Effects of Nitrogen Fertilization on Soil CH₄, CO₂, and N₂O Emissions and Their Global Warming Potential in Agricultural Peatlands

Abstract

Globally, 14–20% of peatlands are affected by agricultural activities, which account for about one-third of global greenhouse gas emissions from farmlands. However, how agricultural activities such as nitrogen fertilization affect peatlands’ CH₄, CO₂ and N₂O emission patterns and their resulting warming effects needs to be improved and complemented. Here, we elucidate the characterization of CH₄, CO₂ and N₂O emissions from the soil surface and different depths of the soil profile during the growing season of agricultural peatlands for over 50 years and the mechanisms of their resulting global warming potential (GWP) impact through field monitoring and molecular techniques. The 100-year GWP of peatlands increased by 1200% with N fertilization of 260 kg N ha⁻¹ yr⁻¹. At the soil surface, N fertilization increased CO₂ and N₂O emissions by 111% and 2600%, respectively, although CH₄ emissions decreased by 87%. In the soil profile, N fertilization had a significant effect on CO₂ from 0 to 60 cm, resulting in an increase in CO₂ concentrations of 14–132%, whereas the top 30 cm of soil was the zone of significant N fertilization effects, with CH₄ concentrations decreasing by 49–95% and N₂O concentrations increasing by 22–26%. Elevated soil pH and NH₄⁺ were the key environmental factors influencing CH₄, CO₂ and N₂O emissions and their resulting increase in GWP. These results suggest that agricultural N fertilization led to a change in the contributor to the GWP of peatlands from CH₄ to N₂O, especially in the top 30 cm of soil. This study helps to provide theoretical support for the development of effective peatland management strategies.

1. Introduction

Peatlands, a type of wetlands, covering only 3% of the terrestrial area and storing 33% of the world’s carbon and 16% of nitrogen, play a key role in regulating the carbon and nitrogen balance. However, the carbon and nitrogen balance of peatlands can be severely disrupted due to the nitrogen fertilization resulting from the conversion of peatlands to farmlands; through changes in soil physicochemical properties [1,2,3]; and through the abundance, community and activity of nitrifying and denitrifying as well as methanogenic and methane (anaerobic) oxidizing microorganisms [4,5,6,7], which consequently influence CH₄ (with a 27-fold higher warming potential than CO₂), CO₂ and N₂O (with a 273-fold higher warming potential than CO₂, ozone-depleting gasses) emission patterns and the global warming potential (GWP). Nitrogen fertilization and irrigation or drainage are the main agricultural activities contributing to large greenhouse gas (GHG) emissions from agricultural peatlands, contributing to one-third of global GHG emissions from farmlands [8]. Therefore, there is an urgent need to develop effective peatland management strategies to reduce GHG emissions and global warming potential (GWP) due to agricultural activities such as nitrogen fertilization.

Research on carbon emissions from peatlands in the context of increasing N has focused on the response of methane to N inputs, but no consistent conclusions have been drawn. Some studies have shown that N inputs promote CH₄ emissions due to increases in available C and available N in soils [9], and conversely, some studies have found that N inputs reduce CH₄ emissions, either by inhibiting CH₄ production or promoting CH₄ oxidation [10,11,12]. These contrasting results may be related to differences in the soil background available C and N content, water table, microbial abundance and community structure and the amount and type of N fertilizers across ecosystems [6]. N inputs have also been found to have no significant effect on CH₄ emissions and have been attributed to the opposite and offsetting effects of N inputs on methanogenesis and methane oxidation processes [13]. These inconsistent results may hinder the accurate assessment and prediction of CH₄ emissions from peatlands in the context of N inputs and the resulting warming effects.

Compared to CH₄, the response of N₂O emissions to N inputs is more complex, and studies on the response of peatlands’ N₂O emissions to N inputs have mainly focused on surface N₂O effluent, with the extent of N₂O response to N inputs varying according to the amount, type and duration of N inputs. In both field and incubation experiments, most N additions of less than five years resulted in increased N₂O emissions from peatlands, due to N inputs providing more available N for N₂O production [13,14,15]. Conversely, N inputs (100 kg N ha⁻¹ yr⁻¹) of more than 10 years have no effect [16] or reduce N₂O emissions from peatlands [17,18]. This may due to the anaerobic conditions of the peatland being favorable for denitrification (converts N₂O to N₂) or due to the increase in soil N content facilitating plant growth, which absorbs excess N and limits the growth and activity of denitrifying microorganisms, thus reducing N₂O emissions [17,19]. We therefore hypothesize that N fertilization may reduce GWP in peatlands by reducing CH₄ to offset increased N₂O emissions.

In summary, studies of the effects of N inputs on the greenhouse gasses CH₄, CO₂ and N₂O have been dominated by the soil surface effluxes, while relatively few studies have monitored their concentrations in the soil profile. Since the greenhouse gas CH₄, CO₂ and N₂O effluxes only represent the net result of their production, transport and consumption, their concentrations in the soil profile provide a more detailed view of emissions at different depths. Combining CH₄, CO₂ and N₂O efflux measurements with profile concentration measurements can help to explore their soil–atmosphere exchange mechanism; identify the hotspots of CH₄, CO₂ and N₂O emissions in the soil profiles; and develop efficient mitigation strategies. Our aim was to explore (1) whether N-fertilized peatlands act as sinks or sources of CH₄, CO₂ and N₂O and (2) the main soil layers for CH₄, CO₂ and N₂O emissions and their key environmental influencing factors.

2. Materials and Methods

2.1. Site Description

This study was conducted in the Jinchuan peatland (42°20′56″ N, 126°22′51″ E) in the Longwan National Nature Reserve in Jilin province, northeastern China, which has a total area of 100 ha and an average thickness of 5 m. About 37 ha of the Jinchuan Peatland have been farmed continuously for over 50 years for paddy fields, named as “paddy–peatland” (N fertilization site). The total N fertilizer application rate was 260 kg N ha⁻¹ yr⁻¹ (farmer data) in three applications of 76 kg N ha⁻¹ (20 May), 92 kg N ha⁻¹ (5 June) and 92 kg N ha⁻¹ (25 June). The climate is temperate continental monsoon with an average annual temperature of 4.1 °C and annual rainfall of 1280 mm (Figure 1) [11].

2.2. CH₄, CO₂ and N₂O Efflux and Depths Concentrations Measurement

CH₄, CO₂ and N₂O effluxes and the concentrations at soil depths of 0–10, 10–20, 20–30, 30–40, 40–50, and 50–60 cm were monitored monthly from May to October 2016 (growing season) in the paddy–peatland (N fertilization site) and the peatland (control). Gas samples were determined by gas chromatography (Agilent 7890A, Santa Clara, CA, USA). The detailed collection and measurement methods of gas samples are the same as we reported previously [11], as described in Supplementary Information S1.1 and Figure 2.

In a 100-yr time horizon, the global warming potential (GWP) was calculated by taking conversion factors that 1 mg of CH₄ and N₂O are equivalent to 27 and 273 mg CO₂, respectively [19], as follows:

$$\mathrm{G}\mathrm{W}\mathrm{P}={\mathrm{F}}_{{\mathrm{C}\mathrm{O}}_2}+27\times {\mathrm{F}}_{{\mathrm{C}\mathrm{H}}_4}+273\times {\mathrm{F}}_{{\mathrm{N}}_2\mathrm{O}}$$

(1)

where ${\mathrm{F}}_{{\mathrm{C}\mathrm{H}}_4}$ and ${\mathrm{F}}_{{\mathrm{N}}_2\mathrm{O}}$ are the values of CH₄ and N₂O effluxes, respectively.

2.3. Soil Collection and Measurement

Soil columns (60 cm in length) were collected in triplicate from the paddy–peatland (N fertilization site) and the peatland (control) along with the gas samples. Each soil column was divided into six layers with depths of 0–10, 10–20, 20–30, 30–40, 40–50 and 50–60 cm. For each sampling site, the six layers of soil were mixed separately. Samples were immediately stored in aluminum foil wrapped in vacuum bags and shipped back to the laboratory on ice within 4 h. Each soil sample was divided into two parts, one for physicochemical property determination and the other for DNA extraction.

The contents of NH₄⁺, NO₃⁻ and NO₂⁻ were measured using a continuous-flow analyzer (San⁺⁺, Skalar, Breda, The Netherlands) after extraction with 2 M KCl (soil/water = 1: 5). The organic matter (OM) and total nitrogen (TN) concentrations were measured using the loss-on-ignition method (550 °C, 5.5 h) and dry combustion method (Elementar Analysen System GmbH, VarioEL III Analyzer, Langenselbold, Germany), respectively. Soil pH was conducted using a pH meter (IQ150, Hach, Loveland, CO, USA) after shaking 5 g of fresh soil and 25 mL of water for 30 min. All physicochemical parameters were measured with three replicates.

2.4. DNA Extraction and Quantitative PCR

The DNA was extracted from 0.5 g fresh soil samples using the PowerSoil DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA) following the manufacturer’s protocol. Extracted DNA was detected by 1% agarose gel and the concentration was measured with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Schwerte, Germany).

Quantification of C and N cycle-related genes was performed by SYBR-Green by an ABI 7500 real-time qPCR device (Applied Biosystems, Foster City, CA, USA), including methanogenic (mcrA, CO₂ reduction and acetate fermentation → CH₄) and methane anaerobic oxidation (NC10, CH₄ → CO₂), ammonia monooxygenase (amoA, NH₄⁺ → NH₂OH), nitrate reductase (narG, NO₃⁻ → NO₂⁻), nitrite reductase (nirK and nirS, NO₂⁻ → NO) and nitric oxide reductase (nosZ, N₂O → N₂). For each DNA sample, qPCR was performed in triplicate. The relevant primer information is shown in

Table 1. The primers used in this study.

Specificity	Primer	Sequence (5’-3’)	Thermal Profiles
NC10	p1F	GGGCTTGACATCCCACGAACCTG	3 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 63 °C and 30 s at 72 °C [20]
	p1R	CGCCTTCCTCCAGCTTGACGC
	p2F	GGGGAACTGCCAGCGTCAAG	3 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 63 °C and 30 s at 72 °C [20]
	p2R	CTCAGCGACTTCGAGTACAG
mcrA	159F	AAAGTGCGGAGCAGCAATCACC	5 min at 96 °C, 45 cycles of 30 s at 96 °C, 30 s at 57 °C and 30 s 72 °C [21]
	345R	TCGTCCCATTCCTGCTGCATTGC
AOA-amoA	archea-amoAF	STAATGGTCTGGCTTAGACG	5 min at 95 °C, 35 cycles of 45 s at 94 °C, 1 min at 53 °C and 1 min at 72 °C [22]
	archea-amoAR	GCGGCCATCCATCTGTATGT
AOB-amoA	amoA-1F	GGGGTTTCTACTGGTGGT	5 min at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 55 °C and 1 min at 72 °C [22]
	amoA-2R	CCCCTCKGSAAAGCCTTCTTC
nirK	FlaCu	ATCATGGTSCTGCCGCG	2 min at 95 °C, 40 cycles of 20 s at 95 °C, 30 s at 63 °C, 30 s at 73 °C and 15 s at 85 °C [23]
	R3Cu	TTGGTGTTRGACTAGCTCCG
nirS	cd3aF	GTSAACGTSAAGGARACSGG	3 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 59 °C and 1 min at 72 °C [24]
	R3cd	GASTTCGGRTGSGTCTTGA
nosZ	nosZ2F	CGCRACGGCAASAAG GTSMSSGT	5 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 54 °C, 40 s at 72 °C [25]
	nosZ2R	CAKRTGCAKSGCRTGGCAGAA
narG	narGf	TCGCCSATYCCGGCSATGTC	3 min at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 57 °C and 30 s at 72 °C [26]
	narGr	GAGTTGTACCAGTCRGCSGAYTCSG

Note: S = C or G; Y = C or T; K = G or T; R = A or G; D = A, G or T; V = A, C or G; B = C, G or T; N = A, C, T or G.

.

2.5. Statistical Analysis

Data on physicochemical properties, the CH₄, CO₂ and N₂O effluxes and concentrations from the soil surface and profiles were analyzed by Statistical Product and Service Solutions 18.0 software (SPSS Inc., Chicago, IL, USA) using one-way ANOVA, independent samples t-test, Spearman correlation and Pearson correlation analysis. The statistical significance thresholds were defined as * p < 0.05, ** p < 0.01 and *** p < 0.001. Partial least squares structural equation modeling analysis (PLS-SEM) was performed using Smart PLS3 v.4.1.0.2. Graphs were drawn using Origin 2018. Data are expressed as mean ± standard error (S.D.).

3. Results

3.1. The CH₄ Efflux and Concentrations in the Soil Profiles

The CH₄ efflux from the surface and its concentrations in the soil profiles decreased after N fertilization, especially in July (Figure 3; p < 0.01). Compared to the control (peatland), N fertilization (paddy-peatland) reduced CH₄ efflux by 87% (Figure 3; p < 0.01). At both sites, CH₄ efflux reached a maximum in July at 0.5 mg m⁻² h⁻¹ (paddy–peatland) and 3.8 mg m⁻² h⁻¹ (peatland), respectively.

Consistent results were also found for N fertilization on CH₄ concentrations in the soil profile, particularly in the top 30 cm of soil (Figure 3). In the N-fertilized peatland, CH₄ concentrations in the top 0–30 cm (370–4800 ppb) were 49–95% lower than in the control (7800–9500 ppm) (p < 0.01). For both sites, the CH₄ concentrations decreased with depth during the growing season.

3.2. The CO₂ Efflux and Concentrations in the Soil Profiles

N fertilization resulted in an increase in CO₂ efflux from the soil surface from July to September, while CO₂ concentration in the soil profile increased throughout the growing season (May to October) (Figure 4; p < 0.05). In July, the surface CO₂ efflux showed a peak with a 111% increase (4.6 mg m⁻² h⁻¹) with N fertilization (paddy–peatland) compared to the control (the peatland) without N fertilization (2.2 mg m⁻² h⁻¹) (Figure 4).

For the CO₂ concentration in the soil profile, it increased by 132% to 1500 ppm in the 50–60 cm soil layer of the N-fertilized peatland in July compared to the control (p < 0.01). These results suggest that N fertilization promotes CO₂ emissions and increases CO₂ concentrations throughout the whole soil profile (0–60 cm).

3.3. The N₂O Efflux and Concentrations in the Soil Profiles

Nitrogen fertilization increased N₂O efflux during the growing season (May to October) and increased N₂O concentrations in topsoil (0–30 cm) from May to July (Figure 5; p < 0.01). N₂O efflux from the N-fertilized peatland peaked in June (2.38 µg m⁻² h⁻¹), a 26-fold increase compared to the non-fertilized site (0.05 µg m⁻² h⁻¹) (p < 0.01).

Consistent with N₂O efflux, N fertilization increased N₂O concentrations in the soil profiles, especially in the top 30 cm of soil. Compared to the control (peatland), N₂O concentrations in the N-fertilized site (paddy-peatland) increased by 22–26% in the top 0–30 cm in June (Figure 5; p < 0.01). The N₂O concentrations ranged from 363 to 451 ppb from the control and 442–490 ppb from the N-fertilized site in the top 0–30 cm of soil.

3.4. The Global Warming Potential (GWP) Response to N Fertilization

N fertilization led to an increase in the global warming potential (GWP) and peaked in June (673 mg CO₂ eq m⁻²), at which point, the GWP increased 12-fold compared to the control (Figure 6a). The enhancement of N fertilization on GWP weakened and reached its minimum value in September (51 mg CO₂ eq m⁻²), indicating that the marked effect of N fertilization on GWP lasted for 4 months (from May to August) and diminished over time.

N fertilization shifted the dominant contributor to GWP from CH₄ (control) to N₂O (N fertilization) (Figure 6b). At the peatland site (control), the relative contribution of CH₄ to GWP varied from 44% (May) to 87% (July), while at the paddy–peatland site (N fertilization), the relative contribution of CH₄ to GWP varied from only 1% to 15%. The relative contribution of N₂O to GWP at the paddy–peatland site varied up to 82% (September) to 98% (May), with 96% in July, when the contribution of methane was the highest. This suggests that N fertilization causes a change in the dominant GWP contributor from CH₄ to N₂O.

3.5. Abundance of CH₄- and N₂O-Related Genes

Soil samples from July were selected to determine the absolute abundance of soil microorganisms associated with CH₄ and N₂O production and consumption processes, since all fertilization was not completed until that time.

N fertilization increased the abundance of genes related to CH₄ and N₂O production and consumption processes (Figure 7). Compared with the control, AOA-amoA and AOB-amoA abundance in the 0–10 cm soil layer increased 2.3 times and 1.0 time, respectively, while narG and nirK, nirS abundance increased up to 1.3~3.1 and 1.8~7.7, 3.1~23.5 times in the 0–30 cm soil layer at the N fertilization site (p < 0.05). The abundance of nosZ, the only functional gene for N₂O depletion processes, did not show significant differences between the N-fertilized peatland and the control, although it increased 1.0~1.6 times (0–30 cm). N fertilization increased methanogenic (mcrA) abundance by 9.7 times (20–30 cm) (p < 0.001) and methane anaerobic oxidizing (NC10) abundance by 4.2 times (0–10 cm) (p < 0.001). These results indicate that the consumption of N₂O is weaker than its production, while the consumption of CH₄ is stronger than its production, which may be related to the increase in N₂O emissions and the decrease in CH₄ emissions.

3.6. Environmental and Microbiological Factors on CH₄, CO₂ and N₂O

The effects of physicochemical and microbial factors on CH₄, CO₂ and N₂O and the GWP were analyzed using partial least-squares structural equation modeling (PLS-SEM) (Figure 8). PLS-SEM showed that soil pH and NH₄⁺ content significantly affected the abundance of NC10, nirK, nirS, nosZ and narG, as well as CH₄ and N₂O emissions, and CH₄ and N₂O emissions significantly affected GWP.

4. Discussion

Peatlands are important carbon and nitrogen reservoirs and net greenhouse gas sinks, but it is uncertain whether they still function as GHG sinks after being subjected to agricultural N fertilizer inputs [9,27]. Here, we show the greenhouse gas CH₄, N₂O and CO₂ effluxes and concentrations from the soil surface and profiles of long-term N-fertilized peatlands and their contribution to the global warming potential (GWP), together with the distribution of associated microorganisms. Contrary to our hypothesis, N fertilization strengthened the peatland N₂O source, increasing the GWP by 12 times and shifting the major contributor to GWP from CH₄ to N₂O. This effect is particularly pronounced in the top 30 cm of soil, where N₂O concentrations increased by 22–26%. Our results provide important theoretical data for the management of peatlands in the context of increasing N and for the development of greenhouse gas mitigation strategies.

The increase in N₂O emissions due to increased N fertilization is the main cause of elevated GWP in peatlands, and the top 30 cm of soil was the main layer in which N fertilization affected N₂O concentration. N fertilization increased NH₄⁺ content in the 30 cm of soil (Figure S1), as well as the abundance of ammonia-oxidizing archaea (amoA-AOA) and ammonia-oxidizing bacteria (amoA-AOB) (Figure 7). An accelerated ammonia oxidation rate has also been observed [28]. These results suggest that the micro-oxygen environment in the top 30 cm of soil is unfavorable for the reduction of N₂O to N₂, which leads to N₂O accumulation [8]. In contrast, anaerobic conditions in the subsoil (40–60 cm) may be more favorable for denitrification, in which NO₂⁻/NO₃⁻ is directly reduced to N₂ rather than N₂O, resulting in lower N₂O concentrations in the subsoil than in the top 30 cm of soil. Recent studies have also pointed out that oxygen concentrations are more accurate predictors of in situ soil N₂O emissions than functional gene abundance [29,30]. Consistently, the hyporheic zones of small streams, which are micro-oxygen environments, were found to emit a large amount of N₂O from the ammonia oxidation process [22]. The micro-oxygen environment may be an important reason for the higher N₂O concentration in the top 30 cm of soil of the N-fertilized peatland than that in the subsoils. Therefore, the NH₄⁺ content in the micro-oxygen zones of peat soils may be manipulated to reduce N₂O emissions by precise fertilization and to avoid over-fertilization.

Nitrogen fertilization shifted the main contributor to GWP in the peatland from CH₄ to N₂O due to reduced CH₄ emissions via the anaerobic oxidation of CH₄. This shift was most pronounced in July, when the relative contribution of CH₄ to GWP decreased from 87% (control) to 2% (N fertilization), whereas the relative contribution of N₂O to GWP increased from 11% (control) to 96% (N fertilization) (Figure 6b). This may be due to the stronger CH₄ anaerobic oxidation than CH₄ production after N fertilization. We previously reported a 220% increase in the rate of anaerobic oxidation of CH₄ following N fertilization [11]. At the same time, the rate of CH₄ production may have been reduced due to the decrease in soil organic matter and DOC content, which can lead to insufficient carbon substrate for methanogenic archaeal species to utilize [31]. Although N fertilization increased mcrA abundance, a functional methanogenic gene, in the 20–30 cm soil layer, the relationship between mcrA abundance and the rate of CH₄ production is so far inconclusive and remains to be explored, and N fertilization may affect the rate of methanogenesis by altering the community structure of the methanogenic archaea [21]. Our correlation analyses and PLS-SEM results also support the finding that N fertilization reduced CH₄ emissions and profile methane concentrations primarily by promoting the anaerobic oxidation of CH₄ rather than CH₄ production. Results showed that soil NH₄⁺ content and pH were significantly negatively correlated with CH₄ concentration (Figure 8; Table S1; p < 0.01), soil DOC content was positively correlated with CH₄ concentration (Table S1; p < 0.05) and mcrA abundance was significantly negatively correlated with CH₄ concentration (Table S1; p < 0.05). Therefore, the acceleration of the anaerobic oxidation of CH₄ may be closely related to the reduction in CH₄ in N-fertilized peatlands.

Elevated soil pH and NH₄⁺ content after N fertilizer application were the main environmental factors for the increase in N₂O emissions and decrease in CH₄ emissions (Figure 8; Table S1) [9]. This is consistent with existing reports that elevated soil pH promotes the metabolic activities of ammonia-oxidizing microorganisms and CH₄ anaerobic-oxidizing microorganisms (NC10) [11,32]. The increase in NH₄⁺ content provided more active substrates for ammonia-oxidizing microorganisms (AOA and AOB) and NC10 to accelerate the ammonia oxidation and anaerobic oxidation of CH₄, which led to an increase in N₂O emissions and a decrease in CH₄ emissions [9,11,33]. Our PLS-SEM and correlation analyses showed that soil pH and NH₄⁺ content was positively correlated with N₂O concentration and negatively correlated with CH₄ concentration (Figure 8). Therefore, higher soil pH and NH₄⁺ content in N-fertilized peatlands were the main environmental influences leading to higher N₂O concentrations and lower CH₄ concentrations compared to unfertilized peatlands.

5. Conclusions

In conclusion, we observed that N fertilization strengthened the greenhouse gas sources in the northern agricultural peatlands with a 12-fold increase in global warming potential (GWP), especially for N₂O. The N₂O efflux from N-fertilized peatlands was as high as 2.38 µg m⁻² h⁻¹, which was 26 times higher than N₂O efflux from the unfertilized peatlands (0.05 µg m⁻² h⁻¹). Nitrogen fertilization also resulted in a shift in the main contributor to GWP from CH₄ (87%, control) to N₂O (96%, N fertilization), which reduced CH₄ emissions by 87% due to the promotion of methane anaerobic oxidation by N inputs. The top 30 cm of soil was the hotspot for N₂O and CH₄ production and consumption under N fertilization conditions, where N₂O concentrations increased by 22–26% and CH₄ concentrations decreased by 49–95%. Soil pH and NH₄⁺ content were the main environmental impact factors, and they affected N₂O and CH₄ emissions and GWP by regulating key microorganisms (NC10, nirK, nirS, nosZ, narG), with positive effects on N₂O concentrations and negative effects on CH₄ concentrations.

In addition, N fertilization accelerated organic matter decomposition and weakened the carbon storage function of peatlands by facilitating the carbon and nitrogen cycle, as evidenced by reductions in soil organic matter (OM), dissolved organic carbon (DOC), and total nitrogen (TN) content and their negative correlation with N₂O emissions (Table S1). Accelerating the process of anaerobic oxidation of methane may be one of the ways to stabilize the northern peatlands’ GWP in the context of N fertilization and to function as a carbon pool. However, to mitigate the elevated GWP after N fertilization, the mechanisms of CH₄ and N₂O production and consumption processes in response to different levels of N fertilization should also be further explored by isotope tracer experiments, and more detailed microbial information could also be provided by metagenomics and metatranscriptomes techniques. Therefore, more attention should be paid to the top 0–30 cm of soil, which is the key zone to reduce the N-fertilized peatland GHG emissions, and precise fertilization and avoiding over-fertilization can be practiced to reduce N₂O emissions and control the peatlands’ GWP.