Clinical Validation of DNA Extraction-Free qPCR, Visual LAMP, and Fluorescent LAMP Assays for the Rapid Detection of African Swine Fever Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. ASFV Reference Material and Clinical Samples
2.2. Heated Lysis (DNA Extraction-Free) of Clinical Samples
2.3. DNA Extraction
2.4. Oligonucleotides
2.5. OIE qPCR, DNA Extraction-Free qPCR, and DNA Extraction-Free LAMP Assay
2.6. Sensitivity Assay
2.7. Specificity Assay
2.8. Comparison of DNA Extraction-Free qPCR and LAMP with OIE qPCR Using Clinical Samples
2.9. Statistical Analyses
3. Results
3.1. Analysis of Sensitivity
3.2. Specificity Analysis
3.3. Performance of DNA Extraction-Free qPCR and LAMP for Clinical Samples Compared with OIE qPCR Testing
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Guo, Z.; Li, K.; Qiao, S.; Chen, X.X.; Deng, R.; Zhang, G. Development and evaluation of duplex TaqMan real-time PCR assay for detection and differentiation of wide-type and MGF505-2R gene-deleted African swine fever viruses. BMC Vet. Res. 2020, 16, 428. [Google Scholar] [CrossRef]
- Wang, A.; Jia, R.; Liu, Y.; Zhou, J.; Qi, Y.; Chen, Y.; Liu, D.; Zhao, J.; Shi, H.; Zhang, J.; et al. Development of a novel quantitative real-time PCR assay with lyophilized powder reagent to detect African swine fever virus in blood samples of domestic pigs in China. Transbound. Emerg. Dis. 2019, 67, 53–56. [Google Scholar] [CrossRef]
- Miao, F.; Zhang, J.; Li, N.; Chen, T.; Wang, L.; Zhang, F.; Mi, L.; Zhang, J.; Wang, S.; Wang, Y.; et al. Rapid and Sensitive Recombinase Polymerase Amplification Combined with Lateral Flow Strip for Detecting African Swine Fever Virus. Other 2019, 10, 1004–1011. [Google Scholar] [CrossRef]
- Sheng, Q.; Jin, M. Molecular Characterization of African Swine Fever Virus, China. Emerg. Infect. Dis. 2018, 24, 2131–2133. [Google Scholar]
- Zhou, X.; Li, N.; Luo, Y.; Liu, Y.E.; Miao, F.; Chen, T.; Zhang, S.; Cao, P.; Li, X.; Tian, K.; et al. Emergence of African Swine Fever in China. Transbound. Emerg. 2018, 65, 1482–1484. [Google Scholar] [CrossRef] [Green Version]
- Zhang, R.; Huang, Y.; Bao, C.; Jung, Y.; Xu, J.; Qian, Y. Epidemiology of African Swine Fever and Analysis of Risk Factors of Its Spread in China: An Overview. Chin. J. Virol. 2019, 35, 512–522. [Google Scholar]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef]
- Salas, M.; Andrés, G. African swine fever virus morphogenesis. Virus Res. 2013, 173, 29–41. [Google Scholar] [CrossRef]
- Aslanyan, L.; Avagyan, H.; Karalyan, Z. Whole-genome-based phylogeny of African swine fever virus. Vet. World 2020, 13, 2118–2125. [Google Scholar] [CrossRef]
- Dixon, L.K.; Escribano, J.M.; Martins, C.; Rock, D.L.; Salas, M.L.; Wilkinson, P.J. Virus Taxonomy, VIIIth Report of the ICTV; Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., Eds.; Elsevier: Amsterdam, The Netherlands; Academic Press: London, UK, 2005; pp. 135–143. [Google Scholar]
- Alejo, A.; Matamoros, T.; Guerra, M.; Andrés, G. A Proteomic Atlas of the African Swine Fever Virus Particle. J. Virol. 2018, 92, e01293-18. [Google Scholar] [CrossRef] [Green Version]
- Bishop, R.P.; Fleischauer, C.; de Villiers, E.P.; Okoth, E.A.; Arias, M.; Gallardo, C.; Upton, C. Comparative analysis of the complete genome sequences of Kenyan African swine fever virus isolates within p72 genotypes IX and X. Virus Genes 2015, 50, 303–309. [Google Scholar] [CrossRef]
- Chapman, D.A.; Darby, A.C.; Da Silva, M.; Upton, C.; Radford, A.D.; Dixon, L.K. Genomic analysis of highly virulent Georgia 2007/1 isolate of African swine fever virus. Emerg. Infect. Dis. 2011, 17, 599–605. [Google Scholar] [CrossRef]
- Portugal, R.; Coelho, J.; Hoeper, D.; Little, N.S.; Smithson, C.; Upton, C.; Martins, C.; Leitão, A.; Keil, G.M. Related strains of African swine fever virus with different virulence: Genome comparison and analysis. J. Gen. Virol. 2015, 96, 408–419. [Google Scholar] [CrossRef]
- Bastos, A.; Penrith, M.; Crucière, C. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003, 148, 693–706. [Google Scholar] [CrossRef]
- Malogolovkin, A.; Burmakina, G.; Titov, I.; Sereda, A.; Gogin, A.; Baryshnikova, E.; Kolbasov, D. Comparative Analysis of African Swine Fever Virus Genotypes and Serogroups. Emerg. Infect. Dis. 2015, 21, 312–315. [Google Scholar] [CrossRef]
- Sánchez-Vizcaíno, J.M.; Mur, L.; Gomez-Villamandos, J.C.; Carrasco, L. An update on the epidemiology and pathology of African swine fever. J. Comp. Pathol. 2015, 152, 9–21. [Google Scholar] [CrossRef]
- Mur, L.; Boadella, M.; Martínez-López, B.; Gallardo, C.; Gortazar, C.; Sánchez-Vizcaíno, J.M. Monitoring of African Swine Fever in the Wild Boar Population of the Most Recent Endemic Area of Spain. Transbound. Emerg. Dis. 2012, 59, 526–531. [Google Scholar] [CrossRef]
- Gaudreault, N.; Richt, J. Subunit Vaccine Approaches for African Swine Fever Virus. Vaccines 2019, 7, 56. [Google Scholar] [CrossRef] [Green Version]
- Tignon, M.; Gallardo, C.; Iscaro, C.; Hutet, E.; Van der Stede, Y.; Kolbasov, D.; De Mia, G.M.; Le Potier, M.-F.; Bishop, R.P.; Arias, M.; et al. Development and inter-laboratory validation study of an improved new real-time PCR assay with internal control for detection and laboratory diagnosis of African swine fever virus. J. Virol. Methods 2011, 178, 161–167. [Google Scholar] [CrossRef]
- Du, D.; Liu, B.; Wang, D.; Qu, Y.; Jiao, H. Application of nucleic acid free extraction and rapid detection technology in the identification of influenza virus cell lines. J. Prev. Med. Inf. 2018, 34, 4–11. [Google Scholar]
- Wang, C.; Liu, J.; Lin, X.; Wu, S. Detection of African Swine Fever Virus (ASFV) by Loop-mediated Isothermal Amplification Method. Prog. Vet. Med. 2010, 31, 15–19. [Google Scholar]
- Woźniakowski, G.; Frączyk, M.; Mazur, N. Comparison of loop-mediated isothermal amplification (LAMP) and cross-priming amplification (CPA) for detection of African swine fever virus. Pol. J. Vet. Sci. 2018, 21, 827–830. [Google Scholar]
- Yang, Z.; Jiang, Y.; Cheng, N.; Li, X.; Huang, K.; Liu, Q.; Sun, Y.; Xu, W. Research Progress on detection methods of African classical swine fever virus. J. Anal. Test. 2021, 40, 628–638. [Google Scholar]
- Li, Y.; Li, L.; Fan, X.; Zou, Y.; Zhang, Y.; Wang, Q.; Sun, C.; Pan, S.; Wu, S.; Wang, Z. Development of real-time reverse transcription recombinase polymerase amplification (RPA) for rapid detection of peste des petits ruminants virus in clinical samples and its comparison with real-time PCR test. Sci. Rep. 2018, 8, 223–240. [Google Scholar] [CrossRef]
- Shen, X.X.; Qiu, F.Z.; Shen, L.P.; Yan, T.F.; Zhao, M.C.; Qi, J.J.; Chen, C.; Zhao, L.; Wang, L.; Feng, Z.-S.; et al. A rapid and sensitive recombinase aided amplification assay to detect hepatitis B virus without DNA extraction. BMC Infect. Dis. 2019, 19, 229–235. [Google Scholar] [CrossRef]
- Fan, X.; Li, L.; Zhao, Y.; Liu, Y.; Liu, C.; Wang, Q.; Dong, Y.; Wang, S.; Chi, T.; Song, F.; et al. Clinical Validation of Two Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of African Swine Fever Virus. Front. Microbiol. 2020, 11, 1696–1713. [Google Scholar] [CrossRef]
- Ha, D.; Fan, X.; Zhao, Y.; Wang, S.; Zhang, Z.; Ge, S.; Li, L.; Wu, X.; Wang, Z. Establishment of a Real-time Fluorescent Recombinase Polymerase Amplification (RPA) for the Detection of African Swine Fever Virus. China Anim. Husb. Vet. Med. 2017, 44, 3270–3277. [Google Scholar]
- Aguero, M.; Fernández, J.; Romero, L.; Sánchez Mascaraque, C.; Arias, M.; Sánchez-Vizcaíno, J.M. Highly Sensitive PCR Assay for Routine Diagnosis of African Swine Fever Virus in Clinical Samples. J. Clin. Microbiol. 2003, 41, 4431–4434. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Wu, D.; Gao, X.; Zhang, W.; Zhang, Q.; Su, Y.; Wei, H.; Zhou, D.; Liu, X.; Song, Y. Establishment of a rapid and visualized LAMP method for detection of African swine fever virus. Anim. Husb. Vet. Med. 2021, 53, 101–106. [Google Scholar]
- King, D.P.; Reid, S.M.; Hutchings, G.H.; Grierson, S.S.; Wilkinson, P.J.; Dixon, L.K.; Bastos, A.D.S.; Drew, T.W. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 2003, 107, 53–61. [Google Scholar] [CrossRef]
- Wang, Y.; Gao, L.; Li, Y.; Xu, Q.; Yang, H.; Shen, C.; Huang, B. African swine fever in China: Emergence and control. J. Biosaf. Biosecurity 2019, 1, 7–8. [Google Scholar] [CrossRef]
- Teklue, T.; Sun, Y.; Abid, M.; Luo, Y.; Qiu, H.J. Current status and evolving approaches to African swine fever vaccine development. Transbound. Emerg. Dis. 2020, 67, 529–542. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Pinero, J.; Gallardo, C.; Elizalde, M.; Robles, A.; Gómez, C.; Bishop, R.; Heath, L.; Couacy-Hymann, E.; Fasina, F.O.; Pelayo, V.; et al. Molecular diagnosis of African Swine Fever by a new real-time PCR using universal probe library. Transbound. Emerg. Dis. 2013, 60, 48–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korthase, C.; Elnagar, A.; Beer, M.; Hoffmann, B. Easy Express Extraction (TripleE)—A Universal, Electricity-Free Nucleic Acid Extraction System for the Lab and the Pen. Microorganisms 2022, 10, 1074. [Google Scholar] [CrossRef] [PubMed]
Assay | Primer | Sequence (5′–3′) | Reference |
---|---|---|---|
DNA extraction-free qPCR | Fw1 | ATCCGATCACATTACCTA | This work |
Rev1 | AGTGGAAGGGTATGTAAG | ||
Probe1 | (FAM)CCGTAACTGCTCATGGTATCAATCT(BHQ1) | ||
Fw2 | GCGATGATGATTACCTTTG | ||
Rev2 | CCCARCTAATATAAAAYTCTCTTG a | ||
Probe2 | (FAM)ARCCACGGGAGGAATACCAAC(BHQ1) | ||
LAMP | F3 | CGCAATATACGCTTTAAACCA | [30] |
B3 | ACATTAGTTTTTCATCGTGGTG | ||
FIP | AGGGGTTACAAACAGGTTATTGATGGGAGTCATTAATGAAATCTCGC | ||
BIP | TACACAACCTTTTTGTAAAACGCGTATTGTTGGTGTGGGTCAC | ||
LB | TCGCTTTTCGCTGATACGTG | ||
OIE qPCR | Positive Primer | CTGCTCATGGTATCAATCTTATCGA | [31] |
Negative Primer | GATACCACAAGATC(AG)GCCGT | ||
Probe | (FAM)CCACGGGAGGAATACCAACCCAGTG(BHQ1) |
Assay | The Reactions (25 µL) | The Thermal Cycling Program | Reference |
---|---|---|---|
OIE qPCR | 16 μL of qPCR mix containing enzyme (Code391A, Takara Co., Ltd.), 1 μL (0.4 μM) of positive primer, 1 μL (0.4 μM) of negative primer, 1 μL (0.4 μM) of probe, 4 μL of ultrapure water without DNase, and 2 µL of extracted DNA. | 30 s at 95 °C, then 40 cycles of 5 s at 95 °C and 30 s at 60 °C; the fluorescent signals from FAM were collected at 60 °C. | [31] |
DNA extraction-free qPCR | 16 μL of qPCR mix containing enzyme (Code391A, Takara Co., Ltd., Dalian, China), 1 μL (0.4 μM) of forward primers (Fw1 and Fw2), 1 μL (0.4 μM) of reverse primers (Rev1 and Rev2), 1 μL (0.4 μM) of probe (Probe1 and Probe2), 4 μL ultrapure water without DNase, and 2 µL DNA extraction-free supernatant. | Pre-amplification (15 cycles of 10 s at 95 °C and 10 s at 50 °C) did not collect the FAM fluorescence signal; then, 1 min at 95 °C; followed by of 10 s at 95 °C and 30 s at 55 °C for 35 cycles; the fluorescent signals from FAM were collected at 55 °C. | This work |
DNA extraction-free visual LAMP | 12.5 μL of 2× reaction buffer, 1 μL of enzyme solution (Code 94001, Rongyan Biotechnology Co., Ltd., Beijing, China), 1 μL of visual MnCl2-calcein stock solution (Code SLP221, Rongyan Biotechnology Co., Ltd.), 1 μL (8 μM) of outer primer F3, 1 μL (8 μM) of outer primer B3, 1 μL (35 μM) of inner primer FIP, 1 μL (35 μM) of inner primer BIP, 1μL (15 μM) of loop primer LB, 0.5 μL of ultrapure water without DNase, and 5 μL of DNA extraction-free supernatant. | Initially, 63 °C for 30 min, followed by 95 °C for 2 min for termination. Under UV light (350–370 nm), samples that showed turbid green fluorescence were considered positive for ASFV, whereas samples with no turbidity were considered negative. | [30] |
DNA extraction-free fluorescent LAMP | 12.5 μL of 2× reaction buffer, 1 μL of enzyme solution (Code 94001, Rongyan Biotechnology Co., Ltd., Beijing, China), 1 μL of SYTO-9 fluorescent dye (No. 051011M, DHelixCo., Ltd., Guangzhou, China), 1 μL (8 μM) of outer primer F3, 1 μL (8 μM) of outer primer B3, 1 μL (35 μM) of inner primer FIP, 1 μL (35 μM) of inner primer BIP, 1 μL (15 μM) of loop primer LB, 0.5 μL of ultrapure water without DNase, and 5 μL of DNA extraction-free supernatant. | 63 °C for 15 s, followed by 45 cycles at 63 °C for 45 s. | [30] |
Assays | Result | OIE qPCR with DNA Extraction | Performance Characteristics (%) | Agreement Kappa Value | |||
---|---|---|---|---|---|---|---|
Positive | Negative | Total | Sensitivity | Specificity | |||
DNA extraction-free qPCR | Positive | 62 | 0 | 62 | 100% (94.2–100%, 95% CI) | 100% (90.7–100%, 95% CI) | 1.0 (1–1, 95% CI) |
Negative | 0 | 38 | 38 | ||||
Total | 62 | 38 | 100 | ||||
DNA extraction-free Visual LAMP | Positive | 54 | 8 | 62 | 87.1% (76.1–94.3%, 95% CI) | 100% (90.7–100%, 95% CI) | 0.84 (0.73–0.94, 95% CI) |
Negative | 0 | 38 | 38 | ||||
Total | 54 | 46 | 100 | ||||
DNA extraction-free Fluorescent LAMP | Positive | 56 | 6 | 621 | 90.32% (80.1–96.4%, 95% CI) | 100% (90.7–100%, 95% CI) | 0.88 (0.78–0.97, 95% CI) |
Negative | 0 | 38 | 38 | ||||
Total | 56 | 44 | 100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, L.; Wang, L.; Lv, M.; Sun, Y.; Cao, J. Clinical Validation of DNA Extraction-Free qPCR, Visual LAMP, and Fluorescent LAMP Assays for the Rapid Detection of African Swine Fever Virus. Life 2022, 12, 1067. https://doi.org/10.3390/life12071067
Yang L, Wang L, Lv M, Sun Y, Cao J. Clinical Validation of DNA Extraction-Free qPCR, Visual LAMP, and Fluorescent LAMP Assays for the Rapid Detection of African Swine Fever Virus. Life. 2022; 12(7):1067. https://doi.org/10.3390/life12071067
Chicago/Turabian StyleYang, Lili, Lin Wang, Meihui Lv, Yu Sun, and Jijuan Cao. 2022. "Clinical Validation of DNA Extraction-Free qPCR, Visual LAMP, and Fluorescent LAMP Assays for the Rapid Detection of African Swine Fever Virus" Life 12, no. 7: 1067. https://doi.org/10.3390/life12071067
APA StyleYang, L., Wang, L., Lv, M., Sun, Y., & Cao, J. (2022). Clinical Validation of DNA Extraction-Free qPCR, Visual LAMP, and Fluorescent LAMP Assays for the Rapid Detection of African Swine Fever Virus. Life, 12(7), 1067. https://doi.org/10.3390/life12071067