Identification of Functional Transcriptional Binding Sites within Chicken Abcg2 Gene Promoter and Screening Its Regulators
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmid and Drugs
2.2. Cell Lines and Primary Embryonic Hepatocytes
2.3. Amplification and Sequence Analysis of the Promoter Region of the Chicken Abcg2 Gene
2.4. Construction of Reporter Plasmids
2.5. Luciferase Reporter Assay
2.6. RT-PCR
2.7. Drug Accumulation Assay
2.8. Statistical Analysis
3. Results
3.1. Several Transcription Factor Binding Sites and CpG Islands Were Predicted and Analyzed in the Chicken Abcg2 Gene Promotor
3.2. The Core Regions of the Chicken Abcg2 Gene Promotor Were Identified Using the Dual Luciferase Reporter Assay System
3.3. Several Regulatory Elements Were Recognized in the Chicken Abcg2 Gene Promoter by Site-Directed Mutagenesis
3.4. Some Xenobiotics Could Alter the Activity of the Chicken Abcg2 Gene Promoter
3.5. Xenobiotics Changed the Chicken Abcg2 mRNA Levels and BCRP Transport Function Related to Their Activities on the Abcg2 Promoter
3.6. Xenobiotics Regulate Activity Levels of the Chicken Abcg2 Gene Promoter Through Different Response Elements, Proven by Deletion and Site-Directed Mutagenic Analysis
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Wen, J.H.; Hua, W.X.; Fang, H.J. The Role of OATP1B1 and BCRP in Pharmacokinetics and DDI of Novel Statins. Cardiovasc. Ther. 2012, 30, e234–e241. [Google Scholar]
- Lempers, V.J.C.; Heuvel, J.J.M.W.V.D.; Russel, F.G.M.; Aarnoutse, R.E.; Burger, D.M.; Brüggemann, R.J.; Koenderink, J.B. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP. Antimicrob. Agents Chemother. 2016, 60, 3372–3379. [Google Scholar] [CrossRef] [PubMed]
- Szilagyi, J.T.; Vetrano, A.M.; Laskin, J.D.; Aleksunes, L.M. Localization of the placental BCRP/ABCG2 transporter to lipid rafts: Role for cholesterol in mediating efflux activity. Placenta 2017, 55, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Guo, T.; Huang, J.; Zhang, H.; Dong, L.; Guo, D.; Guo, L.; He, F.; Bhutto, Z.A.; Wang, L. Abcb1 in Pigs: Molecular cloning, tissues distribution, functional analysis, and its effect on pharmacokinetics of enrofloxacin. Sci. Rep. 2016, 6. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Jin, H.; Zhao, Z. Paracellular tightness and the functional expression of efflux transporters P-gp and BCRP in bEnd3 cells. Neurol. Res. 2018, 40, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, L.; Xiao, Q.; Jiang, L.; He, M.; Bai, X.; Ma, M.; Jiao, X.; Wei, M. miR-302a/b/c/d cooperatively inhibit BCRP expression to increase drug sensitivity in breast cancer cells. Gynecol. Oncol. 2016, 141, 592–601. [Google Scholar] [CrossRef]
- Giacomini, K.M.; Huang, S.-M. Transporters in Drug Development and Clinical Pharmacology. Clin. Pharmacol. Ther. 2013, 94, 3–9. [Google Scholar] [CrossRef]
- Bircsak, K.M.; Moscovitz, J.E.; Wen, X.; Archer, F.; Pys, Y.; Mohammed, M.; Memon, N.; Weinberger, B.I.; Saba, L.M.; Vetrano, A.M. Interindividual regulation of the BCRP/ABCG2 transporter in term human placentas. Drug Metab. Dispos. 2018, 46, 619–627. [Google Scholar] [CrossRef]
- Francois, L.N.; Gorczyca, L.; Du, J.; Bircsak, K.M.; Yen, E.; Wen, X.; Tu, M.-J.; Yu, A.-M.; Illsley, N.P.; Zamudio, S.; et al. Down-regulation of the placental BCRP/ABCG2 transporter in response to hypoxia signaling. Placenta 2017, 51, 57–63. [Google Scholar] [CrossRef]
- Jiro, O.; Masaki, K.; Shirou, I.; Takeshi, H.; Ken, I. Post-transcriptional regulation of breast cancer resistance protein after intestinal ischemia-reperfusion. Biol. Pharm. Bull. 2008, 31, 1032–1035. [Google Scholar]
- Takashi, S.; Tsuyoshi, S.; Shingo, S.; Takashi, S.; Tomoaki, K.; Mary Ann, S.; Hiroyuki, K.; Yuichi, S.; Cyr, D.M.; Hirofumi, K. Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1. Biochem. Biophys. Res. Commun. 2011, 404, 853–858. [Google Scholar]
- Brackman, D.J.; Giacomini, K.M. Reverse Translational Research of ABCG2 (BCRP) in Human Disease and Drug Response. Clin. Pharmacol. Ther. 2018, 103, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, T.; Ross, U.D. Breast cancer resistance protein (BCRP/ABCG2): Its role in multidrug resistance and regulation of its gene expression. Chin. J. Cancer 2012, 31, 73–99. [Google Scholar] [CrossRef] [PubMed]
- Yuhua, Z.; Huaiping, W.; Lijing, W.; Guang, L.; Jin, Y.; Yan, G.; Peng, G.; Xiaofang, Z.; Fulan, W.; Deling, Y. Transcriptional modulation of BCRP gene to reverse multidrug resistance by toremifene in breast adenocarcinoma cells. Breast Cancer Res. Treat. 2010, 123, 679–689. [Google Scholar]
- Natarajan, K.; Xie, Y.; Nakanishi, T.; Moreci, R.S.; Jeyasuria, P.; Hussain, A.; Ross, U.D. Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1. J. Vis. Exp. 2016. [Google Scholar] [CrossRef]
- Bailey-Dell, K.J.; Hassel, B.; Doyle, L.A.; Ross, D.D. Promoter characterization and genomic organization of the human breast cancer resistance protein (ATP-binding cassette transporter G2) gene 1. BBA-Gene Struct. Expr. 2001, 1520, 234–241. [Google Scholar] [CrossRef]
- Szatmari, I.; Vámosi, G.; Brazda, P.; Balint, B.L.; Benkö, S.; Szeles, L.; Jeney, V.; Ozvegy-Laczka, C.; Szanto, A.; Barta, E.; et al. Peroxisome Proliferator-activated Receptor -regulated ABCG2 Expression Confers Cytoprotection to Human Dendritic Cells. J. Boil. Chem. 2006, 281, 23812–23823. [Google Scholar] [CrossRef]
- Benoki, S.; Yoshinari, K.; Chikada, T.; Imai, J.; Yamazoe, Y. Transactivation of ABCG2 through a novel cis-element in the distal promoter by constitutive androstane receptor but not pregnane X receptor in human hepatocytes. Arch. Biochem. Biophys. 2012, 517, 123–130. [Google Scholar] [CrossRef]
- Hamdan, A.M.; Koyanagi, S.; Wada, E.; Kusunose, N.; Ohdo, S. Intestinal expression of mouse Abcg2/Bcrp gene is under the control of circadian clock-activating transcription factor-4 pathway. J. Biol. Chem. 2012, 287, 17224–17231. [Google Scholar] [CrossRef]
- Nishihashi, K.; Kawashima, K.; Nomura, T.; Urakami-Takebayashi, Y.; Miyazaki, M.; Takano, M.; Nagai, J. Cobalt Chloride Induces Expression and Function of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Renal Proximal Tubular Epithelial Cell Line HK-2. Boil. Pharm. Bull. 2017, 40, 82–87. [Google Scholar] [CrossRef]
- Zhang, Z.L.; Jiang, Q.C.; Wang, S.R. Schisandrin A reverses doxorubicin-resistant human breast cancer cell line by the inhibition of P65 and Stat3 phosphorylation. Breast Cancer 2018, 25, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Ee, P.L.R. Identification of a Novel Estrogen Response Element in the Breast Cancer Resistance Protein (ABCG2) Gene. Cancer Res. 2004, 64, 1247–1251. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Zhang, X.; Zhang, H.; Su, P.; Li, W.; Li, L.; Wang, Y.; Liu, W.; Gao, P.; Zhou, G. Progesterone receptor downregulates breast cancer resistance protein expression via binding to the progesterone response element in breast cancer. Cancer Sci. 2012, 103, 959–967. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Dai, X.; Hu, D.; Zhang, Y.; Sun, Y.; Ren, W.; Wang, L. Potential pharmacokinetic effect of rifampicin on enrofloxacin in broilers: Roles of P-glycoprotein and BCRP induction by rifampicin. Poult. Sci. 2016, 95, 2129–2135. [Google Scholar] [CrossRef] [PubMed]
- Burger, H.; Tol, H.V.; Brok, M.; Wiemer, E.A.C.; Bruin, E.A.D.; Guetens, G.; Sparreboom, A.; Nooter, K. Imatinib-induced upregulation of ABCG2 (BCRP) and ABCB1 (MDR1) may represent a novel mechanism of pharmacokinetic drug resistance in cancer patients chronically treated with imatinib. Cancer Res. 2005, 65, 621. [Google Scholar]
- Martín, V.; Sanchezsanchez, A.M.; Herrera, F.; Gomezmanzano, C.; Fueyo, J.; Alvarezvega, M.A.; Antolín, I.; Rodriguez, C. Melatonin-induced methylation of the ABCG2|[sol]|BCRP promoter as a novel mechanism to overcome multidrug resistance in brain tumour stem cells. Br. J. Cancer 2013, 108, 2005–2012. [Google Scholar] [CrossRef]
- To, K.K.; Robey, R.; Zhan, Z.; Bangiolo, L.; Bates, S.E. Upregulation of ABCG2 by Romidepsin via the Aryl Hydrocarbon Receptor Pathway. Mol. Cancer Res. 2011, 9, 516–527. [Google Scholar] [CrossRef]
- Neradugomma, N.K.; Liao, M.Z.; Mao, Q. Buprenorphine, Norbuprenorphine, R-Methadone, and S-Methadone Upregulate BCRP/ABCG2 Expression by Activating Aryl Hydrocarbon Receptor in Human Placental Trophoblasts. Mol. Pharmacol. 2017, 91, 237–249. [Google Scholar] [CrossRef]
- Moore, L.B. Orphan Nuclear Receptors Constitutive Androstane Receptor and Pregnane X Receptor Share Xenobiotic and Steroid Ligands. J. Boil. Chem. 2000, 275, 15122–15127. [Google Scholar] [CrossRef]
- Li, L.; Peng, M.; Ge, C.; Yu, L.; Ma, H. (-)-Hydroxycitric Acid Reduced Lipid Droplets Accumulation Via Decreasing Acetyl-Coa Supply and Accelerating Energy Metabolism in Cultured Primary Chicken Hepatocytes. Cell. Physiol. Biochem. 2017, 43, 812–831. [Google Scholar] [CrossRef]
- Kennedy, S.; Lorenzen, A.; James, C.; Collins, B. Ethoxyresorufin-O-deethylase and Porphyrin Analysis in Chicken Embryo Hepatocyte Cultures with a Fluorescence Multiwell Plate Reader. Anal. Biochem. 1993, 211, 102–112. [Google Scholar] [CrossRef] [PubMed]
- Grabe, N. AliBaba2: Context specific identification of transcription factor binding sites. Silico Boil. 2002, 2, 1–15. [Google Scholar]
- Li, L.C.; Dahiya, R. MethPrimer: Designing primers for methylation PCRs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef]
- Zhang, Y.; Huang, J.; Liu, Y.; Guo, T.; Wang, L. Using the lentiviral vector system to stably express chicken P-gp and BCRP in MDCK cells for screening the substrates and studying the interplay of both transporters. Arch. Toxicol. 2018, 92, 2027–2042. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Langmann, T.; Porsch-Özcürümez, M.; Unkelbach, U.; Klucken, J.; Schmitz, G. Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene. Biochim. Biophys. Acta-Bioenerg. 2000, 1494, 175–180. [Google Scholar] [CrossRef]
- Zhu, Q.; Center, M.S. Cloning and sequence analysis of the promoter region of the MRP gene of HL60 cells isolated for resistance to adriamycin. Cancer Res. 1994, 54, 4488–4492. [Google Scholar]
- Ueda, K.; Pastan, I.; Gottesman, M.M. Isolation and sequence of the promoter region of the human multidrug-resistance (P-glycoprotein) gene. J. Boil. Chem. 1987, 262, 17432–17436. [Google Scholar]
- Cornwell, M.M.; Smith, E.D. SP1 activates the MDR1 promoter through one of two distinct G-rich regions that modulate promoter activity. J. Boil. Chem. 1993, 268, 19505–19511. [Google Scholar]
- Wu, Q.; Yang, Z.; Xia, L.; Nie, Y.; Wu, K.; Shi, Y.; Fan, D. Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget 2014, 5, 11552–11563. [Google Scholar] [CrossRef]
- To, K.K.W.; Zhan, Z.; Bates, S.E. Aberrant Promoter Methylation of the ABCG2 Gene in Renal Carcinoma. Mol. Cell. Boil. 2006, 26, 8572–8585. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Guo, T.; Huang, J.; Huan, C.; He, F.; Zhang, Y.; Bhutto, Z.A.; Wang, L. Cloning and Transcriptional Activity Analysis of the Porcine Abcb1 Gene Promoter: Transcription Factor Sp1 Regulates the Expression of Porcine Abcb1. Front. Pharmacol. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Handschin, C. A Conserved Nuclear Receptor Consensus Sequence (DR-4) Mediates Transcriptional Activation of the Chicken CYP2H1 Gene by Phenobarbital in a Hepatoma Cell Line. J. Boil. Chem. 2000, 275, 13362–13369. [Google Scholar] [CrossRef] [PubMed]
- Gazzoli, I.; Kolodner, R.D. Regulation of the Human MSH6 Gene by the Sp1 Transcription Factor and Alteration of Promoter Activity and Expression by Polymorphisms. Mol. Cell. Boil. 2003, 23, 7992–8007. [Google Scholar] [CrossRef] [PubMed]
- Ogretmen, B.; Safa, A.R. Negative regulation of MDR1 promoter activity in MCF-7, but not in multidrug resistant MCF-7/Adr, cells by cross-coupled NF-kappa B/p65 and c-Fos transcription factors and their interaction with the CAAT region. Biochemistry 1999, 38, 2189–2199. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.L.; Gao, H.; Ou-Yang, K.Q.; Cai, S.X.; Hu, Y.H. Establishment of a cell-based assay to screen regulators for Klotho gene promoter. Acta Pharmacol. Sin. 2004, 25, 1165–1170. [Google Scholar]
- Chunna, Y.; Xiaojuan, C.; Lushan, Y.; Shuqing, C.; Su, Z. Identification of novel pregnane X receptor activators from traditional Chinese medicines. J. Ethnopharmacol. 2011, 136, 137–143. [Google Scholar]
- Reznicek, J.; Ceckova, M.; Ptackova, Z.; Martinec, O.; Tupova, L.; Cerveny, L.; Staud, F. MDR1 and BCRP Transporter-Mediated Drug-Drug Interaction between Rilpivirine and Abacavir and Effect on Intestinal Absorption. Antimicrob. Agents Chemother. 2017, 61. [Google Scholar] [CrossRef]
- Heyes, N.; Kapoor, P.; Kerr, I.D. Polymorphisms of the Multidrug Pump ABCG2: A Systematic Review of Their Effect on Protein Expression, Function, and Drug Pharmacokinetics. Drug Metab. Dispos. 2018, 46, 1886–1899. [Google Scholar] [CrossRef]
Name | Primer Sequence (5′–3′) |
---|---|
Primers for plasmid construction | |
pGL3-D1-F | atctgcgatctaagtaagcttGAGTCCAGAGAGGGCCATGAA |
pGL3-D2-F | atctgcgatctaagtaagcttGAGCACTTGCTCTTCTTCCCAG |
pGL3-D3-F | atctgcgatctaagtaagcttTGTCCCAGGCACACGATGA |
pGL3-D4-F | atctgcgatctaagtaagcttGCAAAAGTCTTCCATGTAGGCAG |
pGL3-D5-F | atctgcgatctaagtaagcttCACAGAGTGACTGAAA |
pGL3-deletion-R | cagtaccggaatgccaagcttGGGTACACTCACAATGCAGGC |
Primers for Construction of Point Mutation Plasmid | |
CXR-mut F | ATTTAAATGCGCACCGACAGTAAAACGATACAGTTGG |
CXR-mut R | TTTTACTGTCGGTGCGCATTTAAATCATACAGTTGCT |
NF-κB-mut F | AACGGGATGGAGTCACTCCAGGGCCTCCACCTGGATG |
NF-κB-mut R | GGCCCTGGAGTGACTCCATCCCGTTTCTGAAGCAA |
ER-mut F | GTTTTTTCAGTATACAAGGCACACGATGAGGGGCTGC |
ER-mut R | CGTGTGCCTTGTATACTGAAAAAACAGACAGTGTGCT |
GR-mut F | TGCCACTGCATAATGGCGTGGGCTCCGTGGTGTTTAG |
GR-mut R | GGAGCCCACGCCATTATGCAGTGGCAGCCCCTC |
Sp1-mut F | TCCACTTCTGCTACGCATAGTGACTGAAAATAACAT |
Sp1-mut R | AGTCACTATGCGTAGCAGAAGTGGACTTGAGTTTGT |
Primers for RTP–CR | |
Abcg2 (BCRP)-F | CCTACTTCCTGGCCTTGATGT |
Abcg2 (BCRP)-R | TCGGCCTGCTATAGCTTGAAATC |
β-actin F | TGCGTGACATCAAGGAGAAG |
β-actin R | TGCCAGGGTACATTGTGGTA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Huang, J.; Li, X.; Fang, C.; Wang, L. Identification of Functional Transcriptional Binding Sites within Chicken Abcg2 Gene Promoter and Screening Its Regulators. Genes 2020, 11, 186. https://doi.org/10.3390/genes11020186
Zhang Y, Huang J, Li X, Fang C, Wang L. Identification of Functional Transcriptional Binding Sites within Chicken Abcg2 Gene Promoter and Screening Its Regulators. Genes. 2020; 11(2):186. https://doi.org/10.3390/genes11020186
Chicago/Turabian StyleZhang, Yujuan, Jinhu Huang, Xiangxiu Li, Ci Fang, and Liping Wang. 2020. "Identification of Functional Transcriptional Binding Sites within Chicken Abcg2 Gene Promoter and Screening Its Regulators" Genes 11, no. 2: 186. https://doi.org/10.3390/genes11020186
APA StyleZhang, Y., Huang, J., Li, X., Fang, C., & Wang, L. (2020). Identification of Functional Transcriptional Binding Sites within Chicken Abcg2 Gene Promoter and Screening Its Regulators. Genes, 11(2), 186. https://doi.org/10.3390/genes11020186