CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver
Abstract
:1. Introduction
2. Materials and Methods
2.1. In Vivo Models
2.2. Blood Serum Biochemistry
2.3. Histological Analysis
2.4. Gene Expression Analysis by qRT-PCR
2.5. Metabolic Analysis
2.6. Statistical Analysis
3. Results
3.1. Hepatic Cbfa2t3 Is Induced by PPARA
3.2. Cbfa2t3 Modulates Glucose Metabolism and Insulin Sensitivity
3.3. Impact of Cbfa2t3 Deficiency in the Liver
3.4. Cbfa2t3 Attenuates Fasting-Induced Lipid Accumulation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hendrikse, L.D.; Haldipur, P.; Saulnier, O.; Millman, J.; Sjoboen, A.H.; Erickson, A.W.; Ong, W.; Gordon, V.; Coudiere-Morrison, L.; Mercier, A.L.; et al. Failure of human rhombic lip differentiation underlies medulloblastoma formation. Nature 2022, 609, 1021–1028. [Google Scholar] [CrossRef] [PubMed]
- Chyla, B.J.; Moreno-Miralles, I.; Steapleton, M.A.; Thompson, M.A.; Bhaskara, S.; Engel, M.; Hiebert, S.W. Deletion of Mtg16, a target of t(16;21), alters hematopoietic progenitor cell proliferation and lineage allocation. Mol. Cell. Biol. 2008, 28, 6234–6247. [Google Scholar] [CrossRef]
- Steinauer, N.; Guo, C.; Zhang, J. Emerging Roles of MTG16 in Cell-Fate Control of Hematopoietic Stem Cells and Cancer. Stem Cells Int. 2017, 2017, 6301385. [Google Scholar] [CrossRef]
- Le, Q.; Hadland, B.; Smith, J.L.; Leonti, A.; Huang, B.J.; Ries, R.; Hylkema, T.A.; Castro, S.; Tang, T.T.; McKay, C.N.; et al. CBFA2T3-GLIS2 model of pediatric acute megakaryoblastic leukemia identifies FOLR1 as a CAR T cell target. J. Clin. Investig. 2022, 132, e157101. [Google Scholar] [CrossRef]
- Neault, M.; Lebert-Ghali, C.E.; Fournier, M.; Capdevielle, C.; Garfinkle, E.A.R.; Obermayer, A.; Cotton, A.; Boulay, K.; Sawchyn, C.; St-Amand, S.; et al. CBFA2T3-GLIS2-dependent pediatric acute megakaryoblastic leukemia is driven by GLIS2 and sensitive to navitoclax. Cell Rep. 2023, 42, 113084. [Google Scholar] [CrossRef] [PubMed]
- Gress, V.; Roussy, M.; Boulianne, L.; Bilodeau, M.; Cardin, S.; El-Hachem, N.; Lisi, V.; Khakipoor, B.; Rouette, A.; Farah, A.; et al. CBFA2T3::GLIS2 pediatric acute megakaryoblastic leukemia is sensitive to BCL-XL inhibition by navitoclax and DT2216. Blood Adv. 2024, 8, 112–129. [Google Scholar] [CrossRef] [PubMed]
- Brown, R.E.; Jacobse, J.; Anant, S.A.; Blunt, K.M.; Chen, B.; Vega, P.N.; Jones, C.T.; Pilat, J.M.; Revetta, F.; Gorby, A.H.; et al. MTG16 regulates colonic epithelial differentiation, colitis, and tumorigenesis by repressing E protein transcription factors. JCI Insight 2022, 7, 153045. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Gullberg, U.; Olsson, I.; Ajore, R. Myeloid translocation gene-16 co-repressor promotes degradation of hypoxia-inducible factor 1. PLoS ONE 2015, 10, e0123725. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Luo, X.; Wang, Z.; Wang, Y.; Zhao, J.; Bian, L. Identification of cancer stemness and M2 macrophage-associated biomarkers in lung adenocarcinoma. Heliyon 2023, 9, e19114. [Google Scholar] [CrossRef]
- Xu, R.; Lu, T.; Zhao, J.; Wang, J.; Peng, B.; Zhang, L. Identification of Tumor Antigens and Immune Subtypes in Lung Adenocarcinoma for mRNA Vaccine Development. Front. Cell Dev. Biol. 2022, 10, 815596. [Google Scholar] [CrossRef]
- Zhang, X.; Fan, Y.; Liu, B.; Qi, X.; Guo, Z.; Li, L. Med19 promotes breast cancer cell proliferation by regulating CBFA2T3/HEB expression. Breast Cancer 2017, 24, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Sinha, R.A.; Rajak, S.; Singh, B.K.; Yen, P.M. Hepatic Lipid Catabolism via PPARalpha-Lysosomal Crosstalk. Int. J. Mol. Sci. 2020, 21, 2391. [Google Scholar] [CrossRef] [PubMed]
- Brocker, C.N.; Patel, D.P.; Velenosi, T.J.; Kim, D.; Yan, T.; Yue, J.; Li, G.; Krausz, K.W.; Gonzalez, F.J. Extrahepatic PPARalpha modulates fatty acid oxidation and attenuates fasting-induced hepatosteatosis in mice. J. Lipid Res. 2018, 59, 2140–2152. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Wang, P.; Chen, Z.; Hu, W.; Gong, Y.; Zhang, W.; Huang, C. WY-14643, a selective agonist of peroxisome proliferator-activated receptor-alpha, ameliorates lipopolysaccharide-induced depressive-like behaviors by preventing neuroinflammation and oxido-nitrosative stress in mice. Pharmacol. Biochem. Behav. 2017, 153, 97–104. [Google Scholar] [CrossRef]
- Kim, D.; Brocker, C.N.; Takahashi, S.; Yagai, T.; Kim, T.; Xie, G.; Wang, H.; Qu, A.; Gonzalez, F.J. Keratin 23 Is a Peroxisome Proliferator-Activated Receptor Alpha-Dependent, MYC-Amplified Oncogene That Promotes Hepatocyte Proliferation. Hepatology 2019, 70, 154–167. [Google Scholar] [CrossRef] [PubMed]
- Brocker, C.N.; Kim, D.; Melia, T.; Karri, K.; Velenosi, T.J.; Takahashi, S.; Aibara, D.; Bonzo, J.A.; Levi, M.; Waxman, D.J.; et al. Long non-coding RNA Gm15441 attenuates hepatic inflammasome activation in response to PPARA agonism and fasting. Nat. Commun. 2020, 11, 5847. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Kim, B.; Brocker, C.N.; Karri, K.; Waxman, D.J.; Gonzalez, F.J. Long non-coding RNA G23Rik attenuates fasting-induced lipid accumulation in mouse liver. Mol. Cell. Endocrinol. 2022, 557, 111722. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.S.; Pineau, T.; Drago, J.; Lee, E.J.; Owens, J.W.; Kroetz, D.L.; Fernandez-Salguero, P.M.; Westphal, H.; Gonzalez, F.J. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol. Cell. Biol. 1995, 15, 3012–3022. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Hunt, A.; Fischer, M.; Engel, M.E.; Hiebert, S.W. Mtg16/Eto2 contributes to murine T-cell development. Mol. Cell. Biol. 2011, 31, 2544–2551. [Google Scholar] [CrossRef]
- Masetti, R.; Bertuccio, S.N.; Pession, A.; Locatelli, F. CBFA2T3-GLIS2-positive acute myeloid leukaemia. A peculiar paediatric entity. Br. J. Haematol. 2019, 184, 337–347. [Google Scholar] [CrossRef]
- Ji, Z.; Lu, R.; Mou, L.; Duan, Y.G.; Zhang, Q.; Wang, Y.; Gui, Y.; Cai, Z. Expressions of miR-15a and its target gene HSPA1B in the spermatozoa of patients with varicocele. Reproduction 2014, 147, 693–701. [Google Scholar] [CrossRef]
- He, Y.; Luo, J.; Zhang, G.; Jin, Y.; Wang, N.; Lu, J.; Li, C.; Guo, X.; Qin, N.; Dai, J.; et al. Single-cell profiling of human CD127(+) innate lymphoid cells reveals diverse immune phenotypes in hepatocellular carcinoma. Hepatology 2022, 76, 1013–1029. [Google Scholar] [CrossRef]
- Wang, L.; Zhou, K.; Wu, Q.; Zhu, L.; Hu, Y.; Yang, X.; Li, D. Microanatomy of the metabolic associated fatty liver disease (MAFLD) by single-cell transcriptomics. J. Drug Target. 2023, 31, 421–432. [Google Scholar] [CrossRef]
- Shah, G.N.; Rubbelke, T.S.; Hendin, J.; Nguyen, H.; Waheed, A.; Shoemaker, J.D.; Sly, W.S. Targeted mutagenesis of mitochondrial carbonic anhydrases VA and VB implicates both enzymes in ammonia detoxification and glucose metabolism. Proc. Natl. Acad. Sci. USA 2013, 110, 7423–7428. [Google Scholar] [CrossRef]
- Aspatwar, A.; Supuran, C.T.; Waheed, A.; Sly, W.S.; Parkkila, S. Mitochondrial carbonic anhydrase VA and VB: Properties and roles in health and disease. J. Physiol. 2023, 601, 257–274. [Google Scholar] [CrossRef]
- Wang, H.; Lu, J.; Edmunds, L.R.; Kulkarni, S.; Dolezal, J.; Tao, J.; Ranganathan, S.; Jackson, L.; Fromherz, M.; Beer-Stolz, D.; et al. Coordinated Activities of Multiple Myc-dependent and Myc-independent Biosynthetic Pathways in Hepatoblastoma. J. Biol. Chem. 2016, 291, 26241–26251. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.M.; Wagner, M.; Xiao, R.; Kim, K.H.; Feng, D.; Lazar, M.A.; Moore, D.D. Nutrient-sensing nuclear receptors coordinate autophagy. Nature 2014, 516, 112–115. [Google Scholar] [CrossRef]
- Xia, B.; Yu, R.; Liu, J.; Liu, D.; Li, S.; Yang, L.; Liu, N.; Liang, B.; Zeng, J.; Wei, J.; et al. BDE-47 induces metabolic dysfunction-associated steatotic liver disease (MASLD) through CD36-mediated increased fatty acid uptake and PPARalpha-induced abnormal fatty acid oxidation in BALB/c mice. Toxicol. Lett. 2024, 391, 100–110. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yu, M.; Chen, L.; Mao, J.; Wang, W.; Yang, Z.; Cao, Z.; Liu, Y.; Wei, M.; Zhang, L.; et al. Design, synthesis, and biological evaluation of first-in-class FABP1 inhibitors for the treatment of NASH. Eur. J. Med. Chem. 2024, 270, 116358. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Zhao, X.; Wei, W.; Liu, W.; Fan, H.; Liu, X.P.; Li, Y.; Wang, L.; Guo, J. METTL16-mediated translation of CIDEA promotes non-alcoholic fatty liver disease progression via m6A-dependent manner. PeerJ 2022, 10, e14379. [Google Scholar] [CrossRef]
- Zhou, L.; Xu, L.; Ye, J.; Li, D.; Wang, W.; Li, X.; Wu, L.; Wang, H.; Guan, F.; Li, P. Cidea promotes hepatic steatosis by sensing dietary fatty acids. Hepatology 2012, 56, 95–107. [Google Scholar] [CrossRef]
- Li, L.; Zhou, H.; Wang, J.; Li, J.; Lyu, X.; Wang, W.; Luo, C.; Huang, H.; Zhou, D.; Chen, X.; et al. Metabolic switch from glycogen to lipid in the liver maintains glucose homeostasis in neonatal mice. J. Lipid Res. 2023, 64, 100440. [Google Scholar] [CrossRef]
- Li, Q.; Wang, W.; Duan, F.; Wang, Y.; Chen, S.; Shi, K.; Xia, Y.; Li, X.; Gao, Y.; Liu, G. DNMT3B Alleviates Liver Steatosis Induced by Chronic Low-grade LPS via Inhibiting CIDEA Expression. Cell Mol. Gastroenterol. Hepatol. 2024, 17, 59–77. [Google Scholar] [CrossRef]
Name | Sequence (5′ → 3′) |
---|---|
ApoB F | GGTGTATGGCTTCAACCCTGA |
ApoB R | GCTTGAGTTCGTACCTGGACA |
Car5a F | GCAAACTTCGCTCGTCCTTC |
Car5a R | TTCCGGTCTGCTCTGCCTAT |
Cd36 F | GATTAATGGCACAGACGCAGC |
Cd36 R | CAGATCCGAACACAGCGTAGA |
Cyp4a14 F | CCTGACTTTCTTTCGCCTGC |
Cyp4a14 R | TGATCACTCCATCTGTGTGCT |
Dgat2 F | GGTCTGCAGCCAGAGAAGAG |
Dgat2 R | TCCAGGTATGAGGAGTCTTCC |
Fabp1 F | AGTCAAGGCAGTCGTCAAGC |
Fabp1 R | ATGTCGCCCAATGTCATGGT |
Fabp4 F | CATAACCCTAGATGGCGGGG |
Fabp4 R | CGCCTTTCATAACACATTCCACC |
Gapdh F | GACTTCAACAGCAACTCCCAC |
Gapdh R | TCCACCACCCTGTTGCTGTA |
Hspa1b F | CGAGGAGGTGGATTAGAGGC |
Hspa1b R | TGCCCAAGCAGCTATCAAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, D.; Ha, S.K.; Gonzalez, F.J. CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver. Cells 2024, 13, 831. https://doi.org/10.3390/cells13100831
Kim D, Ha SK, Gonzalez FJ. CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver. Cells. 2024; 13(10):831. https://doi.org/10.3390/cells13100831
Chicago/Turabian StyleKim, Donghwan, Sang Keun Ha, and Frank J. Gonzalez. 2024. "CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver" Cells 13, no. 10: 831. https://doi.org/10.3390/cells13100831
APA StyleKim, D., Ha, S. K., & Gonzalez, F. J. (2024). CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver. Cells, 13(10), 831. https://doi.org/10.3390/cells13100831