Identification of a Protein Content-Associated Gene in Peanut (Arachis hypogaea) and Functional Characterization of the Gene and Its Homolog in Arabidopsis thaliana
Abstract
1. Introduction
2. Materials and Methods
2.1. BSA-Seq and Single Marker Analysis in Peanut
2.2. Protein Domain Analysis, Amino Acid Conservation Analysis of the Mutation Site, RNA-Binding Residue Prediction, and Protein-Protein Interaction (PPI) Network Analysis
2.3. Relative Expression of the Candidate Gene in Peanut Seeds
2.4. Construction of Overexpression Vector and Transformation of Arabidopsis
2.5. Gene Expression Analysis in Arabidopsis T2 Overexpression Lines
2.6. Construction of Gene-Editing Vector and Transformation of Arabidopsis Thaliana
2.7. Genotyping of CRISPR/Cas9-Induced Arabidopsis Mutants
2.8. Selection and Protein Analysis of Arabidopsis Homozygous Mutant Lines
2.9. Statistical Analysis of Seed Protein Content of Arabidopsis
3. Results
3.1. Candidate Gene Isolation and Protein Domain Analysis
3.2. Evolutionary Conservation Analysis of Amino Acid Residues
3.3. Predicted RNA-Binding Residues
3.4. STRING Analysis of AhSPC
3.5. Relative Expression of AhSPC in Peanut Seeds
3.6. Functional Analysis of AtSPC in Arabidopsis Through Gene Editing
3.6.1. AtSPC Mutations in Arabidopsis CRISPRed Lines
3.6.2. Protein Content in Mature Seeds of CRISPRed Arabidopsis Targeting AtSPC
3.7. Functional Analysis of AhSPC in Arabidopsis Through Overexpression Analysis
3.7.1. Identification of Transgenic Arabidopsis Plants Overexpressing AhSPC
3.7.2. Protein Content in Seeds of Arabidopsis Lines Overexpressing AhSPC
4. Discussion
4.1. Identification and Functional Characterization of AhSPC
4.2. Potential Regulatory Mechanisms of AhSPC
4.3. Structural and Functional Implications of the Lys410Ile Mutation
4.4. Translational Considerations and Future Directions
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mallikarjuna, N.; Varshney, R.K. Genetics, Genomics and Breeding of Peanuts; Taylor & Francis Group, LLC: Abingdon, UK, 2014. [Google Scholar]
- Shah, P.; Pandey, M.; Nayak, S.N.; Chen, C.; Bera, S.; Kole, C.; Puppala, N. Next-Generation Breeding for Nutritional Traits in Peanut. In Compendium of Crop Genome Designing for Nutraceuticals; Kole, C., Ed.; Springer Nature: Singapore, 2023; pp. 1–15. ISBN 978-981-19-3627-2. [Google Scholar]
- Smartt, J. The Groundnut Crop: A Scientific Basis for Improvement; Springer: Dordrecht, The Netherlands, 1994; ISBN 978-94-010-4315-1. [Google Scholar]
- Li, L.; Lin, S.; Liao, X.; Li, S. Study on the Quality of Seed and Hybridization in Wild Species of Genus Arachis. China Oil Crops 1994, 16, 22–26. [Google Scholar]
- Jambunathan, R.; Gurtu, S.; Raghunath, K.; Kannan, S.; Sridhar, R.; Dwivedi, S.L.; Nigam, S.N. Chemical Composition and Protein Quality of Newly Released Groundnut (Arachis hypogaea L.) Cultivars. J. Sci. Food Agric. 1992, 59, 161–167. [Google Scholar] [CrossRef]
- Wang, M.L.; Tonnis, B.; Li, X.; Benke, R.; Huang, E.; Tallury, S.; Puppala, N.; Peng, Z.; Wang, J. Genotype, Environment, and Their Interaction Effects on Peanut Seed Protein, Oil, and Fatty Acid Content Variability. Agron. J. 2024, 116, 1440–1454. [Google Scholar] [CrossRef]
- Duan, Z.; Li, Q.; Wang, H.; He, X.; Zhang, M. Genetic Regulatory Networks of Soybean Seed Size, Oil and Protein Contents. Front. Plant Sci. 2023, 14, 1160418. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; O’Conner, S.; Tanvir, R.; Zheng, W.; Cothron, S.; Towery, K.; Bi, H.; Ellison, E.E.; Yang, B.; Voytas, D.F.; et al. CRISPR/Cas9-Based Editing of NF-YC4 Promoters Yields High-Protein Rice and Soybean. New Phytol. 2024, 245, 2103–2116. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Liu, N.; Huang, L.; Huai, D.; Xu, R.; Chen, X.; Guo, S.; Chen, J.; Jiang, H. Identification of a Major QTL for Seed Protein Content in Cultivated Peanut (Arachis hypogaea L.) Using QTL-Seq. Plants 2024, 13, 2368. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Qi, F.; Liu, H.; Qin, L.; Xu, J.; Shi, L.; Zhang, Z.; Miao, L.; Huang, B.; Dong, W.; et al. QTL Mapping of Quality Traits in Peanut Using Whole-Genome Resequencing. Crop J. 2022, 10, 177–184. [Google Scholar] [CrossRef]
- Sarvamangala, C.; Gowda, M.V.C.; Varshney, R.K. Identification of Quantitative Trait Loci for Protein Content, Oil Content and Oil Quality for Groundnut (Arachis hypogaea L.). Field Crops Res. 2011, 122, 49–59. [Google Scholar] [CrossRef]
- Bertioli, D.J.; Jenkins, J.; Clevenger, J.; Dudchenko, O.; Gao, D.; Seijo, G.; Leal-Bertioli, S.C.M.; Ren, L.; Farmer, A.D.; Pandey, M.K.; et al. The Genome Sequence of Segmental Allotetraploid Peanut Arachis hypogaea. Nat. Genet. 2019, 51, 877–884. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.T.; Wang, X.Z.; Tang, Y.Y.; Wu, Q.; Xu, J.Z.; Hu, D.Q.; Qu, B. Predicting Main Fatty Acids, Oil and Protein Content in Intact Single Seeds of Groundnut by near Infrared Reflectance Spectroscopy. Adv. Mater. Res. 2013, 860–863, 490–496. [Google Scholar] [CrossRef]
- Yu, S.T.; Wang, C.T.; Yu, S.L.; Wang, X.Z.; Tang, Y.Y.; Chen, D.X.; Zhang, J.C. Simple Method to Prepare DNA Templates from a Slice of Peanut Cotyledonary Tissue for Polymerase Chain Reaction. Electron. J. Biotechnol. 2010, 13, 9. [Google Scholar] [CrossRef]
- Simms, D.; Cizdziel, P.E.; Chomczynski, P. TRIzol: A New Reagent for Optimal Single-Step Isolation of RNA. Focus 1993, 15, 532–535. [Google Scholar]
- Kj, L.; Td, S. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral Dip: A Simplified Method for Agrobacterium-Mediated Transformation of Arabidopsis Thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Costa-Neto, G.; Fritsche-Neto, R. Enviromics: Bridging Different Sources of Data, Building One Framework. Crop Breed. Appl. Biotechnol. 2021, 21, e393521S12. [Google Scholar] [CrossRef]
- Vaddepalli, P.; Fulton, L.; Schneitz, K. Asymmetric Redundancy of ZERZAUST and ZERZAUST HOMOLOG in Different Accessions of Arabidopsis thaliana. G3 Genes|Genomes|Genetics 2019, 9, 2245–2252. [Google Scholar] [CrossRef] [PubMed]
- Herman, E.M. Soybean Seed Proteome Rebalancing. Front. Plant Sci. 2014, 5, 437. [Google Scholar] [CrossRef] [PubMed]
- Thompson, R.D.; Verdier, J. Networks of Seed Storage Protein Regulation in Cereals and Legumes at the Dawn of the Omics Era. In Seed Development: OMICS Technologies toward Improvement of Seed Quality and Crop Yield: OMICS in Seed Biology; Agrawal, G.K., Rakwal, R., Eds.; Springer: Dordrecht, The Netherlands, 2012; pp. 187–210. ISBN 978-94-007-4749-4. [Google Scholar]










| Chromosome | QTL | Start (bp) | End (bp) | Length (bp) |
|---|---|---|---|---|
| Chr01 | 1 | 90,500,000 | 100,500,000 | 10,000,000 |
| Chr16 | 2 | 18,500,000 | 28,000,000 | 9,500,000 |
| Chr16 | 3 | 72,000,000 | 79,500,000 | 7,500,000 |
| Chr19 | 4 | 1,500,000 | 8,000,000 | 6,500,000 |
| Chr19 | 5 | 9,500,000 | 16,000,000 | 6,500,000 |
| Chr19 | 6 | 97,000,000 | 106,000,000 | 9,000,000 |
| Chr19 | 7 | 145,500,000 | 154,000,000 | 8,500,00 |
| Primer Name | Forward Primer Sequence | Reverse Primer Sequence | Target Site | Tm (°C) | Product Size (bp) |
|---|---|---|---|---|---|
| Chro1-1 | aaaatcccaaatcaaagttcacga | gtctatgcttgtgaacttgccaga | 93,915,563 | 63 | 118 |
| Chro1-2 | aaaaaggggaagatgacacattca | gacctgtgactcgattccgtg | 94,137,070 | 63 | 132 |
| Chro1-3 | ttttataacgtgcagcacaactgg | tatactcaaaggcttgggacggta | 94,138,308 | 63 | 158 |
| Chro1-4 | atagggtgctgaggatgaattgaa | ttttactggtgtaaactcctcccg | 94,138,756 | 63 | 116 |
| Chro1-5 | atagggtgctgaggatgaattgaa | ttttactggtgtaaactcctcccg | 94,138,757 | 63 | 116 |
| Chro1-6 | ttatacccccttaaccctcaccat | tagctaacggcatcctttcagaag | 94,141,825 | 62 | 113 |
| Chro1-7 | catgtgctatccagggcagatatt | ctgcatcgcttcccatagctaac | 94,141,894 | 63 | 151 |
| Chro1-8 | tctgaaaggatgccgttagctatg | ttccttccgattgaagatgaagag | 94,141,951 | 63 | 158 |
| Chro1-9 | ccgttggataccatgaatgatcta | gaaatcaacgaagctcgatagcat | 94,142,145 | 63 | 130 |
| Chro1-10 | gtacctttgcttctggatgcttct | ttcattgaagaagggcaaaaactc | 94,234,868 | 63 | 156 |
| Chro1-11 | gcttccaaaatagcaaggactgaa | ggtccaaactttatgtatgctctacga | 94,420,765 | 63 | 140 |
| Chro1-12 | gtggtgtgagtccatattccagtg | agtggtgaacatgacgcatctaaa | 94,990,752 | 63 | 158 |
| Chro1-13 | gtggtgtgagtccatattccagtg | agtggtgaacatgacgcatctaaa | 94,990,773 | 63 | 158 |
| Chro1-14 | tttagatgcgtcatgttcaccact | aagctgtcaaattcccttcctacc | 94,990,804 | 63 | 116 |
| Chro1-15 | cataaagcaaatggatttttattcctt | tcatcacacaaattcagagacacaa | 95,154,455 | 61 | 156 |
| Chro1-16 | ggaatagaagtgaccgaagttcca | acaggatgaaaaggaatagggagg | 95,192,650 | 62 | 137 |
| Chro1-17 | actttcttttcataggcccagctc | actagtggagccatattgacggtg | 95,486,645 | 63 | 138 |
| Chro1-18 | tgacttgtctagatgatgcgaagc | atttatggatttttgccaagctga | 95,501,438 | 63 | 136 |
| Chro1-19 | tgacttgtctagatgatgcgaagc | atttatggatttttgccaagctga | 95,501,444 | 63 | 136 |
| Chro1-20 | caacaacagttgcctgagcataac | cgattgattcaaatcagtgtgagg | 95,501,455 | 63 | 153 |
| Chro1-21 | cggtcggaggagatagtagc | tgccataccttccttgacatga | 95,501,455 | 59 | 572 |
| Arabidopsis Plant | Protein (%) |
|---|---|
| Untransformed control | |
| CK1 | 15.85 |
| CK2 | 15.53 |
| CK3 | 14.97 |
| Gene-edited plant | |
| CR12-1 | 14.32 |
| CR12-4 | 10.53 |
| CR12-14 | 8.75 |
| CR12-15 | 10.12 |
| CR17-7 | 17.13 |
| CR17-8 | 16.14 |
| CR17-10 | 10.18 |
| CR17-12 | 12.24 |
| Arabidopsis Plant | Seed Protein Content (%) |
|---|---|
| Untransformed control | |
| WT-1 | 15.8 |
| WT-2 | 15.5 |
| WT-3 | 15.0 |
| Overexpression plant | |
| OE4-1 | 13.7 |
| OE4-2 | 23.5 |
| OE4-10 | 13.4 |
| OE8-3 | 24.5 |
| OE8-4 | 11.1 |
| OE9-3 | 17.6 |
| OE9-5 | 7.40 |
| OE9-6 | 23.0 |
| OE9-10 | 15.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, S.; Zhang, Y.; Dong, J.; Yin, Y.; Gao, L.; Sun, H.; Yuan, G.; Jiang, C.; Wang, C.; Yu, J. Identification of a Protein Content-Associated Gene in Peanut (Arachis hypogaea) and Functional Characterization of the Gene and Its Homolog in Arabidopsis thaliana. Agronomy 2025, 15, 1368. https://doi.org/10.3390/agronomy15061368
Yu S, Zhang Y, Dong J, Yin Y, Gao L, Sun H, Yuan G, Jiang C, Wang C, Yu J. Identification of a Protein Content-Associated Gene in Peanut (Arachis hypogaea) and Functional Characterization of the Gene and Its Homolog in Arabidopsis thaliana. Agronomy. 2025; 15(6):1368. https://doi.org/10.3390/agronomy15061368
Chicago/Turabian StyleYu, Shutao, Yu Zhang, Jingchao Dong, Yechao Yin, Leilei Gao, Haojie Sun, Guangdi Yuan, Chunjiao Jiang, Chuantang Wang, and Jing Yu. 2025. "Identification of a Protein Content-Associated Gene in Peanut (Arachis hypogaea) and Functional Characterization of the Gene and Its Homolog in Arabidopsis thaliana" Agronomy 15, no. 6: 1368. https://doi.org/10.3390/agronomy15061368
APA StyleYu, S., Zhang, Y., Dong, J., Yin, Y., Gao, L., Sun, H., Yuan, G., Jiang, C., Wang, C., & Yu, J. (2025). Identification of a Protein Content-Associated Gene in Peanut (Arachis hypogaea) and Functional Characterization of the Gene and Its Homolog in Arabidopsis thaliana. Agronomy, 15(6), 1368. https://doi.org/10.3390/agronomy15061368

