Environmental Surveillance of ESKAPE Bacteria in Wastewater and Rivers in the Vhembe District, South Africa: Public Health Risks from a One Health Perspective
Abstract
1. Introduction
2. Methods and Materials
2.1. Study Site
2.2. Sample Collection
2.3. Isolation of ESKAPE Pathogens Using Culture Technique
2.4. Genomic DNA Extraction, Species-Specific PCR, and DNA Sequencing for ESKAPE Identification
| Organism | Primer Name | Primer Sequence (5′-3′) | PCR Cycling Parameters | Gene (Size bp) | Reference |
|---|---|---|---|---|---|
| E. faecium | pstS1-F | TTGAGCCAAGTCGAAGCTGGAG | 95 °C for 15 min; 35 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s; final extension at 72 °C for 5 min | pstS (583) | Homan et al. [25] |
| pstS2-R | CGTGATCACGTTCTACTTCC | ||||
| S. aureus | vicK1 | CTAATACTGAAAGTGAGAAACGTA | 94 °C for 5 min; 35 cycles at 94 °C for 40 s, 50 °C for 40 s, and 72 °C for 60 s; final extension at 72 °C for 5 min | vicK (289) | Liu et al. [26] |
| vicK2 | TCCTGCACAATCGTACTAAA | ||||
| K. pneumoniae | Kpn-F | GTGCGATGCGGTCTTTG | 95 °C for 15 min; 45 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 90 s; final extension at 72 °C for 5 min | phoE (398) | Kaushik and Balasubramanian [27] |
| Kpn-R | GGGCGAACTGAACTGATG | ||||
| A. baumannii | A.b_hyp F | CGTCGGTCGGATCCGTGTA | 95 °C for 15 min; 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s; final extension at 72 °C for 5 min | A.b_hyp (545) | Havenga et al. [23] |
| A.b hyp R | AAGTAAAGTGGCAGGCGCTT | ||||
| P. aeruginosa | kpd1 | GCCCACGACCAGTTCGAC | 95 °C for 15 min; 30 cycles at 94 °C for 15 s, 54 °C for 15 s, and 72 °C for 15 s; final extension at 72 °C for 5 min | rhIB (226) | Bodour et al. [28] |
| kpd2 | CATCCCCCTCCCTATGAC | ||||
| Enterobacter spp. | ENB-F | AGTGGAACGGTCTGGAAAGG | 95 °C for 15 min; 45 cycles at 95 °C for 10 s, 56 °C for 20 s, and 72 °C for 20 s; final extension at 72 °C for 5 min | 23S rRNA (154) | Patel et al. [29] |
| ENB-R | TCGGTCAGTCAGGAGTATTTAGC |
3. Results and Discussions
3.1. Molecular Detection of ESKAPE Organisms from WWTPs 1 and 2
3.2. Phylogenetic Analysis

4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kraemer, S.A.; Ramachandran, A.; Perron, G.G. Antibiotic pollution in the environment: From microbial ecology to public policy. Microorganisms 2019, 7, 180. [Google Scholar] [CrossRef] [PubMed]
- Mustafa, S.S.; Batool, R.; Kamran, M.; Javed, H.; Jamil, N. Evaluating the role of wastewaters as reservoirs of antibiotic-resistant ESKAPEE bacteria using phenotypic and molecular methods. Infect. Drug Resist. 2022, 15, 5715–5728. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.M.; Lin, M.F.; Liao, P.C.; Yeh, H.W.; Chang, B.V.; Tang, T.K.; Cheng, C.; Sung, C.H.; Liou, M.L. Comparison of antimicrobial resistance patterns between clinical and sewage isolates in a regional hospital in Taiwan. Lett. Appl. Microbiol. 2009, 48, 560–565. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, M.; Khan, A.U.; Wahid, A.; Butt, Z.A.; Farhan, M.; Ahmad, F. Role of hospital effluents in the contribution of antibiotics and antibiotic-resistant bacteria to the aquatic environment. Pak. J. Nutr. 2012, 11, 1177. [Google Scholar] [CrossRef]
- Rabbani, M.A.G.; Howlader, M.Z.H.; Kabir, Y. Detection of multidrug-resistant (MDR) bacteria in untreated wastewater disposals of hospitals in Dhaka City, Bangladesh. J. Glob. Antimicrob. Res. 2017, 10, 120–125. [Google Scholar] [CrossRef]
- Giebułtowicz, J.; Tyski, S.; Wolinowska, R.; Grzybowska, W.; Zaręba, T.; Drobniewska, A.; Wroczyński, P.; Nałęcz-Jawecki, G. Occurrence of antimicrobial agents, drug-resistant bacteria, and genes in the sewage-impacted Vistula River (Poland). Environ. Sci. Pol. Res. 2018, 25, 5788–5807. [Google Scholar] [CrossRef]
- Savin, M.; Bierbaum, G.; Hammerl, J.A.; Heinemann, C.; Parcina, M.; Sib, E.; Voigt, A.; Kreyenschmidt, J. ESKAPE bacteria and extended-spectrum-β-lactamase-producing Escherichia coli isolated from wastewater and process water from German poultry slaughterhouses. Appl. Environ. Microbiol. 2020, 86, e02748-19. [Google Scholar] [CrossRef]
- Pandey, R.; Mishra, S.K.; Shrestha, A. Characterisation of ESKAPE pathogens with special reference to multidrug resistance and biofilm production in a Nepalese hospital. Infect. Drug Resist. 2021, 14, 2201–2212. [Google Scholar] [CrossRef]
- Nishiyama, M.; Praise, S.; Tsurumaki, K.; Baba, H.; Kanamori, H.; Watanabe, T. Prevalence of antibiotic-resistant bacteria ESKAPE among healthy people estimated by monitoring of municipal wastewater. Antibiotics 2021, 10, 495. [Google Scholar] [CrossRef]
- Kruse, H. Indirect transfer of antibiotic resistance genes to man. Acta Vet. Sci. Suppl. 1999, 92, 59–65. [Google Scholar]
- He, Y.; Yuan, Q.; Mathieu, J.; Stadler, L.; Senehi, N.; Sun, R.; Alvarez, P.J. Antibiotic resistance genes from livestock waste: Occurrence, dissemination, and treatment. npj Clean Water 2020, 3, 4. [Google Scholar] [CrossRef]
- Okafor, J.U.; Nwodo, U.U. Molecular characterisation of antibiotic resistance determinants in Klebsiella pneumoniae isolates recovered from hospital effluents in the Eastern Cape province, South Africa. Antibiotics 2023, 12, 1139. [Google Scholar] [CrossRef]
- Santajit, S.; Indrawattana, N. Mechanisms of antimicrobial resistance in ESKAPE pathogens. Biomed Res. Int. 2016, 2016, 2475067. [Google Scholar] [CrossRef]
- Mapipa, Q.; Digban, T.O.; Nnolim, N.E.; Nontongana, N.; Okoh, A.I.; Nwodo, U.U. Molecular characterisation and antibiotic susceptibility profile of Acinetobacter baumannii recovered from hospital wastewater effluents. Cur. Microbiol. 2022, 79, 123. [Google Scholar]
- Kusi, J.; Ojewole, C.O.; Ojewole, A.E.; Nwi-Mozu, I. Antimicrobial resistance development pathways in surface waters and public health implications. Antibiotics 2022, 11, 821. [Google Scholar] [CrossRef]
- Tiwari, A.; Kurittu, P.; Al-Mustapha, A.I.; Heljanko, V.; Johansson, V.; Thakali, O.; Mishra, S.K.; Lehto, K.M.; Lipponen, A.; Oikarinen, S.; et al. Wastewater surveillance of antibiotic-resistant bacterial pathogens: A systematic review. Front. Microbiol. 2022, 13, 977106. [Google Scholar] [CrossRef]
- Ebomah, K.E.; Okoh, A.I. An African perspective on the prevalence, fate and effects of carbapenem resistance genes in hospital effluents and wastewater treatment plant (WWTP) final effluents: A critical review. Heliyon 2020, 6, e03899. [Google Scholar] [CrossRef]
- Sandman, K.; Ecker, C. Pseudomonas isolation and identification: An introduction to the challenges of polyphasic taxonomy. J. Microbiol. Biol. Educ. 2014, 15, 287–291. [Google Scholar] [CrossRef]
- Clements, T.; Reyneke, B.; Strauss, A.; Khan, W. Persistence of viable bacteria in solar pasteurised harvested rainwater. Water Air Soil Pol. 2019, 230, 130. [Google Scholar] [CrossRef]
- O’Connor, K.; Morrissette, M.; Strandwitz, P.; Ghiglieri, M.; Caboni, M.; Liu, H.; Khoo, C.; D’Onofrio, A.; Lewis, K. Cranberry extracts promote the growth of Bacteroidaceae and decrease the abundance of Enterobacteriaceae in a human gut simulator model. PLoS ONE 2019, 14, e0224836. [Google Scholar] [CrossRef] [PubMed]
- Kassamali, Z.; Prince, R.A.; Danziger, L.H.; Rotschafer, J.C.; Rhomberg, P.R.; Jones, R.N. Microbiological assessment of polymyxin B components tested alone and in combination. Antimicrob. Agents Chemother. 2015, 59, 7823–7825. [Google Scholar] [CrossRef] [PubMed]
- Ekwanzala, M.D.; Dewar, J.B.; Kamika, I.; Momba, M.N.B. Tracking the environmental dissemination of carbapenem-resistant Klebsiella pneumoniae using whole genome sequencing. Sci. Total Environ. 2019, 691, 80–92. [Google Scholar] [CrossRef]
- Havenga, B.; Ndlovu, T.; Clements, T.; Reyneke, B.; Waso, M.; Khan, W. Exploring the antimicrobial resistance profiles of the WHO critical priority list bacterial strains. BMC Microbiol. 2019, 19, 303. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Homan, W.L.; Tribe, D.; Poznanski, S.; Li, M.; Hogg, G.; Spalburg, E.; Van Embden, J.D.; Willems, R.J. Multilocus sequence typing scheme for Enterococcus faecium. J. Clin. Microbiol. 2002, 40, 1963–1971. [Google Scholar] [CrossRef]
- Liu, C.I.; Liu, G.Y.; Song, Y.; Yin, F.; Hensler, M.E.; Jeng, W.Y.; Nizet, V.; Wang, A.H.J.; Oldfield, E. A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence. Science 2008, 319, 1391–1394. [Google Scholar] [CrossRef] [PubMed]
- Kaushik, R.; Balasubramanian, R. Assessment of bacterial pathogens in fresh rainwater and airborne particulate matter using Real-Time PCR. Atmos. Environ. 2012, 46, 131–139. [Google Scholar] [CrossRef]
- Bodour, A.A.; Drees, K.P.; Maier, R.M. Distribution of biosurfactant-producing bacteria in undisturbed and contaminated arid southwestern soils. Appl. Environ. Microbiol. 2003, 69, 3280–3287. [Google Scholar] [CrossRef] [PubMed]
- Patel, C.B.; Shanker, R.; Gupta, V.K.; Upadhyay, R.S. Q-PCR-based culture-independent enumeration and detection of Enterobacter: An emerging environmental human pathogen in riverine systems and potable water. Front. Microbiol. 2016, 7, 172. [Google Scholar] [CrossRef]
- Nyenje, M.E.; Tanih, N.F.; Green, E.; Ndip, R.N. Current status of antibiograms of Listeria ivanovii and Enterobacter cloacae isolated from ready-to-eat foods in Alice, South Africa. Int. J. Environ. Res. Public Health 2012, 9, 3101–3114. [Google Scholar] [CrossRef]
- Hrenovic, J.; Ivankovic, T.; Ivekovic, D.; Repec, S.; Stipanicev, D.; Ganjto, M. The fate of carbapenem-resistant bacteria in a wastewater treatment plant. Water Res. 2017, 126, 232–239. [Google Scholar] [CrossRef]
- Marutescu, L.G.; Popa, M.; Gheorghe-Barbu, I.; Barbu, I.C.; Rodríguez-Molina, D.; Berglund, F.; Blaak, H.; Flach, C.F.; Kemper, M.A.; Spießberger, B.; et al. Wastewater treatment plants, an “escape gate” for ESCAPE pathogens. Front. Microbiol. 2023, 14, 1193907. [Google Scholar] [CrossRef] [PubMed]
- Pärnänen, K.M.; Narciso-da-Rocha, C.; Kneis, D.; Berendonk, T.U.; Cacace, D.; Do, T.T.; Elpers, C.; Fatta-Kassinos, D.; Henriques, I.; Jaeger, T.; et al. Antibiotic resistance in European wastewater treatment plants mirrors the pattern of clinical antibiotic resistance prevalence. Sci. Adv. 2019, 5, 9124. [Google Scholar] [CrossRef]
- Reichert, G.; Hilgert, S.; Fuchs, S.; Azevedo, J.C.R. Emerging contaminants and antibiotic resistance in the different environmental matrices of Latin America. Environ. Pollut. 2019, 255, 113140. [Google Scholar] [CrossRef] [PubMed]
- Huddleston, J.R. Horizontal gene transfer in the human gastrointestinal tract: Potential spread of antibiotic resistance genes. Infect. Drug Resist. 2014, 7, 167–176. [Google Scholar] [CrossRef]
- Almakki, A.; Jumas-Bilak, E.; Marchandin, H.; Licznar-Fajardo, P. Antibiotic resistance in urban runoff. Sci. Total Environ. 2019, 667, 64–76. [Google Scholar] [CrossRef] [PubMed]
- Hassen, B.; Abbassi, M.S.; Benlabidi, S.; Ruiz-Ripa, L.; Mama, O.M.; Ibrahim, C.; Hassen, A.; Hammami, S.; Torres, C. Genetic characterisation of ESBL-producing Escherichia coli and Klebsiella pneumoniae isolated from wastewater and river water in Tunisia: Predominance of CTX-M-15 and high genetic diversity. Environ. Sci. Pol. Res. 2020, 27, 44368–44377. [Google Scholar] [CrossRef]
- Hosu, M.C.; Vasaikar, S.; Okuthe, G.E.; Apalata, T. Molecular Detection of Antibiotic-Resistant Genes in Pseudomonas aeruginosa from Nonclinical Environment: Public Health Implications in Mthatha, Eastern Cape Province, South Africa. Int. J. Microbiol. 2021, 2021, 8861074. [Google Scholar] [CrossRef]
- Aguilar-Salazar, A.; Martínez-Vázquez, A.V.; Aguilera-Arreola, G.; de Jesus de Luna-Santillana, E.; Cruz-Hernández, M.A.; Escobedo-Bonilla, C.M.; Lara-Ramírez, E.; Sánchez-Sánchez, M.; Guerrero, A.; Rivera, G.; et al. Prevalence of ESKAPE bacteria in surface water and wastewater sources: Multidrug resistance and molecular characterisation, An updated review. Water 2023, 15, 3200. [Google Scholar] [CrossRef]
- Galarde-López, M.; Velazquez-Meza, M.E.; Godoy-Lozano, E.E.; Carrillo-Quiroz, B.A.; Cornejo-Juárez, P.; Sassoé-González, A.; Ponce-de-León, A.; Saturno-Hernández, P.; Alpuche-Aranda, C.M. Presence and Persistence of ESKAPEE Bacteria before and after Hospital Wastewater Treatment. Microorganism 2024, 12, 1231. [Google Scholar] [CrossRef]
- Ma, X.; Dong, X.; Cai, J.; Fu, C.; Yang, J.; Liu, Y.; Zhang, Y.; Wan, T.; Lin, S.; Lou, Y.; et al. Metagenomic analysis reveals changes in bacterial communities and antibiotic resistance genes in an eye speciality hospital and a general hospital before and after wastewater treatment. Front. Microbiol. 2022, 13, 848167. [Google Scholar]
- Ma, Y.X.; Wang, C.Y.; Li, Y.Y.; Li, J.; Wan, Q.Q.; Chen, J.H.; Tay, F.R.; Niu, L.N. Considerations and caveats in combating ESKAPE pathogens against nosocomial infections. Adv. Sci. 2020, 7, 1901872. [Google Scholar] [CrossRef] [PubMed]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef] [PubMed]
- Kroneman, A.; Vennema, H.; Deforche, K.V.D.; Avoort, H.V.D.; Peñaranda, S.; Oberste, M.S.; Vinjé, J.; Koopmans, M. An automated genotyping tool for enteroviruses and noroviruses. J. Clin. Virol. 2011, 51, 121–125. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Rousham, E.K.; Unicomb, L.; Islam, M.A. Human, animal and environmental contributors to antibiotic resistance in low-resource settings: Integrating behavioural, epidemiological and One Health approaches. Proc. R. Soc. B Biol. Sci. 2018, 285, 20180332. [Google Scholar] [CrossRef]
- Hernández-García, M.; Castillo-Polo, J.A.; Cordero, D.G.; Pérez-Viso, B.; García-Castillo, M.; Saez de la Fuente, J.; Morosini, M.I.; Cantón, R.; Ruiz-Garbajosa, P. Impact of ceftazidime-avibactam treatment in the emergence of novel KPC variants in the ST307-Klebsiella pneumoniae high-risk clone and consequences for their routine detection. J. Clin. Microbiol. 2022, 60, e02245-21. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbour-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbour-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef]
| Month | WWTPs | Sampling Point | Culturing | PCR | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| S | K | A | P | Eb | S | K | A | P | Eb | |||
| AUGUST | WWTP-1 | Influent | + | + | + | + | + | + | + | + | + | + |
| Effluent | − | − | + | − | + | − | − | − | − | + | ||
| Upstream | + | + | + | + | + | − | + | + | + | + | ||
| Downstream | + | + | + | + | − | − | + | + | + | − | ||
| WWTP-2 | Influent | + | + | + | + | + | + | + | + | + | + | |
| Effluent | + | − | + | − | + | + | − | − | − | − | ||
| Upstream | + | + | + | + | + | − | + | + | + | − | ||
| Downstream | + | + | + | + | + | − | + | + | + | + | ||
| SEPTEMBER | WWTP-1 | Influent | + | + | + | + | + | + | + | + | + | + |
| Effluent | − | − | − | − | + | − | − | − | − | + | ||
| Upstream | + | + | + | + | + | − | + | + | + | + | ||
| Downstream | − | − | − | − | − | − | − | − | − | − | ||
| WWTP-2 | Influent | + | + | + | + | + | + | + | + | + | + | |
| Effluent | + | + | + | + | + | + | + | − | + | + | ||
| Upstream | + | + | + | + | + | + | + | + | + | + | ||
| Downstream | + | + | + | + | + | + | + | − | + | − | ||
| OCTOBER | WWTP-1 | Influent | + | + | + | + | + | + | + | + | + | + |
| Effluent | + | + | − | − | + | + | + | − | − | + | ||
| Upstream | + | + | + | + | + | − | + | + | + | + | ||
| Downstream | + | − | − | − | − | − | − | − | − | − | ||
| WWTP-2 | Influent | + | + | + | + | + | + | + | + | + | + | |
| Effluent | + | + | − | − | + | + | + | − | − | + | ||
| Upstream | + | + | + | + | + | + | + | − | + | + | ||
| Downstream | + | + | + | + | + | + | + | + | + | + | ||
| NOVEMBER | WWTP-1 | Influent | + | + | + | + | + | − | + | + | + | + |
| Effluent | + | + | − | − | + | − | + | − | − | + | ||
| Upstream | + | + | + | + | + | − | + | + | + | + | ||
| Downstream | + | + | − | + | + | − | + | − | + | + | ||
| WWTP-2 | Influent | + | + | + | + | + | − | + | + | + | + | |
| Effluent | + | + | + | + | + | − | + | + | + | + | ||
| Upstream | + | + | + | + | + | + | + | + | + | + | ||
| Downstream | + | + | + | + | + | + | + | + | + | + | ||
| DECEMBER | WWTP-1 | Influent | + | + | + | + | + | + | + | − | + | + |
| Effluent | – | + | − | − | + | − | − | − | − | + | ||
| Upstream | + | + | + | + | + | + | + | − | + | + | ||
| Downstream | − | − | − | − | − | − | − | − | − | − | ||
| WWTP-2 | Influent | + | + | + | + | + | + | + | − | + | + | |
| Effluent | + | + | + | + | + | − | + | − | + | + | ||
| Upstream | + | + | + | + | + | + | + | − | + | + | ||
| Downstream | + | + | + | + | + | − | + | − | + | + | ||
| JANUARY | WWTP-1 | Influent | + | + | + | + | + | + | + | − | + | + |
| Effluent | − | − | − | − | − | − | − | − | − | − | ||
| Upstream | + | + | + | + | + | − | + | − | + | + | ||
| Downstream | − | − | − | − | − | − | − | − | − | − | ||
| WWTP-2 | Influent | + | + | + | + | + | + | + | − | + | + | |
| Effluent | − | − | − | − | − | − | − | − | − | − | ||
| Upstream | + | + | + | + | + | − | + | − | + | + | ||
| Downstream | + | + | + | + | + | − | + | − | + | + | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Potgieter, N.; Rikhotso, M.C.; Kachienga, L.O.; Badzhi, R.; Traoré, A.N. Environmental Surveillance of ESKAPE Bacteria in Wastewater and Rivers in the Vhembe District, South Africa: Public Health Risks from a One Health Perspective. Water 2025, 17, 2999. https://doi.org/10.3390/w17202999
Potgieter N, Rikhotso MC, Kachienga LO, Badzhi R, Traoré AN. Environmental Surveillance of ESKAPE Bacteria in Wastewater and Rivers in the Vhembe District, South Africa: Public Health Risks from a One Health Perspective. Water. 2025; 17(20):2999. https://doi.org/10.3390/w17202999
Chicago/Turabian StylePotgieter, Natasha, Mpumelelo Casper Rikhotso, Leonard Owino Kachienga, Rohudzwa Badzhi, and Afsatou Ndama Traoré. 2025. "Environmental Surveillance of ESKAPE Bacteria in Wastewater and Rivers in the Vhembe District, South Africa: Public Health Risks from a One Health Perspective" Water 17, no. 20: 2999. https://doi.org/10.3390/w17202999
APA StylePotgieter, N., Rikhotso, M. C., Kachienga, L. O., Badzhi, R., & Traoré, A. N. (2025). Environmental Surveillance of ESKAPE Bacteria in Wastewater and Rivers in the Vhembe District, South Africa: Public Health Risks from a One Health Perspective. Water, 17(20), 2999. https://doi.org/10.3390/w17202999

