Identification and Potential Roles of Human MicroRNAs in Ebola Virus Infection and Disease Pathogenesis
Abstract
1. Introduction
2. Materials and Methods
2.1. Deep Sequencing Dataset Utilized
2.2. Differential Expression of Known Cellular miRNAs Using BWA
2.3. Differential Expression of Known and Novel Cellular miRNAs Using miRDeep2
2.4. Prediction of Gene Targets and Functional Analysis
3. Results
3.1. Identification of Known Cellular miRNAs Differentially Expressed in EBOV-Infected Human RPE Cells at 24 h Post Infection
3.2. miRDeep2 Identification of Known and Novel Cellular miRNAs Differentially Expressed in EBOV-Infected Human RPE Cells at 24 h Post Infection
3.3. miRNA Gene Target Prediction and Functional Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Letafati, A.; Salahi Ardekani, O.; Karami, H.; Soleimani, M. Ebola virus disease: A narrative review. Microb. Pathog. 2023, 181, 106213. [Google Scholar] [CrossRef]
- Feldmann, H.; Geisbert, T.W. Ebola haemorrhagic fever. Lancet 2011, 377, 849–862. [Google Scholar] [CrossRef]
- Center for Disease Control and Prevention Ebola Disease. Available online: https://www.cdc.gov/vhf/ebola/index.html (accessed on 28 December 2023).
- Jacob, S.T.; Crozier, I.; Fischer, W.A.; Hewlett, A.; Kraft, C.S.; Vega, M.D.L.; Soka, M.J.; Wahl, V.; Griffiths, A.; Bollinger, L. Ebola virus disease. Nat. Rev. Dis. Primers 2020, 6, 13. [Google Scholar] [CrossRef]
- Bettini, A.; Lapa, D.; Garbuglia, A.R. Diagnostics of Ebola virus. Front. Public Health 2023, 11, 1123024. [Google Scholar] [CrossRef]
- Rugarabamu, S.; Mboera, L.; Rweyemamu, M.; Mwanyika, G.; Lutwama, J.; Paweska, J.; Misinzo, G. Forty-two years of responding to Ebola virus outbreaks in Sub-Saharan Africa: A review. BMJ Glob. Health 2020, 5, e001955. [Google Scholar] [CrossRef]
- Rojas, M.; Monsalve, D.M.; Pacheco, Y.; Acosta-Ampudia, Y.; Ramírez-Santana, C.; Ansari, A.A.; Gershwin, M.E.; Anaya, J. Ebola virus disease: An emerging and re-emerging viral threat. J. Autoimmun. 2020, 106, 102375. [Google Scholar] [CrossRef] [PubMed]
- Falasca, L.; Agrati, C.; Petrosillo, N.; Di Caro, A.; Capobianchi, M.R.; Ippolito, G.; Piacentini, M. Molecular mechanisms of Ebola virus pathogenesis: Focus on cell death. Cell Death Differ. 2015, 22, 1250–1259. [Google Scholar] [CrossRef] [PubMed]
- Basler, C.F.; Wang, X.; Mühlberger, E.; Volchkov, V.; Paragas, J.; Klenk, H.; García-Sastre, A.; Palese, P. The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA 2000, 97, 12289–12294. [Google Scholar] [CrossRef]
- Reid, S.P.; Leung, L.W.; Hartman, A.L.; Martinez, O.; Shaw, M.L.; Carbonnelle, C.; Volchkov, V.E.; Nichol, S.T.; Basler, C.F. Ebola virus VP24 binds karyopherin α1 and blocks STAT1 nuclear accumulation. J. Virol. 2006, 80, 5156–5167. [Google Scholar] [CrossRef] [PubMed]
- Bosio, C.M.; Aman, M.J.; Grogan, C.; Hogan, R.; Ruthel, G.; Negley, D.; Mohamadzadeh, M.; Bavari, S.; Schmaljohn, A. Ebola and Marburg viruses replicate in monocyte-derived dendritic cells without inducing the production of cytokines and full maturation. J. Infect. Dis. 2003, 188, 1630–1638. [Google Scholar] [CrossRef] [PubMed]
- Mahanty, S.; Hutchinson, K.; Agarwal, S.; Mcrae, M.; Rollin, P.E.; Pulendran, B. Cutting Edge: Impairment of Dendritic Cells and Adaptive Immunity by Ebola and Lassa Viruses. J. Immunol. 2003, 170, 2797–2801. [Google Scholar] [CrossRef]
- Papenfort, K.; Melamed, S. Small RNAs, Large Networks: Posttranscriptional Regulons in Gram-Negative Bacteria. Annu. Rev. Microbiol. 2023, 77, 23–43. [Google Scholar] [CrossRef]
- Chen, X.; Rechavi, O. Plant and animal small RNA communications between cells and organisms. Nat. Rev. Mol. Cell Biol. 2022, 23, 185–203. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, Q.; Zhang, R.; Dai, X.; Chen, W.; Xing, D. Circulating microRNAs: Biomarkers of disease. Clin. Chim. Acta 2021, 516, 46–54. [Google Scholar] [CrossRef] [PubMed]
- Barbu, M.G.; Condrat, C.E.; Thompson, D.C.; Bugnar, O.L.; Cretoiu, D.; Toader, O.D.; Suciu, N.; Voinea, S.C. MicroRNA involvement in signaling pathways during viral infection. Front. Cell Dev. Biol. 2020, 8, 143. [Google Scholar] [CrossRef] [PubMed]
- Duy, J.; Koehler, J.W.; Honko, A.N.; Schoepp, R.J.; Wauquier, N.; Gonzalez, J.; Pitt, M.L.; Mucker, E.M.; Johnson, J.C.; O’Hearn, A. Circulating microRNA profiles of Ebola virus infection. Sci. Rep. 2016, 6, 24496. [Google Scholar] [CrossRef] [PubMed]
- Stefan, C.P.; Arnold, C.E.; Shoemaker, C.J.; Zumbrun, E.E.; Altamura, L.A.; Douglas, C.E.; Taylor-Howell, C.L.; Graham, A.S.; Delp, K.L.; Blancett, C.D. Transcriptomic analysis reveals host miRNAs correlated with immune gene dysregulation during fatal disease progression in the Ebola virus cynomolgus macaque disease model. Microorganisms 2021, 9, 665. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liang, H.; Chen, X.; Ke, Y.; Zhou, Z.; Yang, M.; Zen, K.; Yang, R.; Liu, C.; Zhang, C. An Ebola virus-encoded microRNA-like fragment serves as a biomarker for early diagnosis of Ebola virus disease. Cell Res. 2016, 26, 380–383. [Google Scholar] [CrossRef] [PubMed]
- Duy, J.; Honko, A.N.; Altamura, L.A.; Bixler, S.L.; Wollen-Roberts, S.; Wauquier, N.; O’Hearn, A.; Mucker, E.M.; Johnson, J.C.; Shamblin, J.D.; et al. Virus-encoded miRNAs in Ebola virus disease. Sci. Rep. 2018, 8, 6480. [Google Scholar] [CrossRef]
- Teng, Y.; Wang, Y.; Zhang, X.; Liu, W.; Fan, H.; Yao, H.; Lin, B.; Zhu, P.; Yuan, W.; Tong, Y.; et al. Systematic Genome-wide Screening and Prediction of microRNAs in EBOV During the 2014 Ebolavirus Outbreak. Sci. Rep. 2015, 5, 9912. [Google Scholar] [CrossRef]
- Liang, H.; Zhou, Z.; Zhang, S.; Zen, K.; Chen, X.; Zhang, C. Identification of Ebola virus microRNAs and their putative pathological function. Sci. China Life Sci. 2014, 57, 973–981. [Google Scholar] [CrossRef] [PubMed]
- Mishra, R.; Kumar, A.; Ingle, H.; Kumar, H. The interplay between viral-derived miRNAs and host immunity during infection. Front. Immunol. 2020, 10, 508824. [Google Scholar] [CrossRef] [PubMed]
- Diallo, I.; Ho, J.; Laffont, B.; Laugier, J.; Benmoussa, A.; Lambert, M.; Husseini, Z.; Soule, G.; Kozak, R.; Kobinger, G.P. Altered microRNA transcriptome in cultured human liver cells upon infection with Ebola virus. Int. J. Mol. Sci. 2021, 22, 3792. [Google Scholar] [CrossRef]
- Oliver, G.F.; Orang, A.V.; Appukuttan, B.; Marri, S.; Michael, M.Z.; Marsh, G.A.; Smith, J.R. Expression of microRNA in human retinal pigment epithelial cells following infection with Zaire ebolavirus. BMC Res. Notes 2019, 12, 639. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.R.; Todd, S.; Ashander, L.M.; Charitou, T.; Ma, Y.; Yeh, S.; Crozier, I.; Michael, M.Z.; Appukuttan, B.; Williams, K.A. Retinal pigment epithelial cells are a potential reservoir for Ebola virus in the human eye. Transl. Vis. Sci. Technol. 2017, 6, 12. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Li, J.; Fu, Y.; Zhao, Z.; Zhang, C.; Li, N.; Li, J.; Cheng, H.; Jin, X.; Lu, B. A rapid screen for host-encoded miRNAs with inhibitory effects against ebola virus using a transcription-and replication-competent virus-like particle system. Int. J. Mol. Sci. 2018, 19, 1488. [Google Scholar] [CrossRef]
- Afgan, E.; Baker, D.; Batut, B.; Van Den Beek, M.; Bouvier, D.; Čech, M.; Chilton, J.; Clements, D.; Coraor, N.; Grüning, B.A. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Res. 2018, 46, W537–W544. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Griffiths-Jones, S. miRBase: The microRNA sequence database. MicroRNA Protoc. 2006, 342, 129–138. [Google Scholar]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Krueger, F.; James, F.; Ewels, P.; Afyounian, E.; Weinstein, M.; Schuster-Boeckler, B.; Hulselmans, G. FelixKrueger/TrimGalore: v0.6.9—fix declaration bug. Zenodo 2023. [Google Scholar] [CrossRef]
- Friedländer, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012, 40, 37–52. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, X. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef]
- Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef] [PubMed]
- Simmons, G.; Wool-Lewis, R.J.; Baribaud, F.; Netter, R.C.; Bates, P. Ebola virus glycoproteins induce global surface protein down-modulation and loss of cell adherence. J. Virol. 2002, 76, 2518–2528. [Google Scholar] [CrossRef] [PubMed]
- Dube, D.; Schornberg, K.L.; Stantchev, T.S.; Bonaparte, M.I.; Delos, S.E.; Bouton, A.H.; Broder, C.C.; White, J.M. Cell adhesion promotes Ebola virus envelope glycoprotein-mediated binding and infection. J. Virol. 2008, 82, 7238–7242. [Google Scholar] [CrossRef] [PubMed]
- Simon, E.J.; Linstedt, A.D. Site-specific glycosylation of Ebola virus glycoprotein by human polypeptide GalNAc-transferase 1 induces cell adhesion defects. J. Biol. Chem. 2018, 293, 19866–19873. [Google Scholar] [CrossRef] [PubMed]
- Bhella, D. The role of cellular adhesion molecules in virus attachment and entry. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370, 20140035. [Google Scholar] [CrossRef] [PubMed]
- Francica, J.R.; Matukonis, M.K.; Bates, P. Requirements for cell rounding and surface protein down-regulation by Ebola virus glycoprotein. Virology 2009, 383, 237–247. [Google Scholar] [CrossRef] [PubMed]
- Price, A.; Okumura, A.; Haddock, E.; Feldmann, F.; Meade-White, K.; Sharma, P.; Artami, M.; Lipkin, W.I.; Threadgill, D.W.; Feldmann, H. Transcriptional correlates of tolerance and lethality in mice predict Ebola virus disease patient outcomes. Cell Rep. 2020, 30, 1702–1713.e6. [Google Scholar] [CrossRef] [PubMed]
- Jankeel, A.; Menicucci, A.R.; Woolsey, C.; Fenton, K.A.; Mendoza, N.; Versteeg, K.; Cross, R.W.; Geisbert, T.W.; Messaoudi, I. Early transcriptional changes within liver, adrenal gland, and lymphoid tissues significantly contribute to ebola virus pathogenesis in cynomolgus macaques. J. Virol. 2020, 94. [Google Scholar] [CrossRef]
- Qiu, S.; Leung, A.; Bo, Y.; Kozak, R.A.; Anand, S.P.; Warkentin, C.; Salambanga, F.D.; Cui, J.; Kobinger, G.; Kobasa, D. Ebola virus requires phosphatidylinositol (3, 5) bisphosphate production for efficient viral entry. Virology 2018, 513, 17–28. [Google Scholar] [CrossRef]
- Ljungberg, J.K.; Kling, J.C.; Tran, T.T.; Blumenthal, A. Functions of the WNT signaling network in shaping host responses to infection. Front. Immunol. 2019, 10, 2521. [Google Scholar] [CrossRef]
- Daud, M.; Rana, M.A.; Husnain, T.; Ijaz, B. Modulation of Wnt signaling pathway by hepatitis B virus. Arch. Virol. 2017, 162, 2937–2947. [Google Scholar] [CrossRef] [PubMed]
- van Zuylen, W.J.; Rawlinson, W.D.; Ford, C.E. The Wnt pathway: A key network in cell signalling dysregulated by viruses. Rev. Med. Virol. 2016, 26, 340–355. [Google Scholar] [CrossRef]
- Rashid, M.; Yousaf, S.; Sheikh, S.A.; Sajid, Z.; Shabbir, A.S.; Kausar, T.; Tariq, N.; Usman, M.; Shaikh, R.S.; Ali, M. Identities and frequencies of variants in CYP1B1 causing primary congenital glaucoma in Pakistan. Mol. Vis. 2019, 25, 144. [Google Scholar] [PubMed]
- Eghrari, A.O.; Bishop, R.J.; Ross, R.D.; Davis, B.; Larbelee, J.; Amegashie, F.; Dolo, R.F.; Prakalapakorn, S.G.; Gaisie, C.; Gargu, C. Characterization of Ebola Virus–Associated Eye Disease. JAMA Netw. Open 2021, 4, e2032216. [Google Scholar] [CrossRef]
- Saeed, M.F.; Kolokoltsov, A.A.; Freiberg, A.N.; Holbrook, M.R.; Davey, R.A. Phosphoinositide-3 kinase-Akt pathway controls cellular entry of Ebola virus. PLoS Pathog. 2008, 4, e1000141. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, M.; Halfmann, P.; Kawaoka, Y. HER2-mediated enhancement of Ebola virus entry. PLoS Pathog. 2020, 16, e1008900. [Google Scholar] [CrossRef] [PubMed]
- Furuyama, W.; Shifflett, K.; Feldmann, H.; Marzi, A. The Ebola virus soluble glycoprotein contributes to viral pathogenesis by activating the MAP kinase signaling pathway. PLoS Pathog. 2021, 17, e1009937. [Google Scholar] [CrossRef] [PubMed]
- Zampieri, C.A.; Fortin, J.; Nolan, G.P.; Nabel, G.J. The ERK mitogen-activated protein kinase pathway contributes to Ebola virus glycoprotein-induced cytotoxicity. J. Virol. 2007, 81, 1230–1240. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Ma, Y.; Chen, Y.; Pan, F. Role of Forkhead box O3a transcription factor in autoimmune diseases. Int. Immunopharmacol. 2021, 92, 107338. [Google Scholar] [CrossRef] [PubMed]
- Marcel, N.; Hedrick, S.M. A key control point in the T cell response to chronic infection and neoplasia: FOXO1. Curr. Opin. Immunol. 2020, 63, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Cheema, P.S.; Nandi, D.; Nag, A. Exploring the therapeutic potential of forkhead box O for outfoxing COVID-19. Open Biol. 2021, 11, 210069. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Zhang, R.; Fan, X.; Lian, Z.; Hu, Y. FoxOs could play an important role during influenza A viruses infection via microarray analysis based on GEO database. Infect. Genet. Evol. 2019, 75, 104009. [Google Scholar] [CrossRef]
- Kim, M.V.; Ouyang, W.; Liao, W.; Zhang, M.Q.; Li, M.O. The transcription factor Foxo1 controls central-memory CD8 T cell responses to infection. Immunity 2013, 39, 286–297. [Google Scholar] [CrossRef]
- Michelini, R.H.; Doedens, A.L.; Goldrath, A.W.; Hedrick, S.M. Differentiation of CD8 memory T cells depends on Foxo1. J. Exp. Med. 2013, 210, 1189–1200. [Google Scholar] [CrossRef]
- Nanbo, A.; Furuyama, W.; Lin, Z. RNA virus-encoded miRNAs: Current insights and future challenges. Front. Microbiol. 2021, 12, 679210. [Google Scholar] [CrossRef] [PubMed]
- Diallo, I.; Husseini, Z.; Guellal, S.; Vion, E.; Ho, J.; Kozak, R.A.; Kobinger, G.P.; Provost, P. Ebola Virus Encodes Two microRNAs in Huh7-Infected Cells. Int. J. Mol. Sci. 2022, 23, 5228. [Google Scholar] [CrossRef]
- Liu, Y.; Sun, J.; Zhang, H.; Wang, M.; Gao, G.F.; Li, X. Ebola virus encodes a miR-155 analog to regulate importin-α5 expression. Cell. Mol. Life Sci. 2016, 73, 3733–3744. [Google Scholar] [CrossRef]
- Vianello, E.; Persson, J.; Andersson, B.; van Veen, S.; Dias, T.L.; Santoro, F.; Östensson, M.; Obudulu, O.; Agbajogu, C.; Torkzadeh, S. Global blood miRNA profiling unravels early signatures of immunogenicity of Ebola vaccine rVSVΔG-ZEBOV-GP. iScience 2023, 26. [Google Scholar] [CrossRef]
- Fischer, T.; Spohn, M.; Olearo, F.; Zinser, M.E.; Kasonta, R.; Stubbe, H.C.; Rechtien, A.; Ly, M.L.; Schmiedel, S.; Lohse, A.W. Dynamic changes of circulating miRNAs induced by the Ebola virus vaccine VSV-EBOV. Vaccine 2018, 36, 7083–7094. [Google Scholar] [CrossRef]
- Miyashita, Y.; Yoshida, T.; Takagi, Y.; Tsukamoto, H.; Takashima, K.; Kouwaki, T.; Makino, K.; Fukushima, S.; Nakamura, K.; Oshiumi, H. Circulating extracellular vesicle microRNAs associated with adverse reactions, proinflammatory cytokine, and antibody production after COVID-19 vaccination. NPJ Vaccines 2022, 7, 16. [Google Scholar] [CrossRef]
- Lin, Y.; Hsieh, Y.; Cheng, M.; Shen, C.; Shen, C.; Cheng, C. Using MicroRNA Arrays as a Tool to Evaluate COVID-19 Vaccine Efficacy. Vaccines 2022, 10, 1681. [Google Scholar] [CrossRef]
- Momin, M.Y.; Gaddam, R.R.; Kravitz, M.; Gupta, A.; Vikram, A. The challenges and opportunities in the development of MicroRNA therapeutics: A multidisciplinary viewpoint. Cells 2021, 10, 3097. [Google Scholar] [CrossRef]
- Diener, C.; Keller, A.; Meese, E. Emerging concepts of miRNA therapeutics: From cells to clinic. Trends Genet. 2022, 38, 613–626. [Google Scholar] [CrossRef]
- Long, J.; Danesh, F.R. Promises and challenges of miRNA therapeutics. Am. J. Physiol.-Ren. Physiol. 2022, 323, F673–F674. [Google Scholar] [CrossRef]
GeneID | log2 (FC) | p-Value |
---|---|---|
hsa-miR-1296-3p | 1.91 | 1.10 × 10−8 |
hsa-miR-29b-3p * | 1.87 | 5.47 × 10−55 |
hsa-miR-33a-5p * | 1.87 | 1.29 × 10−13 |
hsa-miR-155-3p | 1.61 | 5.33 × 10−7 |
hsa-miR-1307-5p * | 1.55 | 1.03 × 10−19 |
hsa-miR-548a-3p | 1.52 | 3.65 × 10−6 |
hsa-miR-100-3p * | 1.33 | 5.14 × 10−65 |
hsa-miR-19a-5p | 1.32 | 1.70 × 10−6 |
hsa-miR-32-5p * | 1.30 | 9.81 × 10−14 |
hsa-miR-33b-3p | 1.29 | 9.98 × 10−18 |
hsa-miR-592 | 1.20 | 4.59 × 10−5 |
hsa-miR-7-5p | 1.18 | 7.58 × 10−33 |
hsa-miR-4521 * | 1.16 | 2.95 × 10−31 |
hsa-miR-33b-5p * | 1.14 | 3.41 × 10−10 |
hsa-miR-1305 * | 1.13 | 3.22 × 10−12 |
hsa-miR-1277-5p | 1.12 | 4.88 × 10−9 |
hsa-miR-365a-5p * | 1.07 | 3.98 × 10−8 |
hsa-miR-16-1-3p | 1.06 | 1.53 × 10−6 |
hsa-miR-101-5p | 1.02 | 2.53 × 10−20 |
hsa-miR-10392-5p | −1.04 | 1.67 × 10−3 |
hsa-miR-6735-3p | −1.06 | 1.43 × 10−3 |
hsa-miR-27b-5p * | −1.08 | 6.33 × 10−85 |
hsa-miR-1291 | −1.14 | 3.71 × 10−4 |
hsa-let-7c-3p | −1.21 | 3.22 × 10−5 |
hsa-miR-3917 | −1.38 | 3.46 × 10−5 |
hsa-miR-3074-3p * | −1.59 | 3.23 × 10−28 |
GeneID | log2 (FC) | p-Value |
---|---|---|
hsa-miR-29b-2-5p | 1.80 | 3.98 × 10−51 |
hsa-miR-29b-1-5p | 1.79 | 3.69 × 10−65 |
hsa-miR-33b-5p | 1.31 | 5.05 × 10−25 |
hsa-miR-1305 | 1.06 | 2.30 × 10−11 |
GeneID | log2 (FC) | p-Value | Sequence |
---|---|---|---|
NC_060925.1:203674252..203674274 | 5.61 | 1.76 × 10−5 | aaaugagaaaggcugucgugacu |
NC_060929.1:151642371..151642392 | 3.54 | 1.39 × 10−3 | caaaaauuguaauuacuuuggc |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mensah-Bonsu, M.; Doss, C.; Gloster, C.; Muganda, P. Identification and Potential Roles of Human MicroRNAs in Ebola Virus Infection and Disease Pathogenesis. Genes 2024, 15, 403. https://doi.org/10.3390/genes15040403
Mensah-Bonsu M, Doss C, Gloster C, Muganda P. Identification and Potential Roles of Human MicroRNAs in Ebola Virus Infection and Disease Pathogenesis. Genes. 2024; 15(4):403. https://doi.org/10.3390/genes15040403
Chicago/Turabian StyleMensah-Bonsu, Melvin, Christopher Doss, Clay Gloster, and Perpetua Muganda. 2024. "Identification and Potential Roles of Human MicroRNAs in Ebola Virus Infection and Disease Pathogenesis" Genes 15, no. 4: 403. https://doi.org/10.3390/genes15040403
APA StyleMensah-Bonsu, M., Doss, C., Gloster, C., & Muganda, P. (2024). Identification and Potential Roles of Human MicroRNAs in Ebola Virus Infection and Disease Pathogenesis. Genes, 15(4), 403. https://doi.org/10.3390/genes15040403