Next Article in Journal
Identification of Driving Factors of Long-Term Terrestrial Water Storage Anomaly Trend Changes in the Yangtze River Basin Based on Multisource Data and Geographical Detector Method
Previous Article in Journal
Groundwater Vulnerability Assessment in the Huangshui River Basin Under Representative Environmental Change
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Coal Fly Ash Addition on the Carbon Mineralization of Agricultural Soil Under Different Moisture Conditions

1
Guangdong Energy Group Science and Technology Research Institute Co., Ltd., Guangzhou 510630, China
2
National-Regional Joint Engineering Research Center for Soil Pollution Control and Remediation in South China, Guangdong Key Laboratory of Integrated Agro-Environmental Pollution Control and Management, Institute of Eco-Environmental and Soil Sciences, Guangdong Academy of Sciences, Guangzhou 510650, China
3
International Academy of Soil and Water Conservation, Meizhou 514000, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Water 2025, 17(19), 2912; https://doi.org/10.3390/w17192912
Submission received: 9 September 2025 / Revised: 28 September 2025 / Accepted: 1 October 2025 / Published: 9 October 2025
(This article belongs to the Section Soil and Water)

Abstract

Laboratory incubation experiments were conducted to investigate the effects of coal fly ash (FA) amendment (0%, 2.5%, 7.5%, and 15%) and moisture regimes (40%, 70%, and 100% water holding capacity (WHC)) on the mineralization of carbon (C) in an acidic agricultural soil. The results showed that the soil C mineralization intensity initially increased and subsequently decreased throughout the incubation period, with the mineralization dynamics well described by the first-order kinetic model (0.9633 ≤ R2 ≤ 0.9972). Carbon mineralization increased with the application rate of FA, while moisture effect followed the order 70% WHC > 100% WHC > 40% WHC. Indicators showing highly significant correlations with total C mineralization amount included FA application rate, pH, water-soluble organic carbon, (WSOC) and cellulase (CEL) activity. Specific bacterial (Acidobacteriota, Gemmatimonadota, Pseudomonadota, and Actinobacteriota) and fungal phyla (Chytridiomycota, Glomeromycota, and Olpidiomycota) exhibited stronger correlations with C mineralization. The microbial taxa exhibiting significant responses to FA and moisture conditions were not consistent. Although the addition of high proportions of FA, especially with adequate moisture conditions, can enhance soil microbial activity and C mineralization, the potential risks of soil C loss and the accumulation of toxic elements necessitate the prudent implementation of elevated FA application rates in practical scenarios.

1. Introduction

With the rapid development of modern industrial and agricultural production, a substantial volume of waste is generated correspondingly. The improper management and disposal of this waste can pose significant environmental risks [1]. In recent years, the intentional use of industrial or agricultural waste as soil amendments to improve soil quality has become an important research focus. For instance, biochar, sludge compost, and phosphogypsum have been widely applied in agricultural production with remarkable results [2,3,4]. This waste utilization approach not only facilitates the effective disposal of solid waste and reduces environmental burdens, but also achieves the transformation of “waste into treasure”. By transforming waste into valuable resources, soil amendments play a critical role in promoting a circular economy.
Fly ash is a fine-grained byproduct produced during coal combustion in thermal power plants and other industrial facilities. Globally, the annual production of FA exceeds 1.5 billion tons, and has shown a consistent upward trend in recent years [5]. Fly ash is primarily composed of silicon dioxide (SiO2), aluminum oxide (Al2O3), and iron oxide (Fe2O3), and most of its particles are glassy and spherical in nature with pozzolanic activity. Owing to its unique properties, including a porous structure, high surface area, and alkaline properties, FA is considered a promising material for resource recovery. For instance, it has been widely applied in construction, cement production, and soil amendment, particularly in improving soil structure and fertility in degraded lands such as saline alkali soils and coal mine reclamation areas [6,7,8]. Recycling FA not only mitigates its environmental hazards, but also aligns with circular economy principles by transforming waste into valuable resources.
When utilized as a soil amendment, FA can enhance soil porosity, water retention, and nutrient availability (e.g., phosphorus (P) and potassium (K)) [9]. Research has demonstrated that the incorporation of FA into agricultural soils at appropriate doses significantly improves plant growth and increases yield productivity [10,11]. However, the application of FA may produce dual effects. The long-term excessive use of FA as an amendment can induce soil alkalization, thereby impairing nutrient uptake in acidophilic crops such as potatoes [12]. Moreover, while FA contains essential elements for plant growth (e.g., molybdenum (Mo) and selenium (Se)), it is also a source of toxic metals including copper (Cu), arsenic (As), and chromium (Cr). The latent release of these heavy metals from FA under acidic rainfall or root exudate exposure leads to a significant risk of food chain contamination [13,14]. Additionally, FA significantly influences soil enzyme activity and microbial communities, with the effects also being dose-dependent. Low levels of FA application commonly enhances micronutrient availability and stimulate microbial activity, while high doses tend to suppress microbial activity and growth, largely due to the accumulation of toxic metals in soils [15]. Nevertheless, current research on the effects of FA on agricultural soil microbial activities remains relatively limited.
The variations in the physicochemical and microbial properties of soil resulting from the addition of FA also influence soil C dynamics, with effects contingent upon inherent soil characteristics, FA properties, and application rates. The porous structure and fine particles of FA immobilize organic C through physical adsorption protection mechanisms, reducing microbial contract with organic substrates. Simultaneously, iron (Fe) and manganese (Mn) oxides in FA chemically bind with organic C through chelation and complexation, further enhancing its resistance to microbial decomposition. The research of Nayak et al. [15] demonstrated that the application of 10% and 20% FA treatments significantly reduced soil respiration and microbial biomass carbon (MBC). Saidy et al. [16] reported similar findings and attributed decreased soil C mineralization and MBC to organic C stabilization by FA-derived oxides (e.g., Fe/Al oxides) and polyvalent cations (e.g., Ca2+ and Mg2+). Additionally, FA-induced pH shifts differently regulate extracellular enzyme activities (e.g., stimulating phosphatase but inhibiting peroxidase), thereby altering C mineralization capacity [17,18]. Notably, the presence of heavy metal elements in FA often suppresses microbial activity due to toxic stress at high application rates, leading to a significant decrease in organic matter decomposition [19].
Moisture condition is an important factor governing soil C mineralization. Under varying moisture levels, active components in FA exert complex effects in the interaction between microorganisms and soil C. Current research, however, remains insufficient in considering the effects of moisture conditions. The aim of this study is to elucidate the mechanisms by which FA regulates soil C mineralization under varying moisture regimes, integrating analyses of microbial and enzyme activities. Incubation experiments were conducted using agricultural soil as the object under different FA addition rates (0%, 2.5%, 7.5%, and 15%) and moisture conditions (40%, 70%, and 100% WHC) to (1) quantify the kinetics of C mineralization; (2) characterize variations in soil properties, enzyme activities, and microbial community structure; and (3) assess the effects of FA addition on soil C dynamics. The findings will provide critical insights into the role of FA in soil management and its impact on soil C cycling in agriculture ecosystems.

2. Materials and Methods

2.1. Soil Collection and Preparation

The soil used in this study was collected from a vegetable cultivation field located in a typical agricultural region of Shaoguan, Guangdong province, China (24°26′48.65″ N, 113°47′46.84″ E). Characterized as Ferralsol with a sandy clay loam texture, the sampling site experiences a mean annual temperature of 21.1 °C and receives 1580 mm of average yearly precipitation. Surface soil samples (0–20 cm depth) weighing approximately 30 kg were acquired in August 2024. The field was previously cultivated with ridge gourds but remained fallow for the past year. Undisturbed soil cores were simultaneously collected using cutting rings for bulk density and maximum field water holding capacity measurement. Following field collection, the soil samples were transported back to the laboratory and subjected to air drying at room temperature. Visible root fragments and other coarse particles were manually removed. Then, the dried soil was ground and sieved through a 2 mm nylon screen. The physicochemical properties of the soil, including pH, organic C content and fractions (WSOC and MBC), cation exchange capacity (CEC), and mechanical composition, were analyzed. Soil pH was measured in a 1:2.5 (w/v) suspension/solution in deionized water using an S210 pH meter (Mettler-Toledo International Inc., Columbus, OH, USA). Soil organic C (SOC) content was determined using the dichromate (K2Cr2O7) oxidation method [20]. CEC was determined using the ammonium acetate (NH4OAc) method [21], and the mechanical composition was determined via the pipette method [22]. The basic information of the test soil is presented in Table 1.

2.2. Incubation Experiments

The sieved soil was placed in several trays (approximately 1.0 kg per tray) and incubated in darkness at 25 °C in a constant temperature and humidity chamber. Soil moisture was maintained at 60% WHC for 7 days to stimulate microbial activity. Following incubation, an aliquot of the soil sample equivalent to 100 g of dry weight was transferred into a 1.0 L plastic wide-mouth bottle. Fly ash (sieved through a 2 mm mesh) was incorporated into the soil at application rates of 0%, 2.5%, 7.5%, or 15% (w/w) and thoroughly mixed. The moisture content of the soil was adjusted to 40%, 70%, or 100% of the maximum field water-holding capacity by appropriately drying or adding deionized water. Meanwhile, a bottle with no soil or FA addition was set as a control. Each treatment had three replicates, resulting in a total of 39 samples. The bottles were sealed, weighed, and then incubated in darkness at 25 °C within the constant temperature and humidity chamber. The incubation period lasted 36 days, during which the bottles were regularly weighed and replenished with deionized water to maintain a constant soil moisture content. The coal FA used in this study was obtained from Pannan Power Plant in Guizhou Province, China. The properties of the FA are presented in Table 2.

2.3. Soil C Mineralization Monitoring

The mineralization capacity of the incubated soil was determined using the HCl titration method [23]. Prior to the incubation experiment, a small beaker containing 15 mL of freshly prepared 0.1 M NaOH was placed at the bottom of each bottle. The bottles were then capped, tightened, and sealed with adhesive tape. At predetermined intervals (days 1, 4, 7, 10, 15, 20, 25, 30, and 36), the bottles were removed from the constant temperature incubator. The cap was carefully opened, and the CO2-adsorbed solution in the small beaker was transferred into a 250 mL conical flask. The beaker was thoroughly rinsed with deionized water, and the rinse water was collected in the same flask. Subsequently, 2 mL of 1.0 M BaCl2 and a few drops of phenolphthalein indicator were added to the flask. The solution was then titrated with 0.05 M HCl standard solution until the endpoint (color change from red to colorless) was reached. The volume of HCl consumed (V) was recorded. The volume for the control treatment was recorded as V0. After removing the small beakers, the incubation bottles were vented for two hours to exchange air. A new beaker containing NaOH was placed in each bottle, and the bottles were resealed to continued incubation.
The formula for calculating soil CO2 release is as follows:
C i = [ ( V 0 V 1 ) ( V 0 V 2 ) ] × 0.05 × 12 2
where Ci represents the amount of soil CO2-C released during the i-th titration (mg); V0 is the volume of NaOH added prior to incubation (mL); V1 is the volume of HCl consumed in titrating the NaOH solution from the incubated soil (mL); V2 is the volume of HCl consumed in the control treatment; and 12 represents the atomic mass of C (g mol−1).
The C mineralization capacity was calculated as
M i = C i m × d
where Mi represents the minimization capacity (mg C kg−1 d−1); m is the mass of soil (0.5 kg); and d is the number of incubation day.
A first-order kinetic equation [24] was applied to describe the variation in soil C mineralization capacity during the incubation experiments:
Ct = C0 (1 − e(−kt))
where Ct is the cumulative amount of C mineralization at incubation time t (mg C g−1); C0 is the potentially mineralizable organic C in the soil (mg C g−1); k is mineralization rate constant (d−1); and t is the incubation time (d).

2.4. WSOC and MBC Measurement

After the incubation experiments, moist soil samples were collected from the bottles for the determination of WSOC and MBC. WOSC was determined by extracting the soil with deionized (DI) water at a 1:5 (w/v) soil-to-water ratio, followed by the analysis of the C concentration in the extract using a TOC analyzer. MBC was determined using the chloroform fumigation extraction method [25]: fresh soil was fumigated with chloroform vapor under vacuum conditions, and then extracted with 40 mL 0.5 M Na2SO4 solution; then, the extract was filtered, and its C concentration was also measured using the TOC analyzer, with MBC calculated as the difference in extractable C between the fumigated and the unfumigated soils. The remaining incubated soil was freeze-dried. The pH and EC of the soil were subsequently measured.

2.5. Enzyme Activity and Microbial Diversity Determination

The activities of four enzymes closely related to soil respiration, including sucrose (SUC), catalase (CAT), β-glucosidase (BG), and cellulose (CEL), were measured in the incubated soils. SUC activity was determined via the 3, 5-dinitrosalicylic acid colorimetry method [26]. CAT activity was determined using the y titration method, as described in [27]. BG activity was assayed using the p-nitrophenol colorimetric method [28]. CEL activity was determined using the nitro salicylic acid colorimetric method [29].
Soil microbial information was entrusted to Shanghai Meiji Biological Technology Company for analysis. The quantities of bacteria and fungi were determined using real-time PCR with an ABI7300 fluorescence quantitative PCR instrument (Applied Biosystems, Waltham, MA, USA). For the measurement of soil bacteria and fungus diversity, total DNA was extracted using the ZNA® Soil DNA kit (Omega Bio-tek, Norcross, GA, USA). The quality of the extracted genomic DNA was evaluated by 1.0% agarose gel electrophoresis. DNA purity and concentration were measured using a NanoDrop2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3-V4 variable region of the 16S rRNA gene. Primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) were used to amplify the ITS region. The PCR reaction system included 4 μL of 5 × TransStart FastPfu buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of upstream and downstream primers, 0.4 μL of TransStart FastPfu DNA polymerase, and 10 ng of DNA template. The amplification procedure was as follows: initial predenaturation at 95 °C for 3 min, 27 cycles for 30 s steps at 95 °C, 55 °C, and 72 °C, respectively; a final extension at 72 °C for 10 min; and, finally, storage at 4 °C (ABI GeneAmp® 9700, Applied Biosystems, Foster City, CA, USA). The PCR products from the same samples were pooled and then recovered for further purification. Subsequently, the purified products were analyzed using 2% agarose gel electrophoresis and quantified using the Quantus™ Fluorometer (Promega, Madison, WI, USA). High-throughput sequencing was performed on the Illumina MiSeq platform using paired-end 300 bp reads (MiSeq PE300, Illumina, San Diego, CA, USA).

2.6. Data Processing

During the analysis of microbial diversity, raw sequence reads were spliced and quality-filtered using Fastp (version 0.20.0) and FLASH (version 1.2.11) software. Operational taxonomic units (OTUs) were clustered at 97% sequence similarity using UPARSE (version 7.1) software. The taxonomy of OTUs was annotated with the RDP classifier against the Ribosomal Database Project (RDP) gene database, applying a confidence threshold of 70%. Finally, the community composition of each sample was quantified at various taxonomic levels.
A two-way ANOVA was performed to compare the difference in soil property indicators (pH, C fractions, and microbial community characteristics) among different treatments (FA addition rate and moisture content). Pearson’s correlation analysis was conducted to examine the correlation between the different indicators (soil properties, enzyme activities, microbial abundance, and total C mineralization amount). A redundancy analysis (RDA) was conducted using CANOCO 5.0 (Microcomputer Inc., USA) to further identify the key factors governing the microbial activity. Statistical analyses and data visualizations were completed using Origin 2021 (Origin Lab Inc., Northampton, MA, USA) and GraphPad Prism 9.0 software (GrahPad Software Inc., San Diego, CA, USA).

3. Results

3.1. Soil C Mineralization Characteristics

Throughout the 36-day incubation period, the soil C mineralization capacity exhibited an overall decreasing trend across all moisture regimes and FA application rates, with fluctuations becoming relatively minor during the latter half (Figure 1a–d). Specifically, in treatments with 0% and 2.5% FA addition, the C mineralization capacity initially increased, reaching peak values on day 7, followed by a continuous decrease. In contrast, treatments with 7.5% and 15% FA exhibited an initial decrease in mineralization capacity, which subsequently increased to peak values on day 7 before gradually decreasing.
The cumulative C mineralization amount also increased rapidly during the early stages of incubation and gradually stabilized in later stages (Figure 1e–h). Except for the treatment with 2.5% FA addition, differences in cumulative mineralization capacity under the three moisture conditions widened progressively throughout the incubation period. Moreover, it can be clearly observed that the cumulative mineralization amount was consistently the lowest under the 40% WHC conditions. The total CO2 release results showed that soil C mineralization activity increased correspondingly with higher FA addition rates (Figure 1i).
Across moisture conditions, total CO2 release generally decreased in the order 70% WHC > 100% WHC > 40% WHC, except for the treatment with 2.5% FA. In the treatment with 2.5% FA, the difference in total CO2 release was minimal; the amount at 100% WHC was 1.07 ± 0.19 times that at 40% WHC. In contrast, the treatment with 7.5% FA showed the greatest difference, with the total CO2 release at 70% WHC being 1.33 ± 0.20 times that at 40% WHC. The variation in the cumulative amount of C mineralization under the different treatments was well described by the first-order kinetic Equation (0.9633 ≥ R2 ≥ 0.9972, p < 0.01; Table 3). The obtained parameters C0 indicated that amount of potential C mineralization in the soil increased with higher FA addition, exhibiting the highest and lowest values at 70% and 40% WHC, respectively.

3.2. Variation in pH, EC, WSOC, and MBC

The addition of FA significantly altered the soil pH. As shown in Figure 2a, increasing the FA application rate from 0% to 15% resulted in a gradual increase in soil pH from 5.02 ± 0.10 to 5.89 ± 0.14. Moreover, soil pH also increased significantly with higher moisture content. Similarly, EC generally increased with higher FA application rate. However, at equivalent FA addition levels, the EC values were relatively higher under the 70% WHC condition than those under the 40% and the 100% WHC conditions, except at the 7.5% FA application rate (Figure 2b). WSOC exhibited a trend very similar to that of pH (Figure 2c): both elevated FA application rate and higher soil moisture levels significantly enhanced the dissolved organic C content in the soil. Across all moisture conditions, MBC initially decreased and then increased with increasing FA application rate (Figure 2d). Similar to EC, MBC was also generally higher under the 70% WHC condition compared to the 40% and 100% WHC conditions.

3.3. Enzyme Activit and Microbial Quantity and Diversity

The addition of FA significantly (p < 0.05) increased the activity of BG in the soil at 40% WHC and 70% WHC (Figure 3a), whereas no significant (p > 0.05) effect was observed at 100% WHC. Except for the 7.5% FA addition rate treatment, BG activity under the different moisture conditions followed the order 70% WHC > 40% WHC > 100% WHC. CAT activity also increased to some extent as a result of FA addition and was relatively higher at 70% WHC (Figure 3b). SUC activity was relatively higher at 2.5% and 15% FA under 40%WHC conditions but significantly (p < 0.05) decreased in the 2.5% FA +100% WHC treatment (Figure 3c). CEL activity was relatively higher at 7.5% and 15% FA; but was significantly (p < 0.05) lower at 2.5% FA under the 40% and 70% WHC conditions (Figure 3d).
Under all three moisture conditions, bacterial abundance initially decreased and then increased as the FA application rate rose (Figure 4a), with the highest abundance observed at the 15% FA rate compared to the other rates. At FA application rates of 0% and 2.5%, bacterial abundance under 100% WHC conditions was relatively lower than under the other moisture conditions. In contrast, at FA application rates of 7.5% and 15%, bacterial abundance under 100% WHC conditions was higher than under the other moisture conditions. At 40% and 70% WHC, fungal abundance did not significantly differ with varying FA application rates (p > 0.05). However, at 100% WHC, fungal abundance increased with increasing FA application rate, reaching a peak at the 15% application rate (Figure 4b).
As shown in Figure 4c, the dominant bacterial phyla in the soils subjected to different treatments were Bacillota, Chlorflexota, Pseudomonadota, Acidobacteriota, and Actionomycetota, which collectively accounted for 78.35–81.73% of the total bacterial abundance. Furthermore, no regular influence of moisture conditions and FA on different bacteria phyla was observed. The dominant fungal phyla were Ascomycota, Basidiomycota, unclassified_k_F, Chytridiomycota, and Mortierellomycota, which collectively accounted for 98.94% to 99.78% of the total fungal abundance (Figure 4d). In treatments with FA addition (2.5%, 7.5% and 15%), the relative abundance of Ascomycota generally decreased with increasing moisture content, while the relative abundance of Basidiomycota exhibited an overall increasing trend across different treatments.

3.4. Relationship Between CO2 Release and Soil Properties

The correlation analysis results (Figure 5) showed that the total C mineralization amount exhibited a highly significantly (p < 0.01) positive correlation with FA application rate, pH, WSOC, and CEL, and a significantly (p < 0.05) positive correlation with soil moisture content (SMC), bacterial abundance, fungal abundance, and EC. Bacterial abundance exhibited a highly significantly (p < 0.01) positive correlation with FA application rate, pH, EC, WSOC, MBC, CEL, and fungal abundance. Fungal abundance exhibited a highly significant (p < 0.01) positive correlation with FA application rate, pH, and WSOC, and a significantly (p < 0.05) positive correlation with CAT. BG exhibited a highly significant (p < 0.01) positive correlation with EC and MBC, a significantly (p < 0.05) positive correlation with FA application rate, and a significantly (p < 0.05) negative correlation with SMC. CEL exhibited a highly significant (p < 0.01) positive correlation with FA addition rate, pH, WSOC, and MBC, and a significantly (p < 0.05) positive correlation with EC. MBC exhibited a highly significant (p < 0.01) positive correlation with FA application rate and EC, and a significantly (p < 0.05) positive correlation with pH. pH exhibited a highly significantly (p < 0.01) positive correlation with FA application rate and EC.
The results from the redundancy analysis revealed that the bacterial diversity was closely related to SMC and CEL, which could collectively explain 19.5% of the total variance, and fungal diversity was closely related to SMC and WSOC, which could collectively explain 14.4% of the total variance (Figure 6a,b). The total C mineralization amount had a relatively high correlation with bacterial phyla, including Acidobacteriota, Gemmatimonadota, Pseudomonadota, Actinomycetal, and others; and with fungal phyla, including Chytridiomycota, Glomerom, and Olpidiom. The bacterial phyla exhibiting a stronger correlation with moisture content, including Patescibacteria and Gemmatimonadota, while the fungal phyla included Aphelidiomycota, Blastocladiomycota and Unclassified taxa. The bacterial phyla exhibiting a stronger correlation with FA application rate included Planctomycetes, Myxococcota, and Bacillota, while the fungal phyla included Unclassified taxa, Chytridi, and Glomerom.

4. Discussion

4.1. Soil C Mineralization Characteristics and the Influence of Fly Ash Addition

The decomposition of soil organic matter during mineralization incubation experiments typically follows a staged kinetic pattern. In the initial decomposition phase, labile C pools, such as dissolved monosaccharides and proteins, are rapidly consumed. Subsequently, the process shifts toward the more recalcitrant C pools, including lignin and humic substances. Moreover, the composition and metabolic activities of microbial communities dynamically adjust in response to substrate types. For instance, the mineralization of labile C in the initial stages is predominantly driven by bacteria, whereas fungi and other microorganisms become dominant the later stages by decomposing more recalcitrant substrates with relatively lower metabolic efficiency. Previous studies have demonstrated that mineralization rates often peak within the first several days of incubation [30,31]. In the present study, the soil C mineralization rate generally reached its maximum on the 7th day, except for the treatment with 15% FA (Figure 1d). The initial decrease in the C mineralization rate following the addition of high concentrations of FA might be attributed to the inhibitory effects of the abrupt soil pH shifts and the elevated cation and anion concentrations on microbial activity. Furthermore, FA particles might provide a protective effect on soil labile organic C, resulting in reduced substrate availability for mineralization in the short term [19]. The extent of the inhibitory effects on C mineralization depended on the amount of FA added, and microbial activity appeared to overcome this limitation within the initial incubation days.
Compared to the control treatment, FA addition significantly enhanced the C mineralization capacity of soil. This effect, reflected by the increasing cumulative C mineralization with higher FA amendment levels (Figure 1i), stemmed from several mechanisms. Firstly, FA itself contained a certain amount of soluble organic C (17.9 mg kg−1), and its inherent porosity and granular structure improved soil aeration, facilitating the survival and proliferation of soil microorganisms, thereby promoting the microbial decomposition and mineralization of organic C. Secondly, FA addition led to an increase in soil pH, which was beneficial for the proliferation of efficient decomposing bacteria and the dissolution of previously adsorbed or complexed organic matter. Finally, FA supplied microorganisms with readily available nutrients, including minerals (e.g., K, P, and Ca) and trace elements (e.g., Fe, Mn, B, and Mo). This supplementation alleviated potential nutrient and micronutrient limitations in the soil, activating key microbial enzymes, particularly bacteria enzymes such as dehydrogenase and β-glucosidase [32,33].
The extent to which FA affects soil C mineralization is largely depends on the application amount. Numerous studies have shown that low levels of FA applications can enhance soil microbial activity and C mineralization, whereas high application rate commonly exerted inhibitory effects. For instance, Pati and Sahu [32] reported that soil respiration and microbial activities were not suppressed at levels of up to 2.5% FA amendment compared to the control (0%), but decreased significantly with 10% and 20% FA treatment. Wong and Wong [34] found that FA application at the 12% rate seriously inhibited soil microbial activity. Saidy et al. [16] observed that the application of coal FA at low levels (≤25 Mg ha−1) significantly increased both C mineralization and MBC, recommending that applications rates of V should not exceed 10% to avoid inhibitory effects. The negative effects of FA were considered to stem from the release of toxic components (e.g., heavy metals) and soluble salts within the ash reaching critical threshold concentrations, or from the stabilization of organic C by oxides (e.g., amorphous Fe/Al oxides) present in FA [35]. However, such inhibitory effects were not observed in this study. Conversely, all FA application rates (2.5%, 7.5%, and 15%) promoted C mineralization, and both MBC and C mineralization intensity exhibited a highly significant positive correlation with FA application rate. This indicates that the application rate had not yet reached a threshold of negative impact under the experimental conditions.

4.2. Influence of Moisture Conditions on C Mineralization

Moisture conditions are critical environmental factor regulating the rate of soil C mineralization [36]. Soil respiration typically displays a unimodal relationship with soil moisture content: both excessively high and low soil moisture levels inhibit soil microbial activity, consequently limiting C mineralization. When the soil moisture content is maintained within approximately 60–80% WHC, an optimal balance between soil aeration and water availability is achieved, leading to the highest rates of C mineralization [37]. Our results are consistent with this pattern, showing that the greatest amount of C mineralization and MBC content occurred at 70% WHC across all the FA addition rates. Although the WSOC content increased obviously with higher soil moisture (Figure 2b), the lower C mineralization at 100% WHC likely reflected oxygen diffusion limitations caused by soil water saturation. The addition of FA further promoted the dissolution of WSOC at 100% WHC, but did not alter the overall influence of moisture conditions on the amount of mineralization, also suggesting that substrate availability was not a major limiting factor at high WHC.

4.3. Influence on Enzyme Activities

In the soil system, soil enzymes play a key biochemical role in the decomposition of organic matter. Among the four enzymes examined, BG and CEL exhibited more pronounced responses to the addition of FA. Elements such as Ca, Mn, and Fe present in FA can stimulate enzyme activity to some extent [33]. Additionally, changes in soil pH also influenced enzyme activity. The highly significant relationships between CEL activity and variables including FA application rate, pH, WSOC, and MBC indicate that CEL played a critical role in the decomposition of organic matter at the final stage of the incubation experiments. Although MBC only correlated with BG (p < 0.01), the activities of BG, CAT and CEL were relatively higher at 70% WHC compared to 40% and 100% WHC (Figure 3a,b). BG demonstrates a relatively broad optimal moisture range, with peak activity under moist conditions. A low soil water content can lead to the accumulation of reactive oxygen species (ROS), necessitating enhanced CAT activity by microbes for self-protection. Conversely, overly high moisture levels may create anaerobic environments that decrease hydrogen peroxide (H2O2) production, thereby reducing CAT activity. CEL activity primarily depends on root exudates and labile C sources; the weaker regularity of CEL activity might be explained by the absence of fresh plant residues in the incubation experiments [32,37].

4.4. Relationship Between Microbial Quantity and C Mineralization

Microorganisms, including bacteria and fungi, are the primary agents responsible for soil carbon mineralization [38]. The changes in microbial activity are often reflected in the corresponding variations in microbial biomass. Our results showed that MBC was significantly correlated with C mineralization (p < 0.05), indicating the contribution of microbial activity to soil C mineralization. However, this correlation was limited and could not fully explain the observed variations. The limitation was likely because microbial-mediated organic C mineralization not only depended on microbial biomass, but was also more critically regulated by the functional diversity and community structure of microbial assemblages [39].
Different types of microorganisms exhibit distinct responses to variations in moisture and FA content. The response of bacterial abundance to FA application rate closely resembled that of MBC, with both showing an initial decline followed by an increase (Figure 2d and Figure 4a). In contrast, fungal abundance varied less markedly across environmental conditions (Figure 4b). In the short term, bacteria responded more sensitively to FA and predominantly drove C mineralization, particularly when substrate availability (e.g., dissolvable organic C) was relatively abundant. Bacterial abundance showed more significant correlation (p < 0.01) with C mineralization compared to fungal abundance (p < 0.05), suggesting that bacteria dominated C mineralization in the soil. The fungal response to FA might not be significant in the short term but could increase over the long term due to shifts in the type of organic matter sources. Schutter and Fuhrmann [40] reported that, after a relatively long-term period (20 months), FA amendments benefited fungi and Gram-negative bacteria more than other components of the soil microbial community. Under high FA amendment (7.5% and 15%), bacterial and fungal abundances were relatively higher at 100% WHC compared to the other moisture levels. Although 100% WHC is generally not considered optimal for microbial proliferation, the elevated FA proportions significantly increased the concentrations of WSOC and soil pH (p < 0.01), potentially creating more favorable conditions for microbial growth.

4.5. Relationship Between Bacterial Community Characteristics and C Mineralization

Bacteria phyla, including Acidobacteriota, Gemmatimonadota, Pseudomonadota, and Actinomycetota, along with fungal phyla such as Chytridiomycota, Glomeromycota, and Olpidiomycota, exhibited stronger correlations with total C mineralization amount, suggesting their potentially dominant roles in organic matter degradation during the late stages of the incubation experiment. These microorganisms are widely recognized for their capacity to decompose recalcitrant organic substrates [41,42]. Although the impacts of FA amendment and moisture variation on the microbial community structure were not overtly apparent (Figure 4c,d), the differing correlations between bacterial and fungal phyla and environmental variables reflect their distinct responses to environmental changes. Patescibacteria and Gemmatimonadota within the bacterial phyla, as well as Aphelidiomycota, Blastocladiomycota, and unclassified groups within the fungal phyla, exhibited greater sensitivity to changes in moisture conditions. Most of these microorganisms exhibit high dependency on soil moisture and prefer environments with elevated humidity levels, except for Gemmatimonadota, which tend to proliferate under arid conditions. Fly ash amendment exerted more prominent effects on bacterial phyla such as Planctomycetes, Myxococcota, and Bacillota and fungal phyla including Chytridiomycota. Certain phyla showed marked responses to pH fluctuations induced by FA amendment; for example, Planctomycetes and Myxococcota prefer neutral to alkaline environments, while Bacillot favors acidic environments. Soil pH variations significantly influence their survival strategies. Overall, bacterial communities were more sensitive to FA amendment, whereas fungal communities respond more strongly to moisture variations. This differential adaptive strategy collectively explains the complexity of C mineralization dynamics.

4.6. Benefits and Potential Risk Analysis

The results of incubation experiments demonstrated that the short-term addition of FA significantly increased soil C mineralization intensity, particularly under optimal moisture conditions. This suggests that FA application may be detrimental to C sequestration in agricultural soils. It should be noted that this study did not involve plant cultivation. Fly ash application significantly improves soil conditions, including pore structure, nutrient content, and microbial activity. In the long term, these improvements may facilitate crop growth and increase the input of plant-derived C (e.g., via litter and root systems) into the soil, thereby enhancing soil C sequestration capacity. This promising effect thus warrants further investigation. Another notable point relates to the harmful substances present in the FA. According to the Soil Environmental Quality-Risk Control Standard for Soil Contamination of Agricultural Land (trial) [43], issued by the Ministry of Ecology and Environment of the People’s Republic of China, the concentrations of heavy metals in the FA used in this study were all below the corresponding risk screening values for agricultural soils. This indicates that the application of FA to agricultural soils poses a relatively low risk to product quality and safety, crop growth, and soil environment, which can be considered negligible. However, this conclusion is only applicable to the specific FA samples used in this study and does not imply that all FA from various sources is equally safe. In practical applications, it remains essential to determine the concentrations of heavy metals and other pollutants in FA and to conduct a comprehensive risk assessment accordingly. Furthermore, the field environment is far more complex than the laboratory incubation used in this study. Therefore, field experiments are necessary to further assess the benefits and risks of FA application in real agricultural practices.

5. Conclusions

Incubation experiments were conducted to evaluate the effects of FA addition and moisture regimes on the mineralization of C in an acidic agricultural soil. Maximum C mineralization was observed under the conditions of 15% FA and 70% WHC. Mineralization was suppressed at 100% WHC due to oxygen diffusion limitations, despite FA further increasing WSOC content at this moisture level. BG and CEL activities showed more pronounced responses to the addition of FA and were relatively higher at 70% WHC. Bacterial communities exhibited greater sensitivity to FA amendment, whereas fungal communities responded more strongly to variations in moisture. This study did not examine the dynamic changes in soil C properties and microbial community structure following FA addition. Future research should delve deeper into these process characteristics to further elucidate the mechanisms by which FA influences soil C dynamics.

Author Contributions

Conceptualization, X.J. and B.H.; methodology, H.J.; software, X.Z.; validation, D.M. and J.C.; investigation, M.R. and H.J.; resources, M.R.; data curation, M.R. and H.J.; writing—original draft preparation, M.R.; writing—review and editing, X.J. and B.H.; visualization, Z.Y. and H.J.; supervision, J.C.; funding acquisition, X.J. and B.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Guangdong Basic and Applied Basic Research Foundation (Grant No. 2025A1515010758), the Guangdong Foundation for Program of Science and Technology Research (Grant No. 2023B1212060044), and the National Natural Science Foundation of China (No. 42177343 and No.42577403).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

Authors Mumin Rao, Xiangbo Zou, and Dequn Ma were employed by the company Guangdong Energy Group Science and Technology Research Institute Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Millati, R.; Cahyono, R.B.; Ariyanto, T.; Azzahrani, I.N.; Putri, R.U.; Taherzadeh, M.J. Chapter 1—Agricultural, Industrial, Municipal, and Forest Wastes: An Overview. In Sustainable Resource Recovery and Zero Waste Approaches; Taherzadeh, M.J., Bolton, K., Wong, J., Pandey, A., Eds.; Elsevier: Amsterdam, The Netherlands, 2019; pp. 1–22. ISBN 978-0-444-64200-4. [Google Scholar]
  2. Lehmann, J.; Rilig, M.C.; Thies, J.; Masiello, C.A.; Hockaday, W.C.; Crowley, D. Biochar effects on soil biota—A review. Soil Biol. Biochem. 2011, 43, 1812–1836. [Google Scholar] [CrossRef] [Scilit]
  3. Saadaoui, E.; Ghazel, N.; Ben Romdhane, C.; Massoudi, N. Phosphogypsum: Potential uses and problems—A review. Int. J. Environ. Stud. 2017, 74, 558–567. [Google Scholar] [CrossRef] [Scilit]
  4. Kumar, A.; Chopra, A.K.; Kumar, V. A Review on sewage sludge (biosolids) a resource for sustainable agriculture. Arch. Agric. Environ. Sci. 2017, 2, 340–347. [Google Scholar] [CrossRef] [Scilit]
  5. Basu, M.; Pande, M.; Bhadoria, P.; Mahapatra, S. Potential fly-ash utilization in agriculture: A global review. Prog. Nat. Sci. 2009, 19, 1173–1186. [Google Scholar] [CrossRef] [Scilit]
  6. Cristelo, N.; Glendinning, S.; Fernandes, L.; Pinto, A.T. Effects of alkaline-activated fly ash and Portland cement on soft soil stabilisation. Acta Geotech. 2013, 8, 395–405. [Google Scholar] [CrossRef] [Scilit]
  7. Liu, H.B.; Liu, Z.L. Recycling utilization patterns of coal mining waste in China. Resour. Conserv. Recycl. 2010, 54, 1331–1340. [Google Scholar] [CrossRef] [Scilit]
  8. Zacco, A.; Borgese, L.; Gianoncelli, A.; Struis, R.P.; Depero, L.E.; Bontempi, E. Review of fly ash inertisation treatments and recycling. Environ. Chem. Lett. 2014, 12, 153–175. [Google Scholar] [CrossRef] [Scilit]
  9. Usman, M.; Anastopoulos, I.; Hamid, Y.; Wakeel, A. Recent trends in the use of fly ash for the adsorption of pollutants in contaminated wastewater and soils: Effects on soil quality and plant growth. Environ. Sci. Pollut. Res. 2023, 30, 124427–124446. [Google Scholar] [CrossRef] [Scilit]
  10. He, H.H.; Dong, Z.G.; Peng, Q.; Wang, X.; Fan, C.B.; Zhang, X.C. Impacts of coal fly ash on plant growth and accumulation of essential nutrients and trace elements by alfalfa (Medicago sativa) grown in a loessial soil. J. Environ. Manag. 2017, 197, 428–439. [Google Scholar] [CrossRef] [Scilit]
  11. Le, T.V.; Ngo, C.N.T.; Futamata, H. Effect of fly ash amendment on sandy soil properties and peanut yields. Sci. Asia. 2021, 47, 357–365. [Google Scholar] [CrossRef] [Scilit]
  12. Liu, C.; Wang, L.; Yin, J.; Qi, L.; Feng, Y. Combined amendments of nano-hydroxyapatite immobilized cadmium in contaminated soil-potato (Solanum tuberosum L.) system. Bull. Environ. Contam. Toxicol. 2018, 100, 581–587. [Google Scholar] [CrossRef] [Scilit]
  13. Du, Y.J.; Wei, M.L.; Reddy, K.R.; Liu, Z.P.; Jin, F. Effect of acid rain pH on leaching behavior of cement stabilized lead-contaminated soil. J. Hazard. Mater. 2014, 271, 131–140. [Google Scholar] [CrossRef] [Scilit]
  14. Komonweeraket, K.; Cetin, B.; Aydilek, A.H.; Benson, C.H.; Edil, T.B. Effects of pH on the leaching mechanisms of elements from fly ash mixed soils. Fuel 2015, 140, 788–802. [Google Scholar] [CrossRef] [Scilit]
  15. Nayak, A.K.; Raja, R.; Rao, K.S.; Shukla, A.K.; Mohanty, S.; Shahid, M.; Tripathi, R.; Panda, B.B.; Bhattacharyya, P.; Kumar, A.; et al. Effect of fly ash application on soil microbial response and heavy metal accumulation in soil and rice plant. Ecotoxicol. Environ. Saf. 2015, 114, 257–262. [Google Scholar] [CrossRef] [Scilit]
  16. Saidy, A.R.; Hayati, A.; Septiana, M. Different effects of ash application on the carbon mineralization and microbial biomass carbon of reclaimed mining soils. J. Soil Sci. Plant Nutr. 2020, 20, 1001–1012. [Google Scholar] [CrossRef] [Scilit]
  17. Pandey, V.C.; Singh, N. Impact of fly ash incorporation in soil systems. Agric. Ecosyst. Environ. 2010, 136, 16–27. [Google Scholar] [CrossRef] [Scilit]
  18. Usmani, Z.; Kumar, V.; Gupta, P.; Gupta, G.; Rani, R.; Chandra, A. Enhanced soil fertility, plant growth promotion and microbial enzymatic activities of vermicomposted fly ash. Sci. Rep. 2019, 9, 10455. [Google Scholar] [CrossRef] [Scilit]
  19. Jambhulkar, H.P.; Shaikh, S.M.S.; Kumar, M.S. Fly ash toxicity, emerging issues and possible implications for its exploitation in agriculture; Indian scenario: A review. Chemosphere 2018, 3, 333–344. [Google Scholar] [CrossRef] [Scilit]
  20. Nelson, D.W.; Sommers, L.E. Total carbon, organic carbon and organic matter. In Methods of Soil Analysis, Part 3, Chemical Methods; Soil Science Society of America Book Series; Sparks, D.L., Page, A.L., Helmke, P.A., Loeppert, R.H., Eds.; Soil Science Society of America: Madison, WI, USA, 2001; pp. 961–1010. [Google Scholar]
  21. Pansu, M.; Gautheyrou, J. Handbook of Soil Analysis: Mineralogical, Organic and Inorganic Methods; Springer Science & Business Media: Berlin, Germany, 2007. [Google Scholar]
  22. Klute, A.; Page, A.L. Methods of Soil Analysis. In Part 1. Physical and Mineralogical Methods; Part 2. Chemical and Microbiological Properties; American Society of Agronomy, Inc.: Madison, WI, USA, 1986. [Google Scholar]
  23. Angers, D.A.; Recous, S. Decomposition of wheat straw and rye residues as affected by particle size. Plant Soil 1997, 189, 197–203. [Google Scholar] [CrossRef] [Scilit]
  24. Stanford, G.; Smith, S. Nitrogen mineralization potentials of soils. Soil Sci. Soc. Am. J. 1972, 3, 465–472. [Google Scholar] [CrossRef] [Scilit]
  25. Vance, E.D.; Brookes, P.C.; Jenkinson, D.S. An extraction method for measuring soil microbial biomass C. Soil Biol. Biochem. 1987, 19, 703–707. [Google Scholar] [CrossRef] [Scilit]
  26. Guan, S. Soil Enzymes and Its Research Methods; Agriculture Press: Beijing, China, 1986. (In Chinese) [Google Scholar]
  27. Kumar, M.; Yadav, V.; Tuteja, N.; Johri, A.K. Antioxidant enzyme activities in maize plants colonized with Piriformospora indica. Microbiology 2009, 155, 780–790. [Google Scholar] [CrossRef] [Scilit]
  28. Krämer, S.; Green, D.M. Acid and alkaline phosphatase dynamics and their relationship to soil microclimate in a semiarid woodland. Soil Biol. Biochem. 2000, 32, 179–188. [Google Scholar] [CrossRef] [Scilit]
  29. Ma, C.; Chen, X.Y.; Zheng, G.D.; Liu, N.; Zhao, J.H.; Zhang, H.Z. Exploring the influence mechanisms of polystyrene-microplastics on sewage sludge composting. Bioresour. Technol. 2022, 362, 127798. [Google Scholar] [CrossRef] [Scilit]
  30. Tian, Q.; Wang, X.; Wang, D.; Wang, M.; Liao, C.; Yang, X.; Liu, F. Decoupled linkage between soil carbon and nitrogen mineralization among soil depths in a subtropical mixed forest. Soil Biol. Biochem. 2017, 109, 135–144. [Google Scholar] [CrossRef] [Scilit]
  31. Zhang, H.; Yang, X.; Zhu, L.; Ahmed, N.; Gao, Y. Laboratory investigation on the effects of root-secreted organic acids on carbon and nitrogen mineralization in alpine soils caused by invasive shrubs. J. Environ. Chem. Eng. 2025, 13, 117271. [Google Scholar] [CrossRef] [Scilit]
  32. Pati, S.S.; Sahu, S.K. CO2 evolution and enzyme activities (dehydrogenase, protease and amylase) of fly ash amended soil in the presence and absence of earthworms (Drawida willsi Michaelsen) under laboratory conditions. Geoderma 2004, 118, 289–301. [Google Scholar] [CrossRef] [Scilit]
  33. Singh, R.P.; Sharma, B.; Sarkar, A.; Sengupta, C.; Singh, P.; Ibrahim, M.H. Biological responses of agricultural soils to fly-ash amendment. Rev. Environ. Contam. Toxicol. 2014, 232, 45–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Wong, M.H.; Wong, J. Effects of fly ash on soil microbial activity. Enviro. Pollut. Ser. A Ecol. Biol. 1986, 40, 127–144. [Google Scholar] [CrossRef] [Scilit]
  35. Lim, S.S.; Choi, W.J. Changes in microbial biomass, CH4 and CO2 emissions, and soil carbon content by fly ash co-applied with organic inputs with contrasting substrate quality under changing water regimes. Soil Biol. Biochem. 2014, 68, 494–502. [Google Scholar] [CrossRef] [Scilit]
  36. Curtin, D.; Beare, M.H.; Hernandez-Ramirez, G. Temperature and moisture effects on microbial biomass and soil organic matter mineralization. Soil Sci. Soc. Am. J. 2012, 76, 2055–2067. [Google Scholar] [CrossRef] [Scilit]
  37. Yeledhalli, N.; Prakash, S.; Gurumurthy, S.; Ravi, M. Coal fly ash as modifier of physico-chemical and biological properties of soil. Karn. J. Agric. Sci. 2007, 20, 531–534. [Google Scholar]
  38. Kudeyarov, V.N. Soil respiration and carbon sequestration: A review. Euras. Soil Sci. 2023, 56, 1191–1200. [Google Scholar] [CrossRef] [Scilit]
  39. Fang, H.; Dong, B.; Yan, H.; Tang, F.; Wang, B.; Yu, Y. Effect of vegetation of transgenic Bt rice lines and their straw amendment on soil enzymes, respiration, functional diversity and community structure of soil microorganisms under field conditions. J. Environ. Sci. 2012, 24, 1259–1270. [Google Scholar] [CrossRef] [Scilit]
  40. Schutter, M.; Fuhrmann, J. Soil microbial community responses to fly ash amendment as revealed by analyses of whole soils and bacterial isolates. Soil Biol. Biochem. 2001, 33, 1947–1958. [Google Scholar] [CrossRef] [Scilit]
  41. Peng, Y.; Yan, Y.; Fan, Z.; Shi, J.; Huo, C.; Zhang, Z.; Wang, X. Microbial associations with soil organic carbon pool composition and stabilization in eroding landscapes. CATENA 2025, 258, 109302. [Google Scholar] [CrossRef] [Scilit]
  42. Tang, J.; Liu, E.; Li, Y.; Tang, Y.; Tian, Y.; Du, S.; Li, H.; Wan, L.; Zhang, Q. Afforestation promotes soil organic carbon and soil microbial residual carbon accrual in a seasonally flooded marshland. Forests 2024, 15, 1542. [Google Scholar] [CrossRef] [Scilit]
  43. GB 1561-2018; Soil Environment Quality Risk Control Standard for Soil Contamination of Agriculture Land. Ministry of Environmental Protection of the People’s Republic of China: Beijing, China, 2018. Available online: https://www.mee.gov.cn/ywgz/fgbz/bz/bzwb/trhj/201807/t20180703_446029.shtml (accessed on 26 September 2025).
Figure 1. Soil C mineralization dynamics under different soil moisture and FA addition conditions (0%, 2.5%, 7.5%, and15% FA): mineralization rates (ad); cumulative mineralization (eh); and total mineralized C amount (i). Different capital letters represent significant differences among the indicators at the same WHC at different FA addition conditions; Different lowercase letters represent significant differences among the indicators at the same FA addition at different WHC (same for figures below).
Figure 1. Soil C mineralization dynamics under different soil moisture and FA addition conditions (0%, 2.5%, 7.5%, and15% FA): mineralization rates (ad); cumulative mineralization (eh); and total mineralized C amount (i). Different capital letters represent significant differences among the indicators at the same WHC at different FA addition conditions; Different lowercase letters represent significant differences among the indicators at the same FA addition at different WHC (same for figures below).
Water 17 02912 g001
Figure 2. pH (a), EC (b), WSOC (c), and MBC (d) of the incubated soil.
Figure 2. pH (a), EC (b), WSOC (c), and MBC (d) of the incubated soil.
Water 17 02912 g002
Figure 3. BG (a), CAT (b), SUC (c), and CEL (d) activities in the incubated soil.
Figure 3. BG (a), CAT (b), SUC (c), and CEL (d) activities in the incubated soil.
Water 17 02912 g003
Figure 4. Absolute abundance and diversity of bacteria (a,c) and fungi (b,d).
Figure 4. Absolute abundance and diversity of bacteria (a,c) and fungi (b,d).
Water 17 02912 g004
Figure 5. Correlation between C mineralization and environmental factors (BA: bacterial abundance, FA: fungal abundance, TCM: total C mineralization).
Figure 5. Correlation between C mineralization and environmental factors (BA: bacterial abundance, FA: fungal abundance, TCM: total C mineralization).
Water 17 02912 g005
Figure 6. Redundancy analysis of the relationship between bacterial (a) and fungal (b) diversity and influencing factors.
Figure 6. Redundancy analysis of the relationship between bacterial (a) and fungal (b) diversity and influencing factors.
Water 17 02912 g006
Table 1. Physicochemical properties of the sampled soil.
Table 1. Physicochemical properties of the sampled soil.
pH(H2O)SBD
g cm−3
CEC
(cmol(+) kg−1)
TOC
g kg−1
WSOC
mg kg−1
MBC
mg kg−1
Mechanical Composition (%)
2–0.02 mm0.02–0.002 mm<0.002 mm
5.091.457.9713.1237.17236.7962.8514.2722.88
Notes: SBD: soil bulk density; CEC: cation exchange capacity; TOC: total organic carbon; WSOC: water- soluble carbon; MBC: microbial biomass carbon.
Table 2. Chemical properties of the fly ash.
Table 2. Chemical properties of the fly ash.
pH(H2O)WSOC
mg kg−1
TN
g kg−1
TP
g kg−1
TK
g kg−1
Fe
g kg−1
Mn
g kg−1
Ca
g kg−1
Mg
g kg−1
S
g kg−1
8.0217.90.030.346.23.630.19158.09.3447.18
B
mg kg1
Mo
mg kg−1
Na
g kg1
Cu
mg kg−1
Pb
mg kg−1
Zn
mg kg−1
Cd
mg kg−1
Cr
mg kg1
As
mg kg1
Hg
mg kg1
77.71.623.6362.011.073.00.2560.06.010.16
Notes: WSOC: water-soluble carbon; TN: total nitrogen; TP: total phosphorus; TK: total potassium.
Table 3. Parameters calculated from the first-order kinetic equation.
Table 3. Parameters calculated from the first-order kinetic equation.
Fly Ash
Application Rate
Moisture
Condition
C0kR2p
0%40% WHC13.850.0540.9966<0.01
70% WHC18.700.0410.9960<0.01
100%WHC15.400.0530.9972<0.01
2.5%40% WHC15.420.0580.9964<0.01
70% WHC17.130.0500.9961<0.01
100% WHC15.310.0720.9934<0.01
7.5%40% WHC13.590.0720.9933<0.01
70% WHC18.990.0580.9953<0.01
100%WHC17.740.0640.9887<0.01
15%40% WHC16.180.0810.9877<0.01
70% WHC18.560.0790.9822<0.01
100%WHC17.630.0910.9633<0.01
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rao, M.; Jiang, H.; Zou, X.; Ma, D.; Cheng, J.; Jiang, X.; Yuan, Z.; Huang, B. Effects of Coal Fly Ash Addition on the Carbon Mineralization of Agricultural Soil Under Different Moisture Conditions. Water 2025, 17, 2912. https://doi.org/10.3390/w17192912

AMA Style

Rao M, Jiang H, Zou X, Ma D, Cheng J, Jiang X, Yuan Z, Huang B. Effects of Coal Fly Ash Addition on the Carbon Mineralization of Agricultural Soil Under Different Moisture Conditions. Water. 2025; 17(19):2912. https://doi.org/10.3390/w17192912

Chicago/Turabian Style

Rao, Mumin, Heng Jiang, Xiangbo Zou, Dequn Ma, Jiong Cheng, Xinyu Jiang, Zaijian Yuan, and Bin Huang. 2025. "Effects of Coal Fly Ash Addition on the Carbon Mineralization of Agricultural Soil Under Different Moisture Conditions" Water 17, no. 19: 2912. https://doi.org/10.3390/w17192912

APA Style

Rao, M., Jiang, H., Zou, X., Ma, D., Cheng, J., Jiang, X., Yuan, Z., & Huang, B. (2025). Effects of Coal Fly Ash Addition on the Carbon Mineralization of Agricultural Soil Under Different Moisture Conditions. Water, 17(19), 2912. https://doi.org/10.3390/w17192912

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop