Next Article in Journal
Clinical and Genetic Characteristics of Senior-Loken Syndrome Patients in Korea
Previous Article in Journal
Patchy Phylogenetic Distribution and Poor Translational Adaptation of a Nested ORF in the Mammalian Mitochondrial cytb Gene
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 7
10.3390/genes16070834
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genomic Features and Tissue Expression Profiles of the Tyrosinase Gene Family in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)

by
Yanchao Liu
1,2,†,
Pan Liu
2,†,
Tong Ren
3,
Yang Gao
1,
Ziman Wang
4,
Junxian Zhu
2,
Chen Chen
2,
Liqin Ji
2,
Xiaoyou Hong
2,
Xiaoli Liu
2,
Chengqing Wei
2,
Xinping Zhu
2,
Zhangjie Chu
1,* and
Wei Li
2,*
1
School of Fishery, Zhejiang Ocean University, Zhoushan 316000, China
2
Key Laboratory of Tropical & Subtropical Fishery Resource Application & Cultivation of Ministry of Agriculture and Rural Affairs, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510380, China
3
Science and Technology Research Center of China Customs, Beijing 100026, China
4
School of Marine and Fisheries, Guangdong Eco-Engineering Polytechnic, Guangzhou 510520, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Genes 2025, 16(7), 834; https://doi.org/10.3390/genes16070834
Submission received: 16 June 2025 / Revised: 13 July 2025 / Accepted: 15 July 2025 / Published: 17 July 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

In farmed animals, body color is not only an ecological trait but also an important trait that influences the commercial value of the animals. Melanin plays an important role in the formation of body color in animals, while the tyrosinase (TYR) gene family is a group of key enzymes that regulate melanogenesis. The Chinese soft-shelled turtle (Pelodiscus sinensis) is one of the most important reptiles in freshwater aquaculture. However, the potential role of the TYR gene family in the body color formation of P. sinensis remains unclear. This study aimed to investigate the expression and conservation of the TYR gene family in relation to body color variation in P. sinensis. Three core members of this gene family were identified from the P. sinensis genome. Following identification, the genomic features were analyzed. They shared similar physicochemical properties and conserved domains. Chromosome mapping showed that the three genes of P. sinensis were all located on the autosomes, while phylogenetic and collinearity analysis suggested that the protein functions of the three genes in the studied species were highly conserved. Amino acid sequence alignment indicated high conservation among the three TYR gene family proteins (TYR, TYRP1, and DCT) in multiple critical regions, particularly in their hydrophobic N-/C-terminal regions and cysteine/histidine-rich conserved domains. The qRT-PCR revealed that the TYR and DCT genes were highly expressed in the eyes of individuals with different body colors. The expression levels of TYR and TYRP1 genes in the skin were significantly higher in dark-colored individuals than in light-colored ones (p < 0.05). These results will lay the groundwork for functional studies and breeding programs targeting color traits in aquaculture.

1. Introduction

Body color is one of the most important phenotypic characteristics in animals and plays a crucial role in identification, mate selection, camouflage, and warning [1]. In farmed animals, body color is not only an ecological trait but also an important trait that affects the commercial value of these animals [2]. P. sinensis is a commercially important freshwater turtle, prized for its nutritional and medicinal properties, as well as its culinary appeal [3,4]. Body color serves as a key selective breeding trait that influences market demand [5], as evidenced by the commercial success of the Yongzhang golden turtle (GS-01-011-2018), a selectively bred ornamental yellow-bodied variety. Therefore, cultivating novel color variants to enhance ornamental value requires deeper research into P. sinensis’ body color formation mechanisms.
Melanin is one of the most important pigments in the process of body color formation and can be divided into two types: eumelanin and pheomelanin [6]. The melanogenesis process begins with the TYR-catalyzed oxidation of tyrosine and DOPA to DOPAquinone. Subsequent reactions diverge based on cellular conditions. In the presence of cysteine (Cys) or glutathione (GSH), DOPAquinone converts into pheomelanin. When neither of them is present, DOPAquinone performs cyclization to produce DOPAchrome, which either undergoes spontaneous decarboxylation to yield TYR-catalyzed eumelanin or tautomerization to generate eumelanin by tyrosinase-related proteins (TYRP1 and DCT) activity [7]. It can be seen that TYR gene family members play key roles in melanogenesis and animal body color formation.
TYR gene family belongs to the copper-containing metal enzyme family, which is a class of genes encoding key enzymes in melanin synthesis and which contains three main members: TYR, TYRP1, and DCT [8]. Yu et al. identified five TYR variants in the Muchuan Black-Boned Chicken (Gallus gallus domesticus), and the expressions of all variants were significantly different in black and white feather bulbs (p < 0.05) [9]. By establishing a synchronized Tyrosinase transport system, Nakamura et al. demonstrated that TYRP1 is a positive regulator that promotes melanogenesis, which has the function of promoting Tyrosinase targeting to melanosomes [10]. Braasch et al. studied the method of knockdown of the TYRP1 gene in zebrafish (Danio rerio), which caused it to produce pheomelanin instead of eumelanin [11]. In addition, a study suggested that changes in the expression levels of DCT may be closely related to changes in the body color of Rainbow trout (Oncorhynchus mykiss) [12]. Zhang et al. found that compared to wild-type turtle (AWT), the Yongzhang golden turtle (YGT) exhibited significantly reduced melanin content but markedly increased carotenoid levels. Furthermore, the downregulation of genes bc01 and bc02, which are negatively correlated with carotenoid content, may be associated with the development of yellow pigmentation in YGT [13]. Additionally, Wang et al. identified key pigmentation regulators in P. sinensis by comparing two distinct color morphs using mRNA-seq and miRNA-seq, including mRNAs (MITF, GPNMB, KIT) and miRNAs (miR-138, miR-383-3p, miR-1388b-5p) [14]. However, functional studies of the role of the TYR gene family in the body color formation of P. sinensis have not been reported.
In this study, TYR gene family members were identified and analyzed based on the genome of P. sinensis. The differential expressions of the identified genes in the individuals with different body colors were detected by means of quantitative reverse transcription PCR (qRT-PCR). This study will provide basic data for further research on the evolutionary and functional mechanisms of the TYR gene family in P. sinensis.

2. Materials and Methods

2.1. Genome Identification and Physicochemical Analysis of the TYR Gene Family

First, we retrieved the genomic and proteomic data of P. sinensis (GCF_000230535.1) from the National Center for Biotechnology Information (NCBI) database, including genome sequences, protein sequences, and annotation files. Subsequently, the Hidden Markov Model (HMM) data of the TYR gene (PF00264) were obtained from the Pfam Protein Family Database. To identify members of the TYR gene family in the P. sinensis genome, we then employed HMMER 3.0 software [15]. Following this identification, we assessed the candidate sequences and removed the sequence redundancy using the SMART database, with all parameters set to the default values [16]. The molecular weight (kDa), theoretical isoelectric point (pI), instability coefficient, fat index, and total mean hydrophilic coefficient (GRAVY) of the TYR proteins were calculated using ProtParam (https://web.expasy.org/protparam/, accessed on 14 July 2025) [17]. Finally, the subcellular localizations of the TYR proteins were analyzed using Cell-PLocr 2.0 [18].

2.2. Chromosome Scaffold Mapping and Gene Structure Analysis of the TYR Gene Family

Based on the genome annotation file, chromosome scaffold mapping and gene structure visualization of the filtered TYR gene family members were performed using the TBtools 2.2 [19].

2.3. Phylogeny and Collinearity Analysis of the TYR Gene Family

The amino acid sequences of three core TYR gene family members (TYR, TYRP1, and DCT) from the 14 vertebrate species were retrieved from the NCBI database. The 14 vertebrate species were P. sinensis, D. rerio, Oryzias latipes, Bufo gargarizans, Xenopus tropicalis, Homo sapiens, Mus musculus, Zootoca vivipara, Thamnophis elegans, Coturnix japonica, Gallus gallus, Chelonia mydas, Mauremys mutica, and Mauremys reevesii. Following sequence acquisition, multiple-sequence alignment was performed using MUSCLE 5.1[20] to ensure accurate comparisons across species. The phylogenetic tree is a commonly used analytical tool in molecular biology for identifying gene family members and analyzing phylogenetic relationships among species [21]. The species’ evolutionary trees were constructed using the maximum likelihood method with the Jones–Taylor–Thornton (JTT) substitution model and gamma-distributed (G) rate heterogeneity in MEGA 7 [22]. Node support was assessed with 1000 bootstrap replicates, and the final tree was visualized using tvBOT (https://chiplot.online/tvbot.html, accessed on 14 July 2025)[23].

2.4. Conserved Motifs and Structural Domain Analysis of the TYR Gene Family

Conserved motifs in TYR proteins were predicted using the MEME Suite database, with a maximum of 9 motifs allowed [24]. The structural domains were then annotated with the NCBI Conserved Domain tool [25], with all filter parameters set to default values. Finally, both results were visualized using TBtools software [19].

2.5. Homology Alignment and Structural Analysis of the TYR Proteins

Eight representative species spanning mammals, birds, amphibians, reptiles, and fish were selected for comparative analysis with P. sinensis, including H. sapiens, G. gallus, X. tropicalis, Z. vivipara, O. latipes, C. mydas, M. mutica, and M. reevesii. Sequence alignment of the TYR gene family was performed using BioEdit 7.2 [26]. Protein secondary structures were predicted using SOPMA (https://npsa.lyon.inserm.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html, accessed on 14 July 2025)[27], while 3D modeling was conducted with SWISS-MODEL [28].

2.6. Transcription Factor Analysis

The 2 kb upstream promoter regions of TYR genes were extracted from P. sinensis genome annotation files. Then, transcription factors were predicted using the JASPAR database Scan tool (https://jaspar.elixir.no/tools/, accessed on 14 July 2025), with a screening threshold set at 0.8 [29].

2.7. Quantitative Reverse Transcription PCR Analysis of the TYR Gene Family

2.7.1. Sample Collection and Ethical Declaration

To explore the functions of TYR gene family members, qRT-PCR was utilized to measure their relative expression levels across the tissues of four P. sinensis individuals with different body colors (Figure 1): the Qingxi black strain has dark-green skin and black eyes, and was provided by Zhejiang Qingxi Soft-shelled turtle Industry Co. (Huzhou, China); the Yongzhang golden strain has golden-yellow skin and red eyes, and was provided by the Fuping County Jingtao soft-shelled turtle farm (Baoding, China); the albino strain has pinkish-white skin and red eyes, and was provided by the Liwan District Jiying Breeding Farm (Guangzhou, China); the Huangsha strain has olive-green skin and black eyes, and was provided by the Qinzhou City Lin Jisheng Huangsha soft-shelled turtle farm (Qinzhou, China). All P. sinensis individuals used in this study were healthy one-year-old specimens (mean weight: 42.92 ± 4.08 g). Different tissue samples were obtained by following the sample collection method described by Wang et al. [30]. We collected ten types of tissue, namely heart, liver, spleen, lung, kidney, intestine, brain, muscle, eye and skin tissues. The collected samples were promptly preserved in liquid nitrogen for RNA isolation. All experimental methods used for the studied species were performed in accordance with the animal husbandry regulations of the Pearl River Fisheries Research Institute, located in Guangzhou, China.

2.7.2. RNA Extraction and Quantitative Reverse Transcription PCR

Total RNA was extracted from the different tissues according to the instructions for TRlzol Reagent (Life Technologies, Carlsbad, CA, USA). A total of 20 mg of tissue and 1 mL of TRIzol were added into an RNase-free EP tube, homogenized thoroughly and incubated at RT (10 min). Then, 0.2 mL of chloroform was added and the mixture was vortexed vigorously, incubated at RT (5 min), and then centrifuged at 12,000 rpm (4 °C) for 15 min. The upper aqueous phase was carefully transferred to a new tube and an equal volume of isopropanol was added. This mixture was mixed by vortexing and incubated at RT (10 min). It was then centrifuged at 12,000 rpm (4 °C) for 10 min and the supernatant was discarded. The white pellet at the bottom contained RN; this pellet was washed with 1 mL of 75% ethanol, centrifuged at 12,000 rpm (4 °C) for 5 min, and the supernatant was discarded. The washing step was repeated once. After discarding the supernatant, the EP tube was opened and air-dried (5 min) and the pellet was dissolved in 20 μL of RNase-Free H2O. The RNA concentration and purity were measured using NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). RNA integrity was assessed using an Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara,CA, USA). The first strand of cDNA was synthesized using the reverse transcription kit from Takara (Beijing, China). Total RNA was mixed with RT Primer Mix, incubated at 70 °C (10 min), chilled on ice (3 min), and then combined with 2 μL of 5 × M-MLV Buffer, 0.5 μL of dNTP Mixture, 0.25 μL of RNase inhibitor, and 0.5 μL of RTase MLV (RNase H—). The reaction was conducted at 42 °C (60 min) and then the mixture was incubated at 70 °C (15 min). As a highly sensitive and specific technique for measuring the relative expression levels of genes through the fluorescent detection of amplified DNA during PCR cycles [31], qRT-PCR was carried out using iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on ten tissue types from four P. sinensis color morphs, with three biological replicates per tissue and three technical replicates each. Primers were designed based on the available nucleotide sequences of the TYR gene family from the NCBI (Table 1). Since the expression pattern of the Ef1a gene was consistent across all tissues of P. sinensis, it was used as a reference gene to calculate the relative expression levels of the target genes [32]. Primer specificity was verified by NCBI BLAST(https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 14 July 2025) and confirmed by a single peak in the melting curve (Supplementary Figure S1). Subsequently, qRT-PCR standard curves demonstrated high linearity (R2 = 0.994–0.999), with slopes (−3.16 to −3.34) corresponding to amplification efficiencies of 99–107% (Supplementary Figure S2). Gene expression levels were quantified using the 2−ΔΔCt method [33]. Differential expression was analyzed by one-way ANOVA using GraphPad Prism 8.0.2 [34], with results presented as the mean ± SEM of triplicate experiments (statistical significance threshold: p < 0.05) [35].

3. Results

3.1. Identification and Physicochemical Characterization of the TYR Gene Family Members

Three TYR gene family members were identified in the genome of P. sinensis: TYR, TYRP1, and DCT. The results of the physicochemical characterization were as follows: The number of amino acids ranged from 526 to 535. The molecular weight ranged from 59.8 to 60.1 kD. The isoelectric points ranged from 5.35 to 6.47. The instability index ranged from 42.55 to 51.51. The aliphatic index ranged from 74.01 to 76.00. The average hydropathicity ranged from −0.289 to −0.326. Subcellular localization revealed that the three TYR gene family members were all localized on the plasma membrane (Table 2).

3.2. Chromosome Scaffold Mapping and Gene Structure of the TYR Gene Family Members

Our chromosome localization analysis showed that the three screened TYR gene family members were distributed on chromosome scaffold 1, chromosome scaffold 272, and chromosome scaffold 353, respectively (Figure 2A). In the gene structure analysis, there were differences in the gene length, coding sequences, and introns of the three TYR gene family members. The TYR gene had five coding sequences and four introns. The TYRP1 gene had seven coding sequences and seven introns. Finally, the DCT gene had eight coding sequences and seven introns (Figure 2B).

3.3. Phylogenetic Relationships of the TYR Gene Family Members in 14 Vertebrate Species

We constructed a phylogenetic tree to investigate the phylogenetic relationships of the TYR gene family in P. sinensis. The three screened genes from the TYR gene family were divided into three subfamilies. Based on the topology of the phylogenetic tree, it can be seen that the TYR and DCT genes of P. sinensis exhibited the smallest genetic distance with turtles, birds, and reptiles, followed by mammals and amphibians, and the farthest genetic distance with fish. However, the TYRP1 gene exhibited the closest genetic distance with turtles, reptiles, and birds, followed by mammals and fish, and the farthest genetic distance with amphibians (Figure 3).

3.4. Collinearity Analysis of the TYR Gene Family Members

A collinear analysis was conducted across a number of species, including H. sapiens, G. gallus, X. tropicalis, O. latipes, and P. sinensis (Figure 4). The TYR genes of H. sapiens, G. gallus, X. tropicalis, and O. latipes were located on chromosomes 11, 1, 2, and 13, respectively (Figure 4A). The TYRP1 genes of H. sapiens, X. tropicalis, and O. latipes were located on chromosomes 9, 1, and 18, respectively (Figure 4B). It is worth noting that the TYRP1 gene of G. gallus was located on sex chromosome Z. The DCT genes of H. sapiens, G. gallus, X. tropicalis, and O. latipes were located on chromosomes 13, 1, 2, and 21, respectively (Figure 4C). Based on the chromosome positioning results, it could be observed that the TYR and DCT genes of G. gallus and X. tropicalis were located on the same chromosomes. Furthermore, we also found that the TYR genes of H.sapiens, G. gallus, X. tropicalis, and P. sinensis were located on the same gene module, TMEM135-RAB38-CTSC-GRM5-TYR-NOX4. This segment was highly conserved during evolution. O. latipes only had the conserved fragment RAB38-CTSC-GRM5-TYR-NOX4, while TMEM135 was replaced with FZD4 (Figure 4A). The TYRP1 genes of H.sapiens, G. gallus, X. tropicalis, and P. sinensi were located on the same gene module, UHRF2-GLDC-KDM4C-PTPRD-TYRP1-LURAP1L-MPDZ-NFIB-ZDHHC21. O. latipes only had the conserved fragment PTPRD-TYRP1-LURAP1L-MPDZ, while KDM4C was replaced with UPS53, and NFIB was replaced with ADGRL3 (Figure 4B). The DCT genes of H.sapiens, G. gallus, and P. sinensis were located on the same gene module, GPC5-GPC6-DCT-TGDS-GPR180. However, similar conserved gene modules were not found in the DCT genes of X. tropicalis and O. latipes (Figure 4C).

3.5. Conserved Motifs and Structural Domain Analysis of the TYR Gene Family Members

Through amino acid sequence conservation region prediction, nine of the most conserved motifs were obtained (Figure 5A), which were all in the TYR, TYRP1, and DCT gene amino acid sequence. In addition, the three TYR gene family proteins contained the same domain, namely the Tyrosinase Superfamily (Figure 5B). Our results showed that these protein motifs were highly conserved.

3.6. Amino Acid Sequence Alignment and Protein Structure Prediction of the TYR Gene Family Members

The results of the amino acid sequence alignment indicated that the three TYR gene family proteins (TYR, TYRP1, and DCT) were highly conserved in multiple critical regions across the nine species. All sequences featured hydrophobic amino acids in their N- and C-terminal segments. Moreover, they all contained multiple conserved Cys and histidine (His) residues. The sequence alignment results for TYR protein showed that the similarity between P. sinensis and other Testudines species is above 97%, while the lowest similarity is with fish, at only 76.3%. The sequence alignment results for TYRP1 protein indicated that the similarity between P. sinensis and other Testudines species is above 91%, while the lowest similarity is with amphibians, at only 82.2%. The sequence alignment results for DCT protein revealed that the similarity between P. sinensis and other Testudines species is above 91%, while the lowest similarity is with fish, at only 76% (Figure 6A). The results of our protein 3D structure model prediction of the three TYR gene family members showed that the tertiary structure of TYR, TYRP1, and DCT proteins mainly consisted of α-helices, β-turns, random coils, and extended strands (Figure 6B–D). Specifically, the proportions of TYR protein were 28.36%, 1.89%, 59.17%, and 10.59%. The proportions of TYRP1 protein were 30.65%, 1.87%, 56.45%, and 11.03%, while those of DCT protein were 29.85%, 3.80%, 52.85%, and 13.50%.

3.7. Transcription Factor Prediction of the TYR Gene Family Members

In this study, 750, 707, and 763 types of transcription factors were predicted in the promoter regions of the TYR, TYRP1, and DCT genes, respectively. The top 20 transcription factors were selected for visualization and analysis. CTCF accounted for the largest number of transcription factors. The transcription factors of the TFAP and KLF family were the most diverse. Among these, TFAP2A, TFAP2C, and KLF4 are associated with the development and function of melanogenesis (Figure 7).

3.8. Expression Profiling of the TYR Gene Family Members in Four Kinds of P. sinensis

The qRT-PCR results showed that all three members of the TYR gene family were expressed in all tissues of different body colors (Figure 8). TYR and TYRP1 had significantly higher expression levels in the skin of dark-colored individuals than in light-colored individuals (p < 0.05). The TYR and DCT genes were highly expressed in the eyes of individuals with different body colors. The expression of all three genes in kidney and intestine tissues was relatively low.

4. Discussion

Melanin is one of the most important pigments involved in the formation of body coloration, serving functions such as light absorption, photoprotection, and skin pigmentation [36]. The TYR gene family is widely found in eukaryotes and prokaryotes and plays an important role in melanogenesis [37]. This study identified three major members of the TYR gene family in the genome of P. sinensis with similar physicochemical properties. Subcellular localization revealed that these were all localized on the plasma membrane, and that the three TYR gene family proteins all had a conserved domain, namely the Tyrosinase Superfamily. The results of our gene structure analysis showed that the TYR gene family members differ in gene length, coding sequence, and introns, suggesting that they may be functionally diverse. Phylogenetic analyses can be used to identify the evolutionary relationships of different species. Judging from the phylogenetic tree, the TYR and DCT genes of P. sinensis are the closest to those of turtles, birds, and reptiles and the farthest from fish. Unlike the above two genes, the TYRP1 gene exhibited a longer genetic distance from amphibians compared with fish. The results of the collinearity analysis and amino acid sequence alignment are consistent with the phylogenetic analysis, suggesting that the protein functions of the three genes in these species are highly conserved. In the amino acid sequence alignment, we found several conserved amino acid residues, including Cys and His. Cys, an amino acid containing a sulfhydryl group, plays a critical role in protein folding and structural stability through the formation of disulfide bonds via oxidation between two cysteine residues [38]. Cys also plays an important role in melanogenesis; under the action of Cys, DOPAquinone is converted into pheomelanin [7]. The catalytic activity of tyrosinase, the key enzyme regulating melanogenesis, is modulated by histidine residues. Through site-directed mutagenesis, Nakamura et al. showed that replacing any of the seven histidine residues that coordinate copper ions with asparagine in Escherichia coli expressing recombinant Aspergillus oryzae tyrosinase completely abolished its enzymatic activity [39]. Also using site-directed mutagenesis, Hyangsoone’s team identified three histidine residues at the CuA site as essential for human tyrosinase activity. These histidine residues likely participate directly in copper coordination, thereby catalyzing the hydroxylation of L-tyrosine [40]. The TYR gene family plays a crucial role in melanin synthesis, and its evolutionary conservation is essential for maintaining melanocyte function [41].
Our chromosome positioning results showed that the three TYR gene family members in all the investigated species were located on the autosomes, except the TYRP1 in G. gallus, which was located on the Z chromosome. Birds have a ZW sex determination system, where males are ZZ and females are ZW [42]. Sexual dimorphism in plumage color is common, with males often exhibiting brighter and more decorative feathers than females, likely due to sexual selection favoring ornamental traits in males [43]. Additionally, the presence of two Z chromosomes in males may enhance the expression of Z-linked color genes, such as TYRP1, which may contribute to green head feathers in male ducks, as identified through transcriptome analysis [44]. Meanwhile, the TYR gene family members located on autosomes also play a crucial role in melanogenesis and body color formation in animals. Zhang et al. cloned and analyzed the TYR and TYRP1 genes from both normal and albino yellow catfish (Tachysurus fulvidraco). They found that the mRNA expression levels of both genes exhibited significant tissue specificity in two phenotypes, with higher expression observed in normal individuals compared to albino individuals [45]. Melina et al. analyzed the expression levels of TYR in the skin of Llamas (Lama glama) with different coat colors using qPCR. The results showed that the expression of TYR in white llamas was significantly lower than that in dark-pigmented phenotypes (p < 0.05) [46].
This study also identified several transcription factors that are associated with melanin synthesis in the promoter regions of the three TYR gene family members of P. sinensis, such as TFAP2A, TFAP2C and KLF4. TFAP2A and TFAP2C are members of the TFAP2 transcription factor family, which plays a crucial role in regulating melanocyte differentiation and melanoma phenotypes [47]. O’Brien et al. found that the melanocytes of zebrafish embryos which underwent knockdown as a part of TFAP2A treatment were reduced and showed abnormal differentiation and migration [48]. In addition, Seberg et al. found that TFAP2A/TFAP2B double-conditional mutation-treated mouse embryos had significantly fewer melanocytes than the controls. They also analyzed TFAP2A-deficient zebrafish tissue and mouse melanocytes and found that the expression of a subset of pigmentation-associated genes was TFAP2A-dependent, including that of the DCT gene [49]. Hong et al. found that the mRNA and protein levels of KLF4 were more highly expressed in black-skinned sheep than in sheep with white skin. Moreover, the overexpression of KLF4 significantly increased the expression of the TYR gene [50]. As can be seen from the above results, the three main members of the TYR gene family of P. sinensis may participate in the formation of body color through the transcriptional regulation of TFAP2A, TFAP2C and KLF4.
The qRT-PCR results for different tissues with different body colors of P. sinensis showed that the expression levels of the TYR and TYRP1 genes are significantly higher in the skin tissue of dark-colored individuals than in light-colored individuals (p < 0.05). As the first effective barrier between living organisms and the environment, the skin has the role of preventing pathogens from invading, resisting chemical and physical attacks, and preventing water loss [51]. Skin pigmentation is the most important photoprotective factor of skin, in which melanin has an ultraviolet absorption effect, as well as antioxidant and free radical scavenging characteristics. A study showed that TYR is a key gene for the regulation of Bali cattle’s (Bos javanicus domesticus) fur color. Its expression differed significantly between standard Bali cattle and albinos (p < 0.05) [52]. The research of Gong et al. showed that the expression of TYRP1 in the normal Russian sturgeon (Acipenser gueldenstaedtii) was significantly higher than in the albino phenotype [53]. As can be seen from the above results, TYR and TYRP1 play important roles in melanogenesis. At the same time, their high expression levels affect pigmentation and skin protection. The TYR and DCT genes were highly expressed in the eye tissues of individuals with different body colors. TYR is a key rate-limiting enzyme in melanin production. Mutations in the TYR gene will cause reduced or even absent forms of hair, skin, and eye pigmentation, which is known as ocular skin albinism (OCA) [54]. Andrson et al. found that nm2798-mutant mice exhibited the phenomenon of iris pigment dispersion, while the nm2798 mutation was a missense mutation in the DCT [55]. These results indicate that the TYR and DCT genes play important roles in the process of iris pigmentation. The TYR, TYRP1 and DCT genes show differential expression patterns in the spleen, liver, and kidney tissues among the four different-colored strains of P. sinensis. These three organs serve as crucial immune regulatory organs in animals [56,57,58]. The current study has demonstrated that the TYR gene family plays a role in immune regulation in animals [59]. Furthermore, some studies have shown differences in the immune regulatory capacity between different-colored individuals within the same species, such as the Threespine stickleback (Gasterosteus aculeatus) [60] and Chinese mitten crab (Eriocheir sinensis) [61]. Therefore, we speculate that the differential expression of TYR gene family members in these three organs may indicate differences in immune regulatory capacities among different-colored individuals of P. sinensis. The above findings demonstrate that the TYR gene family is associated with body color formation and plays a crucial role in melanogenesis. While it has been shown that its function in vertebrate pigmentation regulation is evolutionarily conserved [37,62,63], information regarding the TYR gene family in the P. sinensis remains scarce. Our results demonstrate that the TYR gene family regulates body color variation in P. sinensis. These findings will provide a theoretical foundation for understanding the molecular mechanisms of pigmentation and practical data for targeted breeding programs of color traits in aquaculture. However, our current findings are limited to transcriptional evidence of TYR gene family regulation, with additional protein-level validation and expanded sample sizes needed to strengthen the conclusions in future studies.

5. Conclusions

In this study, three major members of the TYR gene family were identified. Their function in P. sinensis pigmentation regulation is evolutionarily conserved. The tissue expression profiles of TYR and TYRP1 suggest their functional contribution to body color variation in P. sinensis. These findings will provide fundamental data for research on the functional mechanisms of color characteristics and selective breeding of ornamental traits in aquaculture. Additionally, the immunomodulatory functions of the TYR gene family will be a key focus of our future investigations.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16070834/s1, Figure S1. Melting curve analysis of TYR (A), TYRP1 (B), DCT (C), and Ef1a (D); Figure S2. Amplification efficiency analysis of TYR (A), TYRP1 (B), DCT (C), and Ef1a (D); Table S1: Transcription factors regulating TYR, TYRP1, and DCT.

Author Contributions

Conceptualization, Y.G., Z.C. and W.L.; methodology, J.Z., C.C., L.J. and W.L.; validation, Y.L. and P.L.; formal analysis, Y.L., P.L., Z.W., J.Z., C.C. and W.L.; investigation, Y.L. and P.L.; resources, T.R., X.H., X.L. and C.W.; data curation, Y.L. and Z.W.; writing—original draft, Y.L. and P.L.; writing—review and editing, Y.L. and J.Z.; visualization, Y.L.; supervision, T.R., J.Z., C.C., L.J., X.H., X.L., C.W. and X.Z.; project administration, Y.G., Z.C. and W.L.; funding acquisition, X.Z. and W.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32202941), the Selection Breeding of the High-Quality Fast-Growing Chinese Soft-Shelled Turtle and Studies on Efficient and Healthy Farming Technology (2024-SPY-00-014), the Central Public-Interest Scientific Institution Basal Research Fund, CAFS (2023TD38, NO.2023SJHX1), the National Freshwater Genetic Resource Center (NFGR-2023), and the China-ASEAN Maritime Cooperation Fund (CAMC-2018F).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Review Board of the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences (approval number: LAEC-PRFRI-2025-03-20; approval date: 20 March 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the author. Email: liuyanchao204@163.com.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Singh, A.P.; Nüsslein-Volhard, C. Zebrafish Stripes as a Model for Vertebrate Colour Pattern Formation. Curr. Biol. 2015, 25, R81–R92. [Google Scholar] [CrossRef] [PubMed]
  2. Luo, M.K.; Lu, G.Q.; Yin, H.R.; Wang, L.M.; Atuganile, M.; Dong, Z.J. Fish pigmentation and coloration: Molecular mechanisms and aquaculture perspectives. Rev. Aquac. 2021, 13, 2395–2412. [Google Scholar] [CrossRef]
  3. Zhu, J.; Lei, L.; Chen, C.; Wang, Y.; Liu, X.; Geng, L.; Li, R.; Chen, H.; Hong, X.; Yu, L.; et al. Whole-Transcriptome Analysis Identifies Gender Dimorphic Expressions of Mrnas and Non-Coding Rnas in Chinese Soft-Shell Turtle (Pelodiscus sinensis). Biology 2022, 11, 834. [Google Scholar] [CrossRef] [PubMed]
  4. Zhu, J.; Wang, Y.; Lei, L.; Chen, C.; Ji, L.; Li, J.; Wu, C.; Yu, W.; Luo, L.; Chen, W.; et al. Comparative genomic survey and functional analysis of DKKL1 during spermatogenesis in the Chinese soft-shelled turtle (Pelodiscus sinensis). Int. J. Biol. Macromol. 2024, 254, 127696. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, L.; Wang, X.; Zhang, R.; Li, H.; Zhu, H. Targeted metabolomics revealed the seasonal plasticity of skin color and pigment metabolites in ornamental koi carp. Ecotoxicol. Environ. Saf. 2024, 281, 116595. [Google Scholar] [CrossRef] [PubMed]
  6. Guo, L.L.; Li, W.Y.; Gu, Z.Y.; Wang, L.T.; Guo, L.; Ma, S.B.; Li, C.Y.; Sun, J.S.; Han, B.Q.; Chang, J. Recent Advances and Progress on Melanin: From Source to Application. Int. J. Mol. Sci. 2023, 24, 4360. [Google Scholar] [CrossRef] [PubMed]
  7. Wang, F.F.; Ma, W.J.; Fan, D.J.; Hu, J.; An, X.H.; Wang, Z.D. The biochemistry of melanogenesis: An insight into the function and mechanism of melanogenesis-related proteins. Front. Mol. Biosci. 2024, 11, 1440187. [Google Scholar] [CrossRef] [PubMed]
  8. Solano, F. On the Metal Cofactor in the Tyrosinase Family. Int. J. Mol. Sci. 2018, 19, 633. [Google Scholar] [CrossRef] [PubMed]
  9. Yu, S.; Wang, G.; Liao, J.; Tang, M. Five alternative splicing variants of the TYR gene and their different roles in melanogenesis in the Muchuan black-boned chicken. Br. Poult. Sci. 2019, 60, 8–14. [Google Scholar] [CrossRef] [PubMed]
  10. Nakamura, H.; Fukuda, M. Establishment of a synchronized tyrosinase transport system revealed a role of Tyrp1 in efficient melanogenesis by promoting tyrosinase targeting to melanosomes. Sci. Rep. 2024, 14, 2529. [Google Scholar] [CrossRef] [PubMed]
  11. Braasch, I.; Liedtke, D.; Volff, J.N.; Schartl, M. Pigmentary function and evolution of tyrp1 gene duplicates in fish. Pigment Cell Melanoma Res. 2009, 22, 839–850. [Google Scholar] [CrossRef] [PubMed]
  12. Wu, S.; Huang, J.; Li, Y.; Liu, Z.; Zhang, Q.; Pan, Y.; Wang, X. Cloning, sequence analysis, and expression of tyrp1a and tyrp2 genes related to body colour in different developmental stages and tissues of rainbow trout Oncorhynchus mykiss. Aquac. Int. 2021, 29, 941–961. [Google Scholar] [CrossRef]
  13. Zhang, J.; Ding, Z.H.; Wu, P.F.; Du, W.G.; Guan, Y.Q.; Wang, X.F. Disentangling the molecular mechanisms underlying yellow body coloration in a soft-shelled turtle. Zool. Res. 2025, 46, 379–387. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, P.; Zeng, D.; Xiong, G.; Zhou, X.; Jiang, H.; Hu, Y.; Ge, L.; Wang, X. Integrated analysis of mRNA-seq and microRNA-seq depicts the potential roles of miRNA-mRNA networks in pigmentation of Chinese soft-shelled turtle (Pelodiscus sinensis). Aquac. Rep. 2021, 20, 100686. [Google Scholar] [CrossRef]
  15. Potter, S.C.; Luciani, A.; Eddy, S.R.; Park, Y.; Lopez, R.; Finn, R.D. HMMER web server: 2018 update. Nucleic Acids Res. 2018, 46, W200–W204. [Google Scholar] [CrossRef] [PubMed]
  16. Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021, 49, D458–D460. [Google Scholar] [CrossRef] [PubMed]
  17. Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. In 2-D Proteome Analysis Protocols; Methods in Molecular Biology (Clifton, N.J.); Humana Press: Totowa, NJ, USA, 1999; Volume 112, pp. 531–552. [Google Scholar] [CrossRef]
  18. Chou, K.-C.; Shen, H.B. Cell-PLoc 2.0: An improved package of web-servers for predicting subcellular localization of proteins in various organisms. Nat. Sci. 2010, 2010, 1090–1103. [Google Scholar] [CrossRef]
  19. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  20. Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef] [PubMed]
  21. Delsuc, F.; Brinkmann, H.; Philippe, H. Phylogenomics and the reconstruction of the tree of life. Nat. Rev. Genet. 2005, 6, 361–375. [Google Scholar] [CrossRef] [PubMed]
  22. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  23. Xie, J.; Chen, Y.; Cai, G.; Cai, R.; Hu, Z.; Wang, H. Tree Visualization By One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef] [PubMed]
  24. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  25. Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, D265–D268. [Google Scholar] [CrossRef] [PubMed]
  26. Alzohairy, A. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  27. Geourjon, C.; Deléage, G. SOPMA: Significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Comput. Appl. Biosci. CABIOS 1995, 11, 681–684. [Google Scholar] [CrossRef] [PubMed]
  28. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [PubMed]
  29. Castro-Mondragon, J.A.; Riudavets-Puig, R.; Rauluseviciute, I.; Lemma, R.B.; Turchi, L.; Blanc-Mathieu, R.; Lucas, J.; Boddie, P.; Khan, A.; Manosalva Pérez, N.; et al. JASPAR 2022: The 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2022, 50, D165–D173. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, Y.; Zhu, J.; Chen, C.; Ji, L.; Hong, X.; Liu, X.; Chen, H.; Wei, C.; Zhang, J.; Zhu, X.; et al. Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis). Animals 2024, 14, 931. [Google Scholar] [CrossRef] [PubMed]
  31. Jozefczuk, J.; Adjaye, J. Quantitative real-time PCR-based analysis of gene expression. Methods Enzymol. 2011, 500, 99–109. [Google Scholar] [CrossRef] [PubMed]
  32. Lei, L.; Zhu, J.; Chen, C.; Wang, Y.; Wu, C.; Qi, M.; Wang, Y.; Liu, X.; Hong, X.; Yu, L.; et al. Genome-wide identification, evolution and expression analysis of bone morphogenetic protein (BMP) gene family in chinese soft-shell turtle (Pelodiscus sinensis). Front. Genet. 2023, 14, 1109478. [Google Scholar] [CrossRef] [PubMed]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  34. Mitteer, D.R.; Greer, B.D.; Fisher, W.W.; Cohrs, V.L. Teaching behavior technicians to create publication-quality, single-case design graphs in graphpad prism 7. J. Appl. Behav. Anal. 2018, 51, 998–1010. [Google Scholar] [CrossRef] [PubMed]
  35. Chatzi, A.; Doody, O. The one-way ANOVA test explained. Nurse Res. 2023, 31, 8–14. [Google Scholar] [CrossRef] [PubMed]
  36. McNamara, M.E.; Rossi, V.; Slater, T.S.; Rogers, C.S.; Ducrest, A.L.; Dubey, S.; Roulin, A. Decoding the Evolution of Melanin in Vertebrates. Trends Ecol. Evol. 2021, 36, 430–443. [Google Scholar] [CrossRef] [PubMed]
  37. Esposito, R.; D’Aniello, S.; Squarzoni, P.; Pezzotti, M.R.; Ristoratore, F.; Spagnuolo, A. New Insights into the Evolution of Metazoan Tyrosinase Gene Family. PLoS ONE 2012, 7, e35731. [Google Scholar] [CrossRef] [PubMed]
  38. Bocian-Ostrzycka, K.M.; Grzeszczuk, M.J.; Banaś, A.M.; Jastrząb, K.; Pisarczyk, K.; Kolarzyk, A.; Łasica, A.M.; Collet, J.F.; Jagusztyn-Krynicka, E.K. Engineering of Helicobacter pylori Dimeric Oxidoreductase DsbK (HP0231). Front. Microbiol. 2016, 7, 1158. [Google Scholar] [CrossRef] [PubMed]
  39. Nakamura, M.; Nakajima, T.; Ohba, Y.; Yamauchi, S.; Lee, B.R.; Ichishima, E. Identification of copper ligands in Aspergillus oryzae tyrosinase by site-directed mutagenesis. Biochem. J. 2000, 350, 537–545. [Google Scholar] [CrossRef] [PubMed]
  40. Noh, H.; Lee, S.J.; Jo, H.J.; Choi, H.W.; Hong, S.; Kong, K.H. Histidine residues at the copper-binding site in human tyrosinase are essential for its catalytic activities. J. Enzym. Inhib. Med. Chem. 2020, 35, 726–732. [Google Scholar] [CrossRef] [PubMed]
  41. Lai, X.; Wichers, H.J.; Soler-Lopez, M.; Dijkstra, B.W. Structure and Function of Human Tyrosinase and Tyrosinase-Related Proteins. Chem. A Eur. J. 2018, 24, 47–55. [Google Scholar] [CrossRef] [PubMed]
  42. Graves, J.A. Avian sex, sex chromosomes, and dosage compensation in the age of genomics. Chromosome Res. 2014, 22, 45–57. [Google Scholar] [CrossRef] [PubMed]
  43. Tringali, A.; Bowman, R.; Husby, A. Selection and inheritance of sexually dimorphic juvenile plumage coloration. Ecol. Evol. 2015, 5, 5413–5422. [Google Scholar] [CrossRef] [PubMed]
  44. Ma, S.; Liu, H.; Wang, J.; Wang, L.; Xi, Y.; Liu, Y.; Xu, Q.; Hu, J.; Han, C.; Bai, L.; et al. Transcriptome Analysis Reveals Genes Associated With Sexual Dichromatism of Head Feather Color in Mallard. Front. Genet. 2021, 12, 627974. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, X.T.; Wei, K.J.; Chen, Y.Y.; Shi, Z.C.; Liu, L.K.; Li, J.; Zhang, G.R.; Ji, W. Molecular cloning and expression analysis of tyr and tyrp1 genes in normal and albino yellow catfish Tachysurus fulvidraco. J. Fish Biol. 2018, 92, 979–998. [Google Scholar] [CrossRef] [PubMed]
  46. Anello, M.; Fernández, E.; Daverio, M.S.; Vidal-Rioja, L.; Di Rocco, F. TYR Gene in Llamas: Polymorphisms and Expression Study in Different Color Phenotypes. Front. Genet. 2019, 10, 568. [Google Scholar] [CrossRef] [PubMed]
  47. Kenny, C.; Dilshat, R.; Seberg, H.E.; Van Otterloo, E.; Bonde, G.; Helverson, A.; Franke, C.M.; Steingrímsson, E.; Cornell, R.A. TFAP2 paralogs facilitate chromatin access for MITF at pigmentation and cell proliferation genes. PLoS Genet. 2022, 18, e1010207. [Google Scholar] [CrossRef] [PubMed]
  48. O’Brien, E.K.; d’Alençon, C.; Bonde, G.; Li, W.; Schoenebeck, J.; Allende, M.L.; Gelb, B.D.; Yelon, D.; Eisen, J.S.; Cornell, R.A. Transcription factor Ap-2alpha is necessary for development of embryonic melanophores, autonomic neurons and pharyngeal skeleton in zebrafish. Dev. Biol. 2004, 265, 246–261. [Google Scholar] [CrossRef] [PubMed]
  49. Seberg, H.E.; Van Otterloo, E.; Loftus, S.K.; Liu, H.; Bonde, G.; Sompallae, R.; Gildea, D.E.; Santana, J.F.; Manak, J.R.; Pavan, W.J.; et al. TFAP2 paralogs regulate melanocyte differentiation in parallel with MITF. PLoS Genet. 2017, 13, e1006636. [Google Scholar] [CrossRef] [PubMed]
  50. Qin, H.; Chen, Y.; Wang, S.; Ge, S.; Pang, Q. The role of KLF4 in melanogenesis and homeostasis in sheep melanocytes. Acta Histochem. 2022, 124, 151839. [Google Scholar] [CrossRef] [PubMed]
  51. Proksch, E.; Brandner, J.M.; Jensen, J.M. The skin: An indispensable barrier. Exp. Dermatol. 2008, 17, 1063–1072. [Google Scholar] [CrossRef] [PubMed]
  52. Kholijah, K.; Darwati, S.; Fakhrul Ulum, M.; Londra, I.; Noor, R.; Jakaria, J. Investigation of polymorphism and expression of the tyrosinase (TYR) gene as a gene controlling coat color in Bali cattle. J. Indones. Trop. Anim. Agric. 2024, 49, 297–306. [Google Scholar] [CrossRef]
  53. Gong, Y.; Hu, M.; Xu, S.; Wang, B.; Wang, C.; Mu, X.; Xu, P.; Jiang, Y. Comparative transcriptome analysis reveals expression signatures of albino Russian sturgeon, Acipenseriformes gueldenstaedtii. Mar. Genom. 2019, 46, 1–7. [Google Scholar] [CrossRef] [PubMed]
  54. Sun, W.; Shen, Y.; Shan, S.; Han, L.; Li, Y.; Zhou, Z.; Zhong, Z.; Chen, J. Identification of TYR mutations in patients with oculocutaneous albinism. Mol. Med. Rep. 2018, 17, 8409–8413. [Google Scholar] [CrossRef] [PubMed]
  55. Anderson, M.G.; Hawes, N.L.; Trantow, C.M.; Chang, B.; John, S.W. Iris phenotypes and pigment dispersion caused by genes influencing pigmentation. Pigment Cell Melanoma Res. 2008, 21, 565–578. [Google Scholar] [CrossRef] [PubMed]
  56. Brendolan, A.; Rosado, M.M.; Carsetti, R.; Selleri, L.; Dear, T.N. Development and function of the mammalian spleen. BioEssays News Rev. Mol. Cell. Dev. Biol. 2007, 29, 166–177. [Google Scholar] [CrossRef] [PubMed]
  57. Li, F.; Tian, Z. The liver works as a school to educate regulatory immune cells. Cell. Mol. Immunol. 2013, 10, 292–302. [Google Scholar] [CrossRef] [PubMed]
  58. Wang, Y.H.; Zhang, Y.G. Kidney and innate immunity. Immunol. Lett. 2017, 183, 73–78. [Google Scholar] [CrossRef] [PubMed]
  59. Liu, J.; Sun, X.; Nie, H.; Kifat, J.; Li, J.; Huo, Z.; Bi, J.; Yan, X. Genome-wide identification and expression profiling of TYR gene family in Ruditapes philippinarum under the challenge of Vibrio anguillarum. Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 37, 100788. [Google Scholar] [CrossRef] [PubMed]
  60. Bolnick, D.I.; Shim, K.C.; Schmerer, M.; Brock, C.D. Population-Specific Covariation between Immune Function and Color of Nesting Male Threespine Stickleback. PLoS ONE 2015, 10, e0126000. [Google Scholar] [CrossRef] [PubMed]
  61. Zhao, Y.; Zhu, X.; Han, Z.; Zhang, Y.; Dong, T.; Li, Y.; Dong, J.; Wei, H.; Li, X. Comparative analysis of transcriptomes from different coloration of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 2020, 98, 515–521. [Google Scholar] [CrossRef] [PubMed]
  62. Xu, Y.; Bartido, S.; Setaluri, V.; Qin, J.; Yang, G.; Houghton, A.N. Diverse roles of conserved asparagine-linked glycan sites on tyrosinase family glycoproteins. Exp. Cell Res. 2001, 267, 115–125. [Google Scholar] [CrossRef] [PubMed]
  63. Kumasaka, M.; Sato, S.; Yajima, I.; Yamamoto, H. Isolation and developmental expression of tyrosinase family genes in Xenopus laevis. Pigment Cell Res. 2003, 16, 455–462. [Google Scholar] [CrossRef] [PubMed]
Genes 16 00834 g001
Figure 1. Phenotypic photographs of P. sinensis individuals with four different body colors. The four individuals are referred to as the Qingxi black strain (W), Yongzhang golden strain (H), albino strain (X), and Huangsha strain (S).
Figure 1. Phenotypic photographs of P. sinensis individuals with four different body colors. The four individuals are referred to as the Qingxi black strain (W), Yongzhang golden strain (H), albino strain (X), and Huangsha strain (S).
Genes 16 00834 g001
Genes 16 00834 g002
Figure 2. (A) Chromosome scaffold mapping and (B) gene structure analysis of the TYR gene family members in P. sinensis. In (A), the colored lines indicate the gene density, with red lines representing regions of higher density. The gene density is defined as the number of genes within a 50 kb genome. In (B), the green boxes, yellow boxes, and black lines represent the non-untranslated regions, exons, and introns, respectively.
Figure 2. (A) Chromosome scaffold mapping and (B) gene structure analysis of the TYR gene family members in P. sinensis. In (A), the colored lines indicate the gene density, with red lines representing regions of higher density. The gene density is defined as the number of genes within a 50 kb genome. In (B), the green boxes, yellow boxes, and black lines represent the non-untranslated regions, exons, and introns, respectively.
Genes 16 00834 g002
Genes 16 00834 g003
Figure 3. Phylogenetic tree of the relationship of the TYR gene family members in P. sinensis with other vertebrates.
Figure 3. Phylogenetic tree of the relationship of the TYR gene family members in P. sinensis with other vertebrates.
Genes 16 00834 g003
Genes 16 00834 g004
Figure 4. Collinear analyses of TYR (A), TYRP1 (B), and DCT (C) between P. sinensis and other animals. The direction of the arrow indicates the transcription direction, and each solid line represents a chromosome scaffold.
Figure 4. Collinear analyses of TYR (A), TYRP1 (B), and DCT (C) between P. sinensis and other animals. The direction of the arrow indicates the transcription direction, and each solid line represents a chromosome scaffold.
Genes 16 00834 g004
Genes 16 00834 g005
Figure 5. (A) Conserved motifs and (B) structural domain analysis of the TYR gene family members in P. sinensis. Motifs 1–9 are highlighted by distinct colored boxes in (A). The Tyrosinase Superfamily domain is indicated by the green box in (B).
Figure 5. (A) Conserved motifs and (B) structural domain analysis of the TYR gene family members in P. sinensis. Motifs 1–9 are highlighted by distinct colored boxes in (A). The Tyrosinase Superfamily domain is indicated by the green box in (B).
Genes 16 00834 g005
Genes 16 00834 g006
Figure 6. (A) Amino acid sequence alignment of the TYR gene family members in P. sinensis with other vertebrates. Structural analysis of the (B) TYR, (C) TYRP1, and (D) DCT proteins in P. sinensis. In (B–D), blue spirals represent α-helices, purple arrows represent β-turns, and brown lines represent random coils.
Figure 6. (A) Amino acid sequence alignment of the TYR gene family members in P. sinensis with other vertebrates. Structural analysis of the (B) TYR, (C) TYRP1, and (D) DCT proteins in P. sinensis. In (B–D), blue spirals represent α-helices, purple arrows represent β-turns, and brown lines represent random coils.
Genes 16 00834 g006
Genes 16 00834 g007
Figure 7. Analysis of the promoters of the TYR gene family members in P. sinensis. Different-colored rectangles indicate different transcription factors.
Figure 7. Analysis of the promoters of the TYR gene family members in P. sinensis. Different-colored rectangles indicate different transcription factors.
Genes 16 00834 g007
Genes 16 00834 g008
Figure 8. Differential expressions of (A) TYR, (B) TYRP1, and (C) DCT in four kinds of P. sinensis. The four individuals are referred to as the Qingxi black strain (W), Yongzhang golden strain (H), albino strain (X), and Huangsha strain (S). The ten tissues are coded as heart (H), liver (G), spleen (P), lung (L), kidney (S), intestine (C), brain (N), muscle (J), eyes (Y), and skin (F) tissues. In the bar chart, means labeled with different lowercase letters indicate a significant difference (p < 0.05), whereas means labeled with the same lowercase letters are not significantly different.
Figure 8. Differential expressions of (A) TYR, (B) TYRP1, and (C) DCT in four kinds of P. sinensis. The four individuals are referred to as the Qingxi black strain (W), Yongzhang golden strain (H), albino strain (X), and Huangsha strain (S). The ten tissues are coded as heart (H), liver (G), spleen (P), lung (L), kidney (S), intestine (C), brain (N), muscle (J), eyes (Y), and skin (F) tissues. In the bar chart, means labeled with different lowercase letters indicate a significant difference (p < 0.05), whereas means labeled with the same lowercase letters are not significantly different.
Genes 16 00834 g008
Table 1. Primer sequences for qRT-PCR analysis.
Table 1. Primer sequences for qRT-PCR analysis.
GenePrimer Sequence (5′-3′)Amplicon Length (bp)Tm (°C)
TYRF: GTTTACCCAGCAGCCAATGC
R: TGGAAGGAGTCAACTGGGTCT		15260
TYRP1F: CTCCACACTGCTCCTTACAC
R: CTATTACGGCTACACATTGACC		17658
DCTF: GAGCTGCCAGTGTACAGGAAA
R: TCACATAGTCTGGGTGCGTG		19460
Ef1aF: ACTCGTCCAACTGACAAGCCTC
R: CACGGCGAACATCTTTCACAG		25360
Table 2. Information on the TYR gene family members.
Table 2. Information on the TYR gene family members.
GeneNumber of Amino AcidsMolecular WeightTheoretical pIInstability IndexAliphatic IndexGrand Average of HydropathicitySubcellular Localization
TYR52960,152.085.5651.5174.90−0.289Plasma membrane
TYRP153560,157.455.3549.7576.00−0.331Plasma membrane
DCT52659,858.206.4742.5574.01−0.326Plasma membrane
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Y.; Liu, P.; Ren, T.; Gao, Y.; Wang, Z.; Zhu, J.; Chen, C.; Ji, L.; Hong, X.; Liu, X.; et al. Genomic Features and Tissue Expression Profiles of the Tyrosinase Gene Family in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Genes 2025, 16, 834. https://doi.org/10.3390/genes16070834

AMA Style

Liu Y, Liu P, Ren T, Gao Y, Wang Z, Zhu J, Chen C, Ji L, Hong X, Liu X, et al. Genomic Features and Tissue Expression Profiles of the Tyrosinase Gene Family in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Genes. 2025; 16(7):834. https://doi.org/10.3390/genes16070834

Chicago/Turabian Style

Liu, Yanchao, Pan Liu, Tong Ren, Yang Gao, Ziman Wang, Junxian Zhu, Chen Chen, Liqin Ji, Xiaoyou Hong, Xiaoli Liu, and et al. 2025. "Genomic Features and Tissue Expression Profiles of the Tyrosinase Gene Family in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)" Genes 16, no. 7: 834. https://doi.org/10.3390/genes16070834

APA Style

Liu, Y., Liu, P., Ren, T., Gao, Y., Wang, Z., Zhu, J., Chen, C., Ji, L., Hong, X., Liu, X., Wei, C., Zhu, X., Chu, Z., & Li, W. (2025). Genomic Features and Tissue Expression Profiles of the Tyrosinase Gene Family in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Genes, 16(7), 834. https://doi.org/10.3390/genes16070834

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop