Biosystem Analysis of the Hypoxia Inducible Domain Family Member 2A: Implications in Cancer Biology
Abstract
:1. Introduction
2. Materials and Methods
2.1. Datasets
2.2. In Silico Analysis
2.3. Immunofluorescence and Confocal Microscopy
2.4. Isolation of Mitochondria and Nucleus, and Western Blot
2.5. Animals
2.6. Reverse Transcription and Quantitative Real-Time PCR (qRT-PCR)
2.7. Statistical Analysis
3. Results
3.1. Structural Features of HIG2A Protein
3.2. Genetic Features of HIGD2A Gene in Cancer
3.3. Study of the Datasets of HIGD2A Expression in Diffuse Large B-cell Lymphoma by Profiling Arrays with Gene Expression Omnibus
3.4. Effect of Quercetin on the Expression of Higd2a in Mouse Bone Marrow, Liver and Spleen
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Porporato, P.E.; Filigheddu, N.; Pedro, J.M.B.-S.; Kroemer, G.; Galluzzi, L. Mitochondrial metabolism and cancer. Cell Res. 2018, 28, 265–280. [Google Scholar] [CrossRef] [PubMed]
- Sabharwal, S.S.; Schumacker, P.T. Mitochondrial ROS in cancer: Initiators, amplifiers or an Achilles’ heel? Nat. Rev. Cancer 2014, 14, 709–721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaude, E.; Frezza, C. Defects in mitochondrial metabolism and cancer. Cancer Metab. 2014, 2, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Czabotar, P.E.; Lessene, G.; Strasser, A.; Adams, J.M. Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy. Nat. Rev. Mol. Cell Biol. 2014, 15, 49–63. [Google Scholar] [CrossRef]
- Gracey, A.Y.; Troll, J.V.; Somero, G.N. Hypoxia-induced gene expression profiling in the euryoxic fish Gillichthys mirabilis. Proc. Natl. Acad. Sci. USA 2001, 98, 1993–1998. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.-C.; Taylor, E.B.; Dephoure, N.; Heo, J.-M.; Tonhato, A.; Papandreou, L.; Nath, N.; Denko, N.C.; Gygi, S.P.; Rutter, J. Identification of a Protein Mediating Respiratory Supercomplex Stability. Cell Metab. 2012, 15, 348–360. [Google Scholar] [CrossRef] [Green Version]
- Rieger, B.; Shalaeva, D.N.; Söhnel, A.-C.; Kohl, W.; Duwe, P.; Mulkidjanian, A.Y.; Busch, K.B. Lifetime imaging of GFP at CoxVIIIa reports respiratory supercomplex assembly in live cells. Sci. Rep. 2017, 7, 46055. [Google Scholar] [CrossRef]
- Salazar, C.; Elorza, A.A.; Cofre, G.; Ruiz-Hincapie, P.; Shirihai, O.; Ruiz, L.M. The OXPHOS supercomplex assembly factor HIG2A responds to changes in energetic metabolism and cell cycle. J. Cell. Physiol. 2019, 234, 17405–17419. [Google Scholar] [CrossRef]
- Blanchet, E.; Annicotte, J.-S.; Lagarrigue, S.; Aguilar, V.; Clape, C.; Chavey, C.; Fritz, V.; Casas, F.; Apparailly, F.; Auwerx, J.; et al. E2F transcription factor-1 regulates oxidative metabolism. Nat. Cell Biol. 2011, 13, 1146–1152. [Google Scholar] [CrossRef] [Green Version]
- Fajas, L.; Landsberg, R.L.; Huss-Garcia, Y.; Sardet, C.; Lees, J.A.; Auwerx, J. E2Fs regulate adipocyte differentiation. Dev. Cell 2002, 3, 39–49. [Google Scholar] [CrossRef] [Green Version]
- Johannsdottir, H.K.; Jonsson, G.; Johannesdottir, G.; Agnarsson, B.A.; Eerola, H.; Arason, A.; Heikkila, P.; Egilsson, V.; Olsson, H.; Johannsson, O.T.; et al. Chromosome 5 imbalance mapping in breast tumors from BRCA1 and BRCA2 mutation carriers and sporadic breast tumors. Int. J. Cancer 2006, 119, 1052–1060. [Google Scholar] [CrossRef] [PubMed]
- Kram, A.; Li, L.; Zhang, R.D.; Yoon, D.S.; Ro, J.Y.; Johnston, D.; Grossman, H.B.; Scherer, S.; Czerniak, B. Mapping and Genome Sequence Analysis of Chromosome 5 Regions Involved in Bladder Cancer Progression. Lab. Investig. 2001, 81, 1039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Westbrook, C.A.; Keinänen, M.J. Myeloid malignancies and chromosome 5 deletions. Baillière’s Clin. Haematol. 1992, 5, 931–942. [Google Scholar] [CrossRef]
- Wu, X.; Zhao, Y.; Kemp, B.L.; Amos, C.I.; Siciliano, M.J.; Spitz, M.R. Chromosome 5 aberrations and genetic predisposition to lung cancer. Int. J. Cancer 1998, 79, 490–493. [Google Scholar] [CrossRef]
- Luo, J.; Emanuele, M.J.; Li, D.; Creighton, C.J.; Schlabach, M.R.; Westbrook, T.F.; Wong, K.-K.; Elledge, S.J. A Genome-wide RNAi Screen Identifies Multiple Synthetic Lethal Interactions with the Ras Oncogene. Cell 2009, 137, 835–848. [Google Scholar] [CrossRef] [Green Version]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef] [Green Version]
- Gene Expression Omnibus (GEO) Repository. Available online: http://www.ncbi.nlm.nih.gov/geoprofiles/ (accessed on 14 April 2019).
- Bhalla, K.; Jaber, S.; Nahid, M.N.; Underwood, K.; Beheshti, A.; Landon, A.; Bhandary, B.; Bastian, P.; Evens, A.M.; Haley, J.; et al. Role of hypoxia in Diffuse Large B-cell Lymphoma: Metabolic repression and selective translation of HK2 facilitates development of DLBCL. Sci. Rep. 2018, 8, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Gómez-Abad, C.; Pisonero, H.; Blanco-Aparicio, C.; Roncador, G.; González-Menchén, A.; Martinez-Climent, J.A.; Mata, E.; Rodríguez, M.E.; Muñoz-González, G.; Sánchez-Beato, M.; et al. PIM2 inhibition as a rational therapeutic approach in B-cell lymphoma. Blood 2011, 118, 5517. [Google Scholar] [CrossRef] [Green Version]
- Brune, V.; Tiacci, E.; Pfeil, I.; Döring, C.; Eckerle, S.; van Noesel, C.J.M.; Klapper, W.; Falini, B.; von Heydebreck, A.; Metzler, D.; et al. Origin and pathogenesis of nodular lymphocyte-predominant Hodgkin lymphoma as revealed by global gene expression analysis. J. Exp. Med. 2008, 205, 2251–2268. [Google Scholar] [CrossRef]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Green Version]
- Bienert, S.; Waterhouse, A.; de Beer, T.A.P.; Tauriello, G.; Studer, G.; Bordoli, L.; Schwede, T. The SWISS-MODEL Repository-new features and functionality. Nucleic Acids Res. 2017, 45, D313–D319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laskowski, R.A.; MacArthur, M.W.; Moss, D.S.; Thornton, J.M. PROCHECK: A program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283–291. [Google Scholar] [CrossRef]
- Huang, W.-Y.; Hsu, S.-D.; Huang, H.-Y.; Sun, Y.-M.; Chou, C.-H.; Weng, S.-L.; Huang, H.-D. MethHC: A database of DNA methylation and gene expression in human cancer. Nucleic Acids Res. 2015, 43, D856–D861. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, L.M.; Salazar, C.; Jensen, E.; Ruiz, P.A.; Tiznado, W.; Quintanilla, R.A.; Barreto, M.; Elorza, A.A. Quercetin Affects Erythropoiesis and Heart Mitochondrial Function in Mice. Oxidative Med. Cell. Longev. 2015, 2015, 836301. [Google Scholar] [CrossRef]
- Reddy, C.S.; Vijayasarathy, K.; Srinivas, E.; Sastry, G.M.; Sastry, G.N. Homology modeling of membrane proteins: A critical assessment. Comput. Biol. Chem. 2006, 30, 120–126. [Google Scholar] [CrossRef]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef] [Green Version]
- Kosugi, S.; Hasebe, M.; Tomita, M.; Yanagawa, H. cNLS Mapper: Prediction of Importin α-Dependent Nuclear Localization Signals. Available online: http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi (accessed on 15 May 2019).
- Kosugi, S.; Hasebe, M.; Tomita, M.; Yanagawa, H. Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc. Natl. Acad. Sci. USA 2009, 106, 10171. [Google Scholar] [CrossRef] [Green Version]
- Vaca Jacome, A.S.; Rabilloud, T.; Schaeffer-Reiss, C.; Rompais, M.; Ayoub, D.; Lane, L.; Bairoch, A.; Van Dorsselaer, A.; Carapito, C. N-terminome analysis of the human mitochondrial proteome. Proteomics 2015, 15, 2519–2524. [Google Scholar] [CrossRef]
- Sui, S.; Wang, J.; Yang, B.; Song, L.; Zhang, J.; Chen, M.; Liu, J.; Lu, Z.; Cai, Y.; Chen, S.; et al. Phosphoproteome analysis of the human Chang liver cells using SCX and a complementary mass spectrometric strategy. Proteomics 2008, 8, 2024–2034. [Google Scholar] [CrossRef]
- Chen, L.; Ma, Y.; Qian, L.; Wang, J. Sumoylation regulates nuclear localization and function of zinc finger transcription factor ZIC3. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2013, 1833, 2725–2733. [Google Scholar] [CrossRef] [Green Version]
- Du, J.X.; Bialkowska, A.B.; McConnell, B.B.; Yang, V.W. SUMOylation regulates nuclear localization of Krüppel-like factor 5. J. Biol. Chem. 2008, 283, 31991–32002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palczewska, M.; Casafont, I.; Ghimire, K.; Rojas, A.M.; Valencia, A.; Lafarga, M.; Mellström, B.; Naranjo, J.R. Sumoylation regulates nuclear localization of repressor DREAM. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2011, 1813, 1050–1058. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Li, J.; Dong, F.N.; Dong, J.-T. Characterization of nuclear localization and SUMOylation of the ATBF1 transcription factor in epithelial cells. PLoS ONE 2014, 9, e92746. [Google Scholar] [CrossRef] [PubMed]
- Sondka, Z.; Bamford, S.; Cole, C.G.; Ward, S.A.; Dunham, I.; Forbes, S.A. The COSMIC Cancer Gene Census: Describing genetic dysfunction across all human cancers. Nat. Rev. Cancer 2018, 18, 696–705. [Google Scholar] [CrossRef] [PubMed]
- Abbott, K.L.; Nyre, E.T.; Abrahante, J.; Ho, Y.-Y.; Isaksson Vogel, R.; Starr, T.K. The Candidate Cancer Gene Database: A database of cancer driver genes from forward genetic screens in mice. Nucleic Acids Res. 2014, 43, D844–D848. [Google Scholar] [CrossRef] [Green Version]
- Flavahan, W.A.; Gaskell, E.; Bernstein, B.E. Epigenetic plasticity and the hallmarks of cancer. Science 2017, 357, eaal2380. [Google Scholar] [CrossRef] [Green Version]
- Chou, C.-H.; Shrestha, S.; Yang, C.-D.; Chang, N.-W.; Lin, Y.-L.; Liao, K.-W.; Huang, W.-C.; Sun, T.-H.; Tu, S.-J.; Lee, W.-H.; et al. miRTarBase update 2018: A resource for experimentally validated microRNA-target interactions. Nucleic Acids Res. 2018, 46, D296–D302. [Google Scholar] [CrossRef]
- Mishra, S.; Yadav, T.; Rani, V. Exploring miRNA based approaches in cancer diagnostics and therapeutics. Crit. Rev. Oncol./Hematol. 2016, 98, 12–23. [Google Scholar] [CrossRef]
- Riley, K.J.; Rabinowitz, G.S.; Yario, T.A.; Luna, J.M.; Darnell, R.B.; Steitz, J.A. EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012, 31, 2207–2221. [Google Scholar] [CrossRef]
- Coiffier, B. Rituximab therapy in malignant lymphoma. Oncogene 2007, 26, 3603. [Google Scholar] [CrossRef] [Green Version]
- Chapuy, B.; Stewart, C.; Dunford, A.J.; Kim, J.; Kamburov, A.; Redd, R.A.; Lawrence, M.S.; Roemer, M.G.M.; Li, A.J.; Ziepert, M.; et al. Molecular subtypes of diffuse large B cell lymphoma are associated with distinct pathogenic mechanisms and outcomes. Nat. Med. 2018, 24, 679–690. [Google Scholar] [CrossRef] [PubMed]
- Monti, S.; Savage, K.J.; Kutok, J.L.; Feuerhake, F.; Kurtin, P.; Mihm, M.; Wu, B.; Pasqualucci, L.; Neuberg, D.; Aguiar, R.C.T.; et al. Molecular profiling of diffuse large B-cell lymphoma identifies robust subtypes including one characterized by host inflammatory response. Blood 2005, 105, 1851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alizadeh, A.A.; Eisen, M.B.; Davis, R.E.; Ma, C.; Lossos, I.S.; Rosenwald, A.; Boldrick, J.C.; Sabet, H.; Tran, T.; Yu, X.; et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 2000, 403, 503–511. [Google Scholar] [CrossRef] [PubMed]
- Caro, P.; Kishan, A.U.; Norberg, E.; Stanley, I.A.; Chapuy, B.; Ficarro, S.B.; Polak, K.; Tondera, D.; Gounarides, J.; Yin, H.; et al. Metabolic signatures uncover distinct targets in molecular subsets of diffuse large B cell lymphoma. Cancer Cell 2012, 22, 547–560. [Google Scholar] [CrossRef] [Green Version]
- Gooptu, M.; Whitaker-Menezes, D.; Sprandio, J.; Domingo-Vidal, M.; Lin, Z.; Uppal, G.; Gong, J.; Fratamico, R.; Leiby, B.; Dulau-Florea, A.; et al. Mitochondrial and glycolytic metabolic compartmentalization in diffuse large B-cell lymphoma. Semin. Oncol. 2017, 44, 204–217. [Google Scholar] [CrossRef]
- Sha, C.; Barrans, S.; Cucco, F.; Bentley, M.A.; Care, M.A.; Cummin, T.; Kennedy, H.; Thompson, J.S.; Uddin, R.; Worrillow, L.; et al. Molecular High-Grade B-Cell Lymphoma: Defining a Poor-Risk Group That Requires Different Approaches to Therapy. J. Clin. Oncol. 2018, 37, 202–212. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.V.S.K.; Varambally, S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef]
- Baccan, M.M.; Chiarelli-Neto, O.; Pereira, R.M.S.; Espósito, B.P. Quercetin as a shuttle for labile iron. J. Inorg. Biochem. 2012, 107, 34–39. [Google Scholar] [CrossRef]
- Lee, T.-J.; Kim, O.H.; Kim, Y.H.; Lim, J.H.; Kim, S.; Park, J.-W.; Kwon, T.K. Quercetin arrests G2/M phase and induces caspase-dependent cell death in U937 cells. Cancer Lett. 2006, 240, 234–242. [Google Scholar] [CrossRef]
- Jeong, J.H.; An, J.Y.; Kwon, Y.T.; Rhee, J.G.; Lee, Y.J. Effects of low dose quercetin: Cancer cell-specific inhibition of cell cycle progression. J. Cell. Biochem. 2009, 106, 73–82. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Wang, X.; Zhang, M.; Li, A.; Sun, Z.; Yu, Q. Quercetin potentiates the antitumor activity of rituximab in diffuse large B-cell lymphoma by inhibiting STAT3 pathway. Cell Biochem. Biophys. 2014, 70, 1357–1362. [Google Scholar] [CrossRef]
- Mangnall, D.; Bird, N.C.; Majeed, A.W. The molecular physiology of liver regeneration following partial hepatectomy. Liver Int. 2003, 23, 124–138. [Google Scholar] [CrossRef] [Green Version]
- Khurana, S. The effects of proliferation and DNA damage on hematopoietic stem cell function determine aging. Dev. Dyn. 2016, 245, 739–750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spencer, J.A.; Ferraro, F.; Roussakis, E.; Klein, A.; Wu, J.; Runnels, J.M.; Zaher, W.; Mortensen, L.J.; Alt, C.; Turcotte, R.; et al. Direct measurement of local oxygen concentration in the bone marrow of live animals. Nature 2014, 508, 269–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haase, V.H. Hypoxic regulation of erythropoiesis and iron metabolism. Am. J. Physiol. Ren. Physiol. 2010, 299, F1–F13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyapichev, K.A.; Chapman, J.R.; Iakymenko, O.; Ikpatt, O.F.; Teomete, U.; Sanchez, S.P.; Vega, F. Bone Marrow-Liver-Spleen Type of Large B-Cell Lymphoma Associated with Hemophagocytic Syndrome: A Rare Aggressive Extranodal Lymphoma. Case Rep. Hematol. 2017, 2017, 8496978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yeh, Y.-M.; Chang, K.-C.; Chen, Y.-P.; Kao, L.-Y.; Tsai, H.-P.; Ho, C.-L.; Wang, J.-R.; Jones, D.; Chen, T.-Y. Large B cell lymphoma presenting initially in bone marrow, liver and spleen: An aggressive entity associated frequently with haemophagocytic syndrome. Histopathology 2010, 57, 785–795. [Google Scholar] [CrossRef]
- Knutson, M.D. Iron transport proteins: Gateways of cellular and systemic iron homeostasis. J. Biol. Chem. 2017, 292, 12735–12743. [Google Scholar] [CrossRef] [Green Version]
- Caldwell, C.C.; Kojima, H.; Lukashev, D.; Armstrong, J.; Farber, M.; Apasov, S.G.; Sitkovsky, M.V. Differential Effects of Physiologically Relevant Hypoxic Conditions on T Lymphocyte Development and Effector Functions. J. Immunol. 2001, 167, 6140. [Google Scholar] [CrossRef]
- Godoy, P.; Hewitt, N.J.; Albrecht, U.; Andersen, M.E.; Ansari, N.; Bhattacharya, S.; Bode, J.G.; Bolleyn, J.; Borner, C.; Böttger, J.; et al. Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Arch. Toxicol. 2013, 87, 1315–1530. [Google Scholar] [CrossRef] [Green Version]
- Bensaad, K.; Harris, A.L. Hypoxia and Metabolism in Cancer. In Tumor Microenvironment and Cellular Stress. Advances in Experimental Medicine and Biology; Koumenis, C., Hammond, E., Giaccia, A., Eds.; Springer: New York, NY, USA, 2014; Volume 772, pp. 1–39. [Google Scholar]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Snyder, C.M.; Chandel, N.S. Mitochondrial regulation of cell survival and death during low-oxygen conditions. Antioxid. Redox Signal. 2009, 11, 2673–2683. [Google Scholar] [CrossRef] [Green Version]
- Pang, X.-G.; Cong, Y.; Bao, N.-R.; Li, Y.-G.; Zhao, J.-N. Quercetin Stimulates Bone Marrow Mesenchymal Stem Cell Differentiation through an Estrogen Receptor-Mediated Pathway. BioMed. Res. Int. 2018, 2018, 4178021. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wu, Y.; Jiang, X.; Zhang, X.; Xia, L.; Lin, K.; Xu, Y. The Effect of Quercetin on the Osteogenesic Differentiation and Angiogenic Factor Expression of Bone Marrow-Derived Mesenchymal Stem Cells. PLoS ONE 2015, 10, e0129605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casado-Díaz, A.; Anter, J.; Dorado, G.; Quesada-Gómez, J.M. Effects of quercetin, a natural phenolic compound, in the differentiation of human mesenchymal stem cells (MSC) into adipocytes and osteoblasts. J. Nutr. Biochem. 2016, 32, 151–162. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Hou, X.; Fan, F.; Wu, H. Quercetin stimulates mitochondrial apoptosis dependent on activation of endoplasmic reticulum stress in hepatic stellate cells. Pharm. Biol. 2016, 54, 3237–3243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larocca, L.M.; Teofili, L.; Leone, G.; Sica, S.; Pierelli, L.; Menichella, G.; Scambia, G.; Benedetti Panici, P.; Ricci, R.; Piantelli, M.; et al. Antiproliferative activity of quercetin on normal bone marrow and leukaemic progenitors. Br. J. Haematol. 1991, 79, 562–566. [Google Scholar] [CrossRef] [PubMed]
- López-Posadas, R.; Ballester, I.; Abadía-Molina, A.C.; Suárez, M.D.; Zarzuelo, A.; Martínez-Augustin, O.; Sánchez de Medina, F. Effect of flavonoids on rat splenocytes, a structure–activity relationship study. Biochem. Pharmacol. 2008, 76, 495–506. [Google Scholar] [CrossRef] [PubMed]
Ramachandran Plot Quality (%) | Goodness Factor | ||||||
---|---|---|---|---|---|---|---|
Most Favored | Additional Allowed | Generously Allowed | Dis-Allowed | Dihedral | Covalent | Overall | |
Model-1A | 70.3 | 21.9 | 7.8 | 0.0 | −0.30 | −0.31 | −0.29 |
Model-1B | 70.4 | 23.9 | 4.2 | 1.4 | −0.27 | −0.22 | −0.23 |
miRNA. (Accession ID) | Mature miRNA Sequence | miRNA-Target Expression Profile (TCGA) | ||
---|---|---|---|---|
Tumor (n) | R (Pearson Correlation) | p-Value | ||
hsa-mir-181a-2 (MIRT256742 [miRNA, hsa-miR-181a-5p :: HIGD2A, target gene]) | 39| AACAUUCAACGCUGUCGGUGAGU |61 | KICH (25) | 0.346 | 0.05 |
PRAD (50) | −0.239 | 0.05 | ||
hsa-mir-181b-1 (MIRT256743 [miRNA, hsa-miR-181b-5p :: HIGD2A, target gene]) | 36| AACAUUCAUUGCUGUCGGUGGGU |58 | HNSC (42) | −0.409 | 3.6 × 10−3 |
BRCA (84) | −0.258 | 8.9 × 10−3 | ||
KICH (25) | 0.374 | 0.03 | ||
LUSC (38) | −0.276 | 0.05 | ||
KIRP (32) | 0.296 | 0.05 | ||
hsa-mir-181c (MIRT256744 [miRNA, hsa-miR-181c-5p :: HIGD2A, target gene]) | 27| AACAUUCAACCUGUCGGUGAGU |48 | BRCA (84) | −0.312 | 1.9 × 10−3 |
LIHC (49) | 0.283 | 0.02 | ||
CHOL (9) | 0.642 | 0.03 | ||
LUSC (38) | −0.302 | 0.03 | ||
KICH (25) | 0.346 | 0.05 | ||
hsa-miR-181d (MIRT256746 [miRNA, hsa-miR-181d-5p :: HIGD2A, target gene]) | 36| AACAUUCAUUGUUGUCGGUGGGU |58 | BRCA (84) | −0.379 | 1.9 × 10−4 |
LUSC (38) | −0.389 | 7.9 × 10−3 | ||
LIHC (49) | 0.236 | 0.05 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salazar, C.; Yañez, O.; Elorza, A.A.; Cortes, N.; García-Beltrán, O.; Tiznado, W.; Ruiz, L.M. Biosystem Analysis of the Hypoxia Inducible Domain Family Member 2A: Implications in Cancer Biology. Genes 2020, 11, 206. https://doi.org/10.3390/genes11020206
Salazar C, Yañez O, Elorza AA, Cortes N, García-Beltrán O, Tiznado W, Ruiz LM. Biosystem Analysis of the Hypoxia Inducible Domain Family Member 2A: Implications in Cancer Biology. Genes. 2020; 11(2):206. https://doi.org/10.3390/genes11020206
Chicago/Turabian StyleSalazar, Celia, Osvaldo Yañez, Alvaro A. Elorza, Natalie Cortes, Olimpo García-Beltrán, William Tiznado, and Lina María Ruiz. 2020. "Biosystem Analysis of the Hypoxia Inducible Domain Family Member 2A: Implications in Cancer Biology" Genes 11, no. 2: 206. https://doi.org/10.3390/genes11020206
APA StyleSalazar, C., Yañez, O., Elorza, A. A., Cortes, N., García-Beltrán, O., Tiznado, W., & Ruiz, L. M. (2020). Biosystem Analysis of the Hypoxia Inducible Domain Family Member 2A: Implications in Cancer Biology. Genes, 11(2), 206. https://doi.org/10.3390/genes11020206