 33, 748–757. [Google Scholar] [CrossRef] [PubMed]
- Loopik, D.L.; IntHout, J.; Ebisch, R.M.F.; Melchers, W.J.G.; Massuger, L.F.A.G.; Siebers, A.G.; Bekkers, R.L.M. The Risk of Cervical Cancer after Cervical Intraepithelial Neoplasia Grade 3: A Population-Based Cohort Study with 80,442 Women. Gynecol. Oncol. 2020, 157, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Bruno, M.T.; Scalia, G.; Cassaro, N.; Boemi, S. Multiple HPV 16 Infection with Two Strains: A Possible Marker of Neoplastic Progression. BMC Cancer 2020, 20, 444. [Google Scholar] [CrossRef] [PubMed]
- Soto-De Leon, S.; Camargo, M.; Sanchez, R.; Munoz, M.; Perez-Prados, A.; Purroy, A.; Patarroyo, M.E.; Patarroyo, M.A. Distribution Patterns of Infection with Multiple Types of Human Papillomaviruses and Their Association with Risk Factors. PLoS ONE 2011, 6, e14705. [Google Scholar] [CrossRef]
- Wang, H.Y.; Lee, D.; Park, S.; Kim, G.; Kim, S.; Han, L.; Yubo, R.; Li, Y.; Park, K.H.; Lee, H. Diagnostic Performance of HPV E6/E7 MRNA and HPV DNA Assays for the Detection and Screening of Oncogenic Human Papillomavirus Infection among Woman with Cervical Lesions in China. Asian Pacific J. Cancer Prev. 2015, 16, 7633–7640. [Google Scholar] [CrossRef]
- Mittal, S.; Basu, P.; Muwonge, R.; Banerjee, D.; Ghosh, I.; Sengupta, M.M.; Das, P.; Dey, P.; Mandal, R.; Panda, C.; et al. Risk of High-Grade Precancerous Lesions and Invasive Cancers in High-Risk HPV-Positive Women with Normal Cervix or CIN 1 at Baseline—A Population-Based Cohort Study. Int. J. Cancer 2017, 140, 1850–1859. [Google Scholar] [CrossRef]
- Zorzi, M.; Del Mistro, A.; Giorgi Rossi, P.; Laurino, L.; Battagello, J.; Lorio, M.; Soldà, M.; Martinotti Gabellotti, E.; Maran, M.; Dal Cin, A.; et al. Risk of CIN2 or More Severe Lesions after Negative HPV-MRNA E6/E7 Overexpression Assay and after Negative HPV-DNA Test: Concurrent Cohorts with a 5-Year Follow-Up. Int. J. Cancer 2020, 146, 3114–3123. [Google Scholar] [CrossRef]
- Macedo, A.C.L.; Gonçalves, J.C.N.; Bavaresco, D.V.; Grande, A.J.; Chiaramonte Silva, N.; Rosa, M.I. Accuracy of MRNA HPV Tests for Triage of Precursor Lesions and Cervical Cancer: A Systematic Review and Meta-Analysis. J. Oncol. 2019, 2019, 6935030. [Google Scholar] [CrossRef]
- Sun, J.; Yue, Y.; Li, R.; Sun, Q.; Hu, C.; Ge, X.; Guan, Q. Detection of HPV E6/E7 MRNA in the Diagnosis of Cervical Cancer and Precancerous Lesions after Kidney Transplantation. Am. J. Transl. Res. 2021, 13, 7312–7317. [Google Scholar] [PubMed]
- Yao, Y.L.; Tian, Q.F.; Cheng, B.; Cheng, Y.F.; Ye, J.; Lu, W.G. Human Papillomavirus (HPV) E6/E7 MRNA Detection in Cervical Exfoliated Cells: A Potential Triage for HPV-Positive Women. J. Zhejiang Univ. Sci. B 2017, 18, 256–262. [Google Scholar] [CrossRef] [PubMed]
- Sahlgren, H.; Elfström, K.M.; Lamin, H.; Carlsten-Thor, A.; Eklund, C.; Dillner, J.; Elfgren, K. Colposcopic and Histopathologic Evaluation of Women with HPV Persistence Exiting an Organized Screening Program. Am. J. Obstet. Gynecol. 2020, 222, 253.e1–253.e8. [Google Scholar] [CrossRef] [PubMed]
- Johansson, H.; Bjelkenkrantz, K.; Darlin, L.; Dilllner, J.; Forslund, O. Presence of High-Risk HPV MRNA in Relation to Future High-Grade Lesions among High-Risk HPV DNA Positive Women with Minor Cytological Abnormalities. PLoS ONE 2015, 10, e0124460. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Minaguchi, T.; Lachkar, B.; Zhang, S.; Xu, C.; Tenjimbayashi, Y.; Shikama, A.; Tasaka, N.; Akiyama, A.; Sakurai, M.; et al. Separate Analysis of Human Papillomavirus E6 and E7 Messenger RNAs to Predict Cervical Neoplasia Progression. PLoS ONE 2018, 13, 6–17. [Google Scholar] [CrossRef] [PubMed]
- Martí, C.; Marimón, L.; Glickman, A.; Henere, C.; Saco, A.; Rakislova, N.; Torné, A.; Ordi, J.; Del Pino, M. Usefulness of E7 Mrna in Hpv16-Positive Women to Predict the Risk of Progression to Hsil/Cin2+. Diagnostics 2021, 11, 1634. [Google Scholar] [CrossRef]
- de Sanjosé, S.; Brotons, M.; Pavón, M.A. The Natural History of Human Papillomavirus Infection. Best Pract. Res. Clin. Obstet. Gynaecol. 2018, 47, 2–13. [Google Scholar] [CrossRef]
- Asciutto, K.C.; Borgfeldt, C.; Forslund, O. 14-Type HPV MRNA Test in Triage of HPV DNA-Positive Postmenopausal Women with Normal Cytology. BMC Cancer 2020, 20, 1025. [Google Scholar] [CrossRef]
Gene | Primer and Probe Sequences (5′–3′) |
---|---|
E6/E7 HPV 16 | F: TTGCAGATCATCAAGAACACGTAGA |
R: CAGTAGAGATCAGTTGTCTCTGGTTGC | |
P: FAM-AATCATGCATGGAGATACACCTACATTGCATGA-TAMRA | |
E6/E7 HPV 31 | F: ATTCCACAACATAGGAGGAAGGTG |
R: CACTTGGGTTTCAGTACGAGGTCT | |
P: FAM-ACAGGACGTTGCATAGCATGTTGGA-TAMRA | |
E6/E7 HPV 33 | F: ATATTTCGGGTCGTTGGGCA |
R: ACGTCACAGTGCAGTTTCTCTACGT | |
P: FAM-GGACCTCCAACACGCCGCACA-TAMRA * | |
E6/E7 HPV 51 | F: AAAGCAAAAATTGGTGGACGA |
R: TGCCAGCAATTAGCGCATT | |
P: FAM-CATGAAATAGCGGGACGTTGGACG-TAMRA |
HPV Infection | HR HPV DNA | n (%) | n (%) |
---|---|---|---|
Single | 16 | 83 (48.3) | 145 (84.3) |
31 | 28 (16.3) | ||
33 | 18 (10.5) | ||
51 | 16 (9.3) | ||
Multiple | 16, 31 | 13 (7.6) | 27 (15.7) |
16, 51 | 6 (3.5) | ||
31, 33 | 3 (1.7) | ||
16, 33 | 2 (1.2) | ||
31, 51 | 2 (1.2) | ||
16, 31, 33 | 1 (0.6) | ||
Total: | 172 (100) | 172 (100) |
Most Prevalent HR-HPV-DNA-Positive Women | n (%) |
---|---|
Cytology | |
NILM | 29 (16.9) |
ASCUS | 46 (26.7) |
LSIL | 44 (25.6) |
HSIL | 53 (30.8) |
Total: | 172 (100) |
Age | |
≤30 | 68 (36.5) |
31–44 | 62 (36.0) |
≥45 | 42 (24.4) |
Mean age (years, SD)) | 36.7 (12.6) |
HR HPV DNA | Cytology | χ2 | p | ||||
---|---|---|---|---|---|---|---|
NILM | ASCUS | LSIL | HSIL | ||||
n (%) | n (%) | n (%) | n (%) | ||||
HPV 16 | + | 13 (44.8) | 28 (60.9) | 24 (54.5) | 40 (75.5) | 8.628 | 0.035 * |
− | 16 (55.2) | 18 (39.1) | 20 (45.5) | 13 (24.5) | |||
HPV 31 | + | 11 (37.9) | 16 (34.8) | 14 (31.8) | 6 (11.3) | 10.214 | 0.017 * |
− | 18 (62.1) | 30 (65.2) | 30 (68.2) | 47 (88.7) | |||
HPV 33 | + | 6 (20.7) | 6 (13.0) | 5 (11.4) | 7 (13.2) | 1.398 | 0.706 |
− | 23 (79.3) | 40 (87.0) | 39 (88.6) | 46 (86.8) | |||
HPV 51 | + | 4 (13.8) | 5 (10,9) | 8 (18.2) | 7 (13.2) | 1.045 | 0.790 |
− | 25 (86.2) | 41 (89.1) | 36 (81.8) | 46 (86.8) | |||
Total: | 29 (100) | 46 (100) | 44 (100) | 53 (100) |
HR HPV-Positive Women | Age Group (Years) | Total n (%) | χ2 | p | Mean Age (years, (SD)) | # | p | ||
---|---|---|---|---|---|---|---|---|---|
≤30 | 31–44 | ≥45 | |||||||
n (%) | n (%) | n (%) | |||||||
Cytology | |||||||||
NILM | 19 (27.9) | 5 (8.1) | 5 (11.9) | 29 (16.9) | 29.500 | 0.000 *** | 30.9 (12.2) | 9.321 | 0.000 *** |
ASCUS | 21 (30.9) | 21 (33.9) | 4 (9.5) | 46 (26.7) | 33.4 (9.2) | 0.000 *** | |||
LSIL | 17 (25.0) | 18 (29.0) | 9 (21.5) | 44 (25.6) | 35.9 (11.5) | 0.012 * | |||
HSIL | 11 (16.2) | 18 (29.0) | 24 (51.1) | 53 (30.8) | 43.4 (6.8) | - | |||
Total: | 68 (39.5) | 62 (36.1) | 42 (24.4) | 172 (100) | |||||
Genotype | § | ||||||||
HR HPV 16 | 41 (50.6) | 39 (52.0) | 25 (56.8) | 105 (52.5) | 0.147 | 0.929 | 36.9 (12.9) | 0.289 | 0.773 |
HR HPV 31 | 24 (29.6) | 15 (20.0) | 8 (18.2) | 47 (23.5) | 3.930 | 0.140 | 33.1 (10.8) | 2.317 | 0.022 * |
HR HPV 33 | 10 (12.3) | 10 (13.3) | 4 (9.1) | 24 (12.0) | 0.963 | 0.618 | 34.1 (11.2) | 1.077 | 0.283 |
HR HPV 51 | 6 (7.4) | 11 (14.7) | 7 15.9 | 24 (12.0) | 2.489 | 0.298 | 40.5 (12.7) | 1.610 | 0.109 |
Total: | 81 (40.5) | 75 (37.5) | 44 (22.0) | 200 (100) |
E6/E7 mRNA HPV Genotypes | Genotypes n (%) | HR HPV 16, 31, 33, 51 Cervical Samples (n = 291) | E6/E7 mRNA HR HPV/Most Prevalent HR-HPV-DNA-Positive Samples (%) | E6/E7 mRNA HR HPV Positive/HR-HPV-DNA-Positive (%) | ||
---|---|---|---|---|---|---|
Positive n (%) | Negative n (%) | |||||
HPV 16 | + | 51 (25.5) | 51 (48.6) | 0 (0.0) | 29.7 (51/172) | 48.5 (51/105) |
− | 149 (74.5) | 54 (51.4) | 186 (63.9) | |||
Total: | 200 (100) | 105 (36.1) | 186 (63.9) | |||
HPV 31 | + | 33 (16.5) | 33 (70.2) | 0 (0.0) | 19.2 (33/172) | 70.2 (33/47) |
− | 167 (83.5) | 14 (29.8) | 244 (83.8) | |||
Total: | 200 (100) | 47 (16.2) | 244 (83.8) | |||
HPV 33 | + | 16 (8.0) | 16 (66.7) | 0 (0.0) | 9.3 (16/172) | 66.7 (16/24) |
− | 184 (92.0) | 8 (33.3) | 267 (91.8) | |||
Total: | 200 (100) | 24 (8.2) | 267 (91.8) | |||
HPV 51 | + | 15 (7.5) | 15 (62.5) | 0 (0.0) | 8.7 (15/172) | 62.5 (15/24) |
− | 185 (92.5) | 9 (37.5) | 267 (91.8) | |||
Total: | 200 (100) | 24 (8.2) | 267 (91.8) | |||
Total E6/E7 mRNA genotypes | + | 115 (57.5) | 0 (0.0) | 66.9 (115/172) | 57.5 (115/200) | |
- | 85 (42.5) | 119 (100) |
E6/E7 mRNA HPV Genotypes | Cytology | Total n (%) | χ2 | p | ||||
---|---|---|---|---|---|---|---|---|
NILM n (%) | ASCUS n (%) | LSIL n (%) | HSIL n (%) | |||||
HPV 16 | + | 1 (3.4) | 6 (13.0) | 10 (22.7) | 34 (64.2) | 51 (29.7) | 46.881 | 0.000 *** |
- | 28 (96.6) | 40 (87.0) | 34 (77.3) | 19 (35.8) | 121 (70.3) | |||
Total: | 29 (100) | 46 (100) | 44 (100) | 53 (100) | 172 (100) | |||
HPV 31 | + | 7 (24.1) | 12 (26.1) | 10 (22.7) | 4 (7.5) | 33 (19.2) | 6.858 | 0.077 |
- | 22 (75.9) | 34 (73.9) | 34 (77.3) | 49 (92.5) | 139 (80.8) | |||
Total: | 29 (100) | 46 (100) | 44 (100) | 53 (100) | 172 (100) | |||
HPV 33 | + | 3 (10.3) | 3 (6.5) | 5 (11.4) | 5 (9.4) | 16 (9.3) | 0.682 | 0.878 |
- | 26 (89.7) | 43 (93.5) | 39 (88.6) | 48 (90.6) | 156 (90.7) | |||
Total: | 29 (100) | 46 (100) | 44 (100) | 53 (100) | 172 (100) | |||
HPV 51 | + | 3 (10.3) | 1 (2.2) | 5 (11.4) | 6 (11.3) | 15 (8.7) | - | - |
- | 26 (89.7) | 45 (97.8) | 39 (88.6) | 47 (88.7) | 157 (91.3) | |||
Total: | 29 (100) | 46 (100) | 44 (100) | 53 (100) | 172 (100) | |||
Cervical samples | ||||||||
E6/E7 mRNA HPVs | + | 13 (10.9) | 20 (29.4) | 30 (60.0) | 48 (88.9) | 111 (38.1) | ||
- | 106 (89.1) | 48 (70.6) | 20 (40.0) | 6 (11.1) | 180 (61.9) | 108.623 | 0.000 *** | |
Total: | 119 (100) | 68 (100) | 50 (100) | 54 (100) | 291 (100) |
Cytology | HR HPV DNA | f1 | Multiple E6/E7 mRNA HR HPV | f2 | Single E6/E7 mRNA HR HPV | f3 | Multiple E6/E7 mRNA HR HPV * (%) | Single E6/E7 mRNA HR HPV ** (%) | Total Oncogenic Activity |
---|---|---|---|---|---|---|---|---|---|
NILM | 16, 31 | 1 | - | 0 | - | 0 | 40.0 | 20.0 | 60.0 |
16, 51 | 1 | - | 0 | 51 | 1 | ||||
31, 33 | 2 | 31, 33 | 1 | - | 0 | ||||
31, 51 | 1 | 31, 51 | 1 | - | 0 | ||||
Total: | 5 | Total: | 2 | Total: | 1 | ||||
ASCUS | 16, 31 | 6 | - | 0 | 16 | 1 | 22.2 | 44.4 | 66.6 |
31 | 3 | ||||||||
16, 51 | 1 | - | 0 | - | 0 | ||||
31, 33 | 1 | 31, 33 | 1 | - | 0 | ||||
31, 51 | 1 | 31, 51 | 1 | - | 0 | ||||
Total: | 9 | Total: | 2 | Total: | 4 | ||||
LSIL | 16, 31 | 3 | - | 0 | 16 | 1 | 0.0 | 83.3 | 83.3 |
31 | 2 | ||||||||
16, 31, 33 | 1 | - | 0 | 33 | 1 | ||||
16, 51 | 2 | - | 0 | 51 | 1 | ||||
Total: | 6 | Total: | 0 | Total: | 5 | ||||
HSIL | 16, 31 | 3 | 16, 31 | 1 | 16 | 1 | 14.3 | 85.7 | 100 |
31 | 1 | ||||||||
16, 33 | 2 | - | 0 | 16 | 1 | ||||
33 | 1 | ||||||||
16, 51 | 2 | - | 0 | 16 | 1 | ||||
51 | 1 | ||||||||
Total: | 7 | Total: | 1 | Total: | 6 |
E6/E7 mRNA HR HPV | Age (years) | Total | χ2 | p | |||
---|---|---|---|---|---|---|---|
≤30 | 31–44 | ≥45 | |||||
n (%) | n (%) | n (%) | n (%) | ||||
HPV 16 | + | 13 (19.1) | 20 (32.3) | 18 (42.9) | 51 (29.7) | 7.331 | 0.026 * |
- | 55 (80.9) | 42 (67.7) | 24 (57.1) | 121 (70.3) | |||
Total: | 68 (100) | 62 (100) | 42 (100) | 172 (100) | |||
HPV 31 | + | 16 (23.5) | 10 (16.1) | 7 (16.7) | 33 (19.2) | 1.373 | 0.503 |
– | 52 (76.5) | 52 (83.9) | 35 (83.3) | 139 (80.8) | |||
Total: | 68 (100) | 62 (100) | 42 (100) | 172 (100) | |||
HPV 33 | + | 7 (10.3) | 6 (9.7) | 3 (7.1) | 16 (9.3) | 0.322 | 0.851 |
– | 61 (89.7) | 56 (90.3) | 39 (92.9) | 156 (90.7) | |||
Total: | 68 (100) | 62 (100) | 42 (100) | 172 (100) | |||
HPV 51 | + | 3 (4.4) | 5 (8.1) | 7 (16.7) | 15 (8.7) | 4.951 | 0.084 |
– | 65 (95.6) | 57 (91.9) | 35 (83.3) | 157 (91.3) | |||
Total: | 68 (100) | 62 (100) | 42 (100) | 172 (100) |
Test | Cytology | Sensitivity | CI | Specificity | CI | PPV | CI | NPV | CI |
---|---|---|---|---|---|---|---|---|---|
(%) | (95%) | (%) | (95%) | (%) | (95%) | (%) | (95%) | ||
HPV DNA | ASCUS | 67.6 *** | 55.2–78.5 | 75.6 | 66.9–83.0 | 61.3 | 49.4–72.4 | 80.4 * | 71.8–87.3 |
LSIL | 88.0 ** | 75.7–95.5 | 75.6 | 66.9–83.0 | 60.3 | 48.1–71.6 | 93.8 * | 86.9–97.7 | |
HSIL | 98.2 | 90.1–100 | 75.6 | 66.9–83.0 | 64.6 | 53.3–74.9 | 98.9 | 94.0–100 | |
E6/E7 mRNA HPV | ASCUS | 29.4 | 19.0–41.7 | 89.1 ** | 82.0–94.0 | 60.6 | 42.1–77.1 | 68.8 | 60.9–76.0 |
LSIL | 60.0 | 45.2–73.6 | 89.1 ** | 82.0–94.0 | 69.8 *** | 53.9–82.8 | 84.1 | 76.6–90.0 | |
HSIL | 88.9 | 77.4–95.8 | 89.1 ** | 82.0–94.0 | 78.7 *** | 66.3–88.1 | 94.6 | 88.7–98.0 |
HSIL | AUC ± SE | p | CI (95%) |
---|---|---|---|
E6/E7 mRNA HR HPV | 0.812 ± 0.031 | 0.000 *** | 0.752–0.871 |
HR HPV DNA | 0.740 ± 0.030 | 0.000 *** | 0.680–0.799 |
HSIL | OR | CI (95%) | p | ||
---|---|---|---|---|---|
NILM | HR HPV DNA 16 | + | 1.627 | 0.351–7.531 | 0.534 |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV | + | 3.989 | 0.843–18.882 | 0.081 | |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV 16 | + | 19.099 | 1.539–236.983 | 0.022 * | |
– | 1.00 a | ||||
Age (years) | ≤30 | 1.00a | |||
31–44 | 5.382 | 1.360–21.296 | 0.016 * | ||
≥45 | 6.654 | 1.665–26.598 | 0.007 ** | ||
ASCUS | HR HPV DNA 16 | + | 0.957 | 0.230–3.988 | 0.952 |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV | + | 3.910 | 0.906–16.871 | 0.068 | |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV 16 | + | 6.384 | 1.215–33.545 | 0.029 * | |
– | 1.00 a | ||||
Age (years) | ≤30 | 1.00 a | |||
31–44 | 1.401 | 0.469–4.182 | 0.546 | ||
≥45 | 8.738 | 2.147–35.568 | 0.002 ** | ||
LSIL | HR HPV DNA 16 | + | 1.009 | 0.243–4.192 | 0.990 |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV | + | 1.636 | 0.377–7.102 | 0.511 | |
– | 1.00 a | ||||
E6/E7 mRNA HR HPV 16 | + | 5.099 | 1.091–23.832 | 0.038 * | |
– | 1.00 a | ||||
Age (years) | ≤30 | 1.00 a | |||
31–44 | 1.362 | 0.464–3.992 | 0.574 | ||
≥45 | 3.719 | 1.161–11.920 | 0.027 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nikolic, N.; Basica, B.; Mandic, A.; Surla, N.; Gusman, V.; Medic, D.; Petrovic, T.; Strbac, M.; Petrovic, V. E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women. Diagnostics 2023, 13, 917. https://doi.org/10.3390/diagnostics13050917
Nikolic N, Basica B, Mandic A, Surla N, Gusman V, Medic D, Petrovic T, Strbac M, Petrovic V. E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women. Diagnostics. 2023; 13(5):917. https://doi.org/10.3390/diagnostics13050917
Chicago/Turabian StyleNikolic, Natasa, Branka Basica, Aljosa Mandic, Nela Surla, Vera Gusman, Deana Medic, Tamas Petrovic, Mirjana Strbac, and Vladimir Petrovic. 2023. "E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women" Diagnostics 13, no. 5: 917. https://doi.org/10.3390/diagnostics13050917
APA StyleNikolic, N., Basica, B., Mandic, A., Surla, N., Gusman, V., Medic, D., Petrovic, T., Strbac, M., & Petrovic, V. (2023). E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women. Diagnostics, 13(5), 917. https://doi.org/10.3390/diagnostics13050917