TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. SNP Selection
2.3. Oligonucleotides Design
2.4. DNA Extraction and Real-Time PCR Conditions
2.5. Statistical Analysis
3. Results
3.1. Epidemiological Characteristics of Studied Groups
3.2. Genotyping Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO Reveals Leading Causes of Death and Disability Worldwide: 2000–2019. Available online: https://www.who.int/ru/news/item/09-12-2020-who-reveals-leading-causes-of-death-and-disability-worldwide-2000-2019 (accessed on 15 November 2022).
- World Health Organization (WHO). Available online: https://www.who.int (accessed on 15 November 2022).
- Ramirez, J.A.; Wiemken, T.L.; Peyrani, P.; Arnold, F.W.; Kelley, R.; Mattingly, W.A.; Nakamatsu, R.; Pena, S.; Guinn, B.E.; Furmanek, S.P.; et al. Adults Hospitalized with Pneumonia in the United States: Incidence, Epidemiology, and Mortality. Clin. Infect. Dis. 2017, 65, 1806–1812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- AMRmap. Available online: https://amrmap.ru/ (accessed on 15 November 2022).
- Clinical Recommendations: Community-Acquired Pneumonia in Adults 2021. Available online: https://spulmo.ru/upload/kr/Pneumonia_2021.pdf (accessed on 12 December 2022).
- Asami, T.; Ishii, M.; Namkoong, H.; Yagi, K.; Tasaka, S.; Asakura, T.; Suzuki, S.; Kamo, T.; Okamori, S.; Kamata, H.; et al. Anti-inflammatory roles of mesenchymal stromal cells during acute Streptococcus pneumoniae pulmonary infection in mice. Cytotherapy 2018, 20, 302–313. [Google Scholar] [CrossRef] [PubMed]
- Baral, P.; Batra, S.; Zemans, R.L.; Downey, G.P.; Jeyaseelan, S. Divergent functions of toll-like receptors during bacterial lung infections. Am. J. Respir. Crit. Care Med. 2014, 190, 722–732. [Google Scholar] [CrossRef] [Green Version]
- Frantz, S.; Kobzik, L.; Kim, Y.-D.; Fukazawa, R.; Medzhitov, R.; Lee, R.T.; Kelly, R.A. Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium. J. Clin. Investig. 1999, 104, 271–280. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Kuang, M.; Li, J.; Zhu, L.; Jia, Z.; Guo, X.; Hu, Y.; Kong, J.; Yin, H.; Wang, X. SARS-CoV-2 Spike Protein Interacts with and Activates TLR41. Cell Res. 2021, 31, 818–820. [Google Scholar] [CrossRef]
- Lu, H.; Wen, D.; Wang, X.; Gan, L.; Du, J.; Sun, J.; Zeng, L.; Jiang, J.; Zhang, A. Host genetic variants in sepsis risk: A field synopsis and meta-analysis. Crit. Care 2019, 23, 26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, H.; Wen, D.; Sun, J.; Du, J.; Qiao, L.; Zhang, H.; Zeng, L.; Zhang, L.; Jiang, J.; Zhang, A. Polygenic Risk Score for Early Prediction of Sepsis Risk in the Polytrauma Screening Cohort. Front. Genet. 2020, 11, 545564. [Google Scholar] [CrossRef]
- Ghafouri-Fard, S.; Noroozi, R.; Vafaee, R.; Branicki, W.; Poṡpiech, E.; Pyrc, K.; Łabaj, P.; Omrani, M.D.; Taheri, M.; Sanak, M. Effects of host genetic variations on response to, susceptibility and severity of respiratory infections. Biomed. Pharmacother. 2020, 128, 110296. [Google Scholar] [CrossRef]
- Guo, X.-G.; Xia, Y. The rs5743708 gene polymorphism in the TLR2 gene contributes to the risk of tuberculosis disease. Int. J. Clin. Exp. Pathol. 2015, 8, 11921–11928. [Google Scholar]
- Wu, S.; Liu, X.; Chen, L.; Wang, Y.; Zhang, M.; Wang, M.; He, J.Q. Polymorphisms of TLR2, TLR4 and TOLLIP and Tuberculosis in Two Independent Studies. Biosci. Rep. 2020, 40, BSR20193141. [Google Scholar] [CrossRef]
- Behairy, M.Y.; Abdelrahman, A.A.; Toraih, E.A.; Ibrahim, E.E.-D.A.; Azab, M.M.; Sayed, A.A.; Hashem, H.R. Investigation of TLR2 and TLR4 Polymorphisms and Sepsis Susceptibility: Computational and Experimental Approaches. Int. J. Mol. Sci. 2022, 23, 10982. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.-W.; Zhang, A.-Q.; Wang, X.; Li, Z.-Y.; Yang, J.-H.; Zeng, L.; Gu, W.; Jiang, J.-X. Association between the TLR2 Arg753Gln polymorphism and the risk of sepsis: A meta-analysis. Crit. Care 2015, 19, 416. [Google Scholar] [CrossRef] [Green Version]
- Smelaya, T.V.; Belopolskaya, O.B.; Smirnova, S.V.; Kuzovlev, A.N.; Moroz, V.V.; Golubev, A.M.; Pabalan, N.A.; Salnikova, L.E. Genetic dissection of host immune response in pneumonia development and progression. Sci. Rep. 2016, 6, 35021. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sepsis 2017 Paris. Intensiv. Care Med. Exp. 2017, 5 (Suppl. S1), 37. [CrossRef] [PubMed] [Green Version]
- Liu, R.; Mo, Y.-Y.; Wang, H.-L.; Tan, Y.; Wen, X.-J.; Deng, M.-J.; Yan, H.; Li, L. The relationship between toll like receptor 4 gene rs4986790 and rs4986791 polymorphisms and sepsis susceptibility: A meta-analysis. Sci. Rep. 2016, 6, 38947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.-C.; Jeong, B.-H. Strong Association of the rs4986790 Single Nucleotide Polymorphism (SNP) of the Toll-Like Receptor 4 (TLR4) Gene with Human Immunodeficiency Virus (HIV) Infection: A Meta-Analysis. Genes 2020, 12, 36. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhao, L.; Liu, K.; Kong, X.; Tao, Z.; Wang, Y. Association of Polymorphisms in Toll-Like Receptors 4 and 9 with Risk of Pulmonary Tuberculosis: A Meta-Analysis. J. Pharmacol. Exp. Ther. 2015, 21, 1097–1106. [Google Scholar] [CrossRef] [Green Version]
- Yuan, F.F.; Marks, K.; Wong, M.; Watson, S.; de Leon, E.; McIntyre, P.B.; Sullivan, J.S. Clinical relevance of TLR2, TLR4, CD14 and FcγRIIA gene polymorphisms in Streptococcus pneumoniae infection. Immunol. Cell Biol. 2008, 86, 268–270. [Google Scholar] [CrossRef]
- Schurz, H.; Daya, M.; Möller, M.; Hoal, E.G.; Salie, M. TLR1, 2, 4, 6 and 9 Variants Associated with Tuberculosis Susceptibility: A Systematic Review and Meta-Analysis. PLoS ONE 2015, 10, e0139711. [Google Scholar] [CrossRef]
- Skevaki, C.; Pararas, M.; Kostelidou, K.; Tsakris, A.; Routsias, J.G. Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious diseases. Clin. Exp. Immunol. 2015, 180, 165–177. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Zhang, M. Associations between genetic polymorphisms of TLRs and susceptibility to tuberculosis: A meta-analysis. J. Endotoxin Res. 2020, 26, 75–83. [Google Scholar] [CrossRef] [PubMed]
- Azzarà, A.; Cassano, I.; Paccagnella, E.; Tirindelli, M.C.; Nobile, C.; Schittone, V.; Lintas, C.; Sacco, R.; Gurrieri, F. Genetic Variants Determine Intrafamilial Variability of SARS-CoV-2 Clinical Outcomes in 19 Italian Families. PLoS ONE 2022, 17, e0275988. [Google Scholar] [CrossRef] [PubMed]
- May, M.; Chang, M.; Dietz, D.; Shoucri, S.; Laracy, J.; Sobieszczyk, M.E.; Uhlemann, A.-C.; Zucker, J.; Kubin, C.J. Limited Utility of Procalcitonin in Identifying Community-Associated Bacterial Infections in Patients Presenting with Coronavirus Disease 2019. Antimicrob. Agents Chemother. 2021, 65, e02167-20. [Google Scholar] [CrossRef] [PubMed]
- Karnaushkina, M.; Guryev, A.; Mironov, K.; Dunaeva, E.; Korchagin, V.; Bobkova, O.; Vasilyeva, I.; Kassina, D.; Litvinova, M. Associations of Toll-like Receptor Gene Polymorphisms with NETosis Activity as Prognostic Criteria for the Severity of Pneumonia. Sovrem. Teh. Med. 2021, 13, 47. [Google Scholar] [CrossRef]
- Vincent, L.J.; Moreno, R.; Takala, J.; Willatts, S.; De Mendona, A.; Bruining, H.; Reinhart, C.; Suter, P.; Thijs, L. The SOFA (Sepsis-Related Organ Failure Assessment) Score to Describe Organ Dysfunction/Failure. On Behalf of the Working Group on Sepsis-Related Problems of the European Society of Intensive Care Medicine. Intensive Care Med. 1996, 22, 707–710. [Google Scholar] [CrossRef]
- Bartlett, J.G.; Dowell, S.F.; A Mandell, L.; File, T.M.; Musher, D.M.; Fine, M.J. Practice Guidelines for the Management of Community-Acquired Pneumonia in Adults. Clin. Infect. Dis. 2000, 31, 347–382. [Google Scholar] [CrossRef]
- DbSNP Summary. Available online: https://www.ncbi.nlm.nih.gov/projects/SNP/snp_summary.cgi. (accessed on 15 November 2022).
- Design Options. Available online: http://www.qiagen.com/us/knowledge-and-support/knowledge-hub/technology-and-research/lna-technology/custom-lna-oligonucleotide-design-and-applications/design-guidelines/design-options (accessed on 15 November 2022).
- Fairley, S.; Lowy-Gallego, E.; Perry, E.; Flicek, P. The International Genome Sample Resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res. 2020, 48, D941–D947. [Google Scholar] [CrossRef]
- González, J.R.; Armengol, L.; Solé, X.; Guinó, E.; Mercader, J.M.; Estivill, X.; Moreno, V. SNPassoc: An R package to perform whole genome association studies. Bioinformatics 2007, 23, 654–655. [Google Scholar] [CrossRef] [Green Version]
- Aragon, T.J.; Fay, M.P.; Wollschlaeger, D.; Omidpanah, A. Epitools: Epidemiology Tools, 2020. Available online: https://CRAN.R-project.org/package=epitools. (accessed on 14 November 2022).
- Jombart, T.; Ahmed, I. adegenet 1.3-1: New tools for the analysis of genome-wide SNP data. Bioinformatics 2011, 27, 3070–3071. [Google Scholar] [CrossRef] [Green Version]
- Graffelman, J. Exploring Diallelic Genetic Markers: The Hardy Weinberg Package. J. Stat. Softw. 2015, 64, 1–23. [Google Scholar] [CrossRef]
- Wickham, H. Ggplot2; Springer: New York, NY, USA, 2009. [Google Scholar]
- Patil, I. Visualizations with statistical details: The ’ggstatsplot’ approach. J. Open Source Softw. 2021, 6, 3167. [Google Scholar] [CrossRef]
- Kumar, V.; Sharma, A. Innate Immunity in Sepsis Pathogenesis and Its Modulation: New Immunomodulatory Targets Revealed. J. Chemother. 2008, 20, 672–683. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, C.G.; Allon, S.J.; Nyquist, S.K.; Mbano, I.M.; Miao, V.N.; Tzouanas, C.N.; Cao, Y.; Yousif, A.S.; Bals, J.; Hauser, B.M.; et al. SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell 2020, 181, 1016–1035.e19. [Google Scholar] [CrossRef]
- Zou, X.; Chen, K.; Zou, J.; Han, P.; Hao, J.; Han, Z. Single-cell RNA-seq data analysis on the receptor ACE2 expression reveals the potential risk of different human organs vulnerable to 2019-nCoV infection. Front. Med. 2020, 14, 185–192. [Google Scholar] [CrossRef] [Green Version]
- Qi, F.; Qian, S.; Zhang, S.; Zhang, Z. Single cell RNA sequencing of 13 human tissues identify cell types and receptors of human coronaviruses. Biochem. Biophys. Res. Commun. 2020, 526, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Wurfel, M.M.; Gordon, A.C.; Holden, T.D.; Radella, F.; Strout, J.; Kajikawa, O.; Ruzinski, J.T.; Rona, G.; Black, R.A.; Stratton, S.; et al. Toll-like Receptor 1 Polymorphisms Affect Innate Immune Responses and Outcomes in Sepsis. Am. J. Respir. Crit. Care Med. 2008, 178, 710–720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moore, J.E.; Millar, B.C. Susceptibility of the Mycobacterium abscessus complex to drying: Implications for nebulizer hygiene in patients with cystic fibrosis. Int. J. Mycobacteriology 2020, 9, 173–175. [Google Scholar]
- Kumpf, O.; Giamarellos-Bourboulis, E.J.; Koch, A.; Hamann, L.; Mouktaroudi, M.; Oh, D.-Y.; Latz, E.; Lorenz, E.; A Schwartz, D.; Ferwerda, B.; et al. Influence of genetic variations in TLR4 and TIRAP/Mal on the course of sepsis and pneumonia and cytokine release: An observational study in three cohorts. Crit. Care 2010, 14, R103. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Jiang, T.; Yang, X.; Xue, Y.; Wang, C.; Liu, J.; Zhang, X.; Chen, Z.; Zhao, M.; Li, J.-C. Toll-Like Receptor -1, -2, and -6 Polymorphisms and Pulmonary Tuberculosis Susceptibility: A Systematic Review and Meta-Analysis. PLoS ONE 2013, 8, e63357. [Google Scholar] [CrossRef] [Green Version]
- Ovsyannikova, I.G.; Haralambieva, I.H.; Vierkant, R.; Pankratz, V.S.; Jacobson, R.; Poland, G.A. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity. Qual. Life Res. 2011, 130, 547–561. [Google Scholar] [CrossRef] [Green Version]
- Thada, S.; Horvath, G.; Müller, M.; Dittrich, N.; Conrad, M.; Sur, S.; Hussain, A.; Pelka, K.; Gaddam, S.; Latz, E.; et al. Interaction of TLR4 and TLR8 in the Innate Immune Response against Mycobacterium Tuberculosis. Int. J. Mol. Sci. 2021, 22, 1560. [Google Scholar] [CrossRef] [PubMed]
- Khanmohammadi, S.; Rezaei, N. Role of Toll-like Receptors in the Pathogenesis of COVID-19. J. Med. Virol. 2021, 93, 2735–2739. [Google Scholar] [CrossRef] [PubMed]
- Moen, S.H.; Ehrnström, B.; Kojen, J.F.; Yurchenko, M.; Beckwith, K.S.; Afset, J.E.; Damås, J.K.; Hu, Z.; Yin, H.; Espevik, T.; et al. Human Toll-like Receptor 8 (TLR8) Is an Important Sensor of Pyogenic Bacteria, and Is Attenuated by Cell Surface TLR Signaling. Front. Immunol. 2019, 10, 1209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campbell, G.R.; To, R.K.; Hanna, J.; Spector, S.A. SARS-CoV-2, SARS-CoV-1, and HIV-1 derived ssRNA sequences activate the NLRP3 inflammasome in human macrophages through a non-classical pathway. Iscience 2021, 24, 102295. [Google Scholar] [CrossRef]
- Asano, T.; Boisson, B.; Onodi, F.; Matuozzo, D.; Moncada-Velez, M.; Renkilaraj, M.R.L.M.; Zhang, P.; Meertens, L.; Bolze, A.; Materna, M.; et al. X-Linked Recessive TLR7 Deficiency in ~1% of Men under 60 Years Old with Life-Threatening COVID-19. Sci. Immunol. 2021, 6, eabl4348. [Google Scholar] [CrossRef] [PubMed]
Gene, SNP | Risk Allele | Associated Condition |
---|---|---|
TLR1, rs5743551 | G | Sepsis |
TLR2, rs5743708 | A | Sepsis, tuberculosis |
TLR2, rs3804100 | T | Tuberculosis, measles-specific antibody levels following immunization |
TLR4, rs4986790 | G | Sepsis, tuberculosis |
TLR6, rs5743810 | G | Tuberculosis, allogeneic hematopoietic stem cell transplant recipients |
TLR8, rs3764880 | G | SARS-CoV-2 clinical outcomes, tuberculosis |
Gene, SNP | Name | 5′–3′ Sequence |
---|---|---|
TLR1, rs5743551 | TLR1-F | AAT CCA GGC TGA GGG AGC AA |
TLR1-R | ACT GGG AGT AGT GGG GAT GAG T | |
TLR1-A | (FAM)GCTGAGAAGCTTCC(BHQ1) 1 | |
TLR1-G | (R6G)GCTGAGGAGCTTCC(BHQ1) 1 | |
TLR2, rs5743708 | TLR2-F | CATTCTTCTGGAGCCCATTGAGA |
TLR2-R | CGCAGCTCTCAGATTTACCCAA | |
TLR2-G | (FAM)GCTGCGGAAGAT(BHQ1) 1 | |
TLR2-A | (R6G)AAGCTGCAGAAGAT(BHQ1) 1 | |
TLR2, rs3804100 | TLR2-F1 | CTGAAACTTGTCAGTGGCCAGAA |
TLR2-R1 | TTCCAGTGTCTTGGGAATGCA | |
TLR2-C | (FAM)TACACAGCGTAACAG(BHQ1) 1 | |
TLR2-T | (R6G)TACACAGTGTAACAG(BHQ-1) 1 | |
TLR4, rs4986790 | TLR4-F | GGCCTGTGCAATTTGACCATT |
TLR4-R | GTCACACTCACCAGGGAAAATGA | |
TLR4-A | (FAM)CCTCGATGATATTATTG(BHQ1) 1 | |
TLR4-G | (R6G)CCTCGATGGTATTATTG(BHQ1) 1 | |
TLR6, rs5743810 | TLR6-F | CTATGTGGTTGAGGGTAAAATTCAGTAAG |
TLR6-R | TGAATGATGACAACTGTCAAGTTTTC | |
TLR6-A | (FAM)AAGGTTGAACCTCTG(BHQ1) 1 | |
TLR6-G | (R6G)AGGTTGGACCTCTG(BHQ1) 1 | |
TLR8, rs3764880 | TLR8-F | GCTGCTGCAAGTTACGGAATGAA |
TLR8-R | GGGTCAGAAACCCCATATTCTGTT | |
TLR8-A | (FAM)CAGAAACATGGTAAG(BHQ1) 1 | |
TLR8-G | (R6G)CAGAAACGTGGTAAG(BHQ1) 1 |
Variables | Patients (n = 161) | Controls (n = 99) | p | ||
---|---|---|---|---|---|
Case 1 (n = 76) | Case 2 (n = 85) | p | |||
Age, mean (SD), y | 43.89 (14.54) | 65.87 (13.63) | <0.0001 | 39.76 (12.12) | <0.0001 |
Male, n (%) * | 57 (75) | 21 (24.7) | <0.0001 | 24 (24.2) | 0.0001 |
Samples | SNP | Minor Allele Frequency (MAF) | HWE *, p | Fisher’s Exact Test for Equality of Allele Frequencies, p |
---|---|---|---|---|
Case 1 | rs5743551 (TLR1) | G (0.243) | 0.056 | 0.332 |
rs3804100 (TLR2) | C (0.072) | 0.040 | 0.723 | |
rs4986790 (TLR4) | G (0.079) | 0.058 | 0.271 | |
rs3764880 (TLR8) | G (0.274) | 0.360 ** | 0.903 | |
Case 2 | rs5743551 (TLR1) | G (0.194) | 0.074 | 0.015 |
rs3804100 (TLR2) | C (0.029) | 1.000 | 0.110 | |
rs4986790 (TLR4) | G (0.100) | 0.588 | 0.040 | |
rs3764880 (TLR8) | G (0.235) | 0.519 ** | 0.417 | |
Control | rs5743551 (TLR1) | G (0.232) | 0.396 | 0.140 |
rs3804100 (TLR2) | C (0.081) | 1.000 | 0.352 | |
rs4986790 (TLR4) | G (0.091) | 0.572 | 0.077 | |
rs3764880 (TLR8) | G (0.213) | 0.329 ** | 0.150 | |
EUR | rs5743551 (TLR1) | G (0.285) | 0.016 | - |
rs3804100 (TLR2) | C (0.064) | 1.000 | ||
rs4986790 (TLR4) | G (0.057) | 0.207 | ||
rs3764880 (TLR8) | G (0.269) | 0.566 ** |
SNP | Control | Allele 1 Freq. | Case 1 | Allele 2 Freq. | OR CI95% | p |
---|---|---|---|---|---|---|
rs5743551 (TLR1) | ||||||
Codominant | ||||||
A/A | 60 | 60.6 | 40 | 52.6 | 1.00 | 0.045 |
A/G | 32 | 32.3 | 35 | 46.1 | 1.64 (0.88–3.06) | |
G/G | 7 | 7.1 | 1 | 1.3 | 0.21 (0.03–1.81) | |
Recessive | ||||||
A/A-A/G | 92 | 92.9 | 75 | 98.7 | 1.00 | 0.052 |
G/G | 7 | 7.1 | 1 | 1.3 | 0.18 (0.02–1.46) | |
rs3764880 (TLR8) | ||||||
Recessive | ||||||
A/A-A/G | 94 | 94.9 | 57 | 75.0 | 1.00 | 0.00012 |
G/G | 5 | 5.1 | 19 | 25.0 | 6.27 (2.22–17.71) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salamaikina, S.; Karnaushkina, M.; Korchagin, V.; Litvinova, M.; Mironov, K.; Akimkin, V. TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic. Diagnostics 2023, 13, 121. https://doi.org/10.3390/diagnostics13010121
Salamaikina S, Karnaushkina M, Korchagin V, Litvinova M, Mironov K, Akimkin V. TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic. Diagnostics. 2023; 13(1):121. https://doi.org/10.3390/diagnostics13010121
Chicago/Turabian StyleSalamaikina, Svetlana, Maria Karnaushkina, Vitaly Korchagin, Maria Litvinova, Konstantin Mironov, and Vasily Akimkin. 2023. "TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic" Diagnostics 13, no. 1: 121. https://doi.org/10.3390/diagnostics13010121
APA StyleSalamaikina, S., Karnaushkina, M., Korchagin, V., Litvinova, M., Mironov, K., & Akimkin, V. (2023). TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic. Diagnostics, 13(1), 121. https://doi.org/10.3390/diagnostics13010121