Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Treatments
2.2. Identification of SPS Gene Family Members in Apple
2.3. Chromosome Mapping, Subcellular Mapping and Secondary Structure Analysis of Apple SPS Gene Family
2.4. Phylogenetic Tree Construction and Collinearity Analysis of SPS Family
2.5. Motif, Gene Structure, and Cis-Acting Element Analysis of Apple SPS Gene Family
2.6. Codon Bias Analysis of MdSPS Family
2.7. Analysis and Prediction of Interaction Network of Apple SPS Gene Family Proteins
2.8. Expression Analysis of Apple SPS Family Gene Chip
2.9. qRT-PCR Analysis of Apple SPS Family
2.10. Statistical Analysis
3. Results
3.1. Chromosome Mapping and Physicochemical Property Analysis of Apple SPS Gene Family
3.2. Subcellular Localization Prediction and Secondary Structure Analysis of the Apple SPS Family
3.3. Construction of Phylogenetic Tree of Apple SPS Gene Family
3.4. Synteny Analysis of SPS Genes Family
3.5. Motif Analysis of Apple SPS Gene Family and Prediction of Promoter Cis-Acting Elements
3.6. Codon Bias Analysis of Apple SPS Family
3.7. Interaction Analysis of Apple SPS Gene Family Proteins
3.8. Analysis of Expression Patterns in the Apple SPS Gene Family
3.9. Quantitative Fluorescence Analysis of Apple SPS Gene Family
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boyer, J.; Liu, R.H. Apple phytochemicals and their health benefits. Nutr. J. 2004, 3, 5. [Google Scholar] [CrossRef] [PubMed]
- Yingmin, L.; Dapeng, Z.; Haiyan, A.Y. Sugar unloading mechanisms in the developing apple fruit. Acta Hortic. Sin. 1999, 26, 141–146. [Google Scholar]
- Koprivica, G.; Mišljenović, N.; Lević, L.; Petkova, M.; Pribiš, V. Osmotic dehydration of apple in sucrose and sugar beet molasses: Change of nutritive properties of final product. PTEP 2008, 12, 215–218. [Google Scholar]
- Lenz, F. Fruit effects on the dry matter and carbohydrate distribution in apple trees. Acta Hortic. 2009, 835, 21–38. [Google Scholar] [CrossRef]
- Harborne, B.J. Hormonal Regulation of Development I; Encyclopedia of Plant Physiology New Series; Springer: Berlin/Heidelberg, Germany, 1982; Volume 9, p. 681. [Google Scholar]
- Cheng, L.; Zhou, R.; Reidel, E.J.; Sharkey, T.D.; Dandekar, A.M. Antisense inhibition of sorbitol synthesis leads to up-regulation of starch synthesis without altering CO2 assimilation in apple leaves. Planta 2004, 220, 767–776. [Google Scholar] [CrossRef] [PubMed]
- Loescher, W.H. Physiology and metabolism of sugar alcohols in higher plants. Physiol. Plant. 1987, 70, 553–557. [Google Scholar] [CrossRef]
- Zhang, L.Y.; Peng, Y.B.; Sandrine, P.T.; Fan, Y.; Lu, Y.F.; Lu, Y.M.; Gao, X.P.; Shen, Y.Y.; Delrot, S.; Zhang, D.P. Evidence for apoplasmic phloem unloading in developing apple fruit. Plant Physiol. 2004, 135, 574–586. [Google Scholar] [CrossRef] [PubMed]
- Winter, H.; Huber, S.C. Regulation of sucrose metabolism in higher plants: Localization and regulation of activity of key enzymes. Crit. Rev. Biochem. Mol. Biol. 2000, 35, 253–289. [Google Scholar] [CrossRef]
- Stuart, H.; Christine, F.; David, W. The purification and properties of sucrose-phosphate synthetase from spinach leaves: The involvement of this enzyme and fructose bisphosphatase in the regulation of sucrose biosynthesis. Arch. Biochem. Biophys. 1981, 212, 237–246. [Google Scholar]
- Huber, S.C.; Huber, J.L. Role and regulation of sucrose-phosphate synthase in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 431–444. [Google Scholar] [CrossRef]
- Leloir, L.F.; Cardini, C.E. The biosynthesis of sucrose phosphate. J. Biol. Chem. 1955, 214, 65–157. [Google Scholar] [CrossRef]
- Lutfiyya, L.L.; Xu, N.F.; D’Ordine, R.L.; Morrell, J.A.; Miller, P.W.; Duff, S.G. Phylogenetic and expression analysis of sucrose phosphate synthase isozymes in plants. J. Plant Physiol. 2007, 164, 923–933. [Google Scholar] [CrossRef]
- Juan, J.V.; Marcelo, F.; Graciela, S.; Beatriz, J.M.; Luis, H.E. Characterization of a rice sucrose-phosphate synthase-encoding gene. Gene 1996, 170, 217–222. [Google Scholar]
- Langenkämper, G.; Fung, R.M.; Newcomb, R.D.; Atkinson, R.G.; Gardner, R.C.; MacRae, E.A. Sucrose phosphate synthase genes in plants belong to three different families. J. Mol. Evol. 2002, 54, 322–332. [Google Scholar] [CrossRef]
- Huang, D.L.; Qin, C.X.; Gui, Y.Y.; Zhao, L.H.; Chen, Z.L.; Wang, M.; Sun, Y.; Liao, Q.; Li, Y.R.; Lakshmanan, P. Role of the SPS gene families in the regulation of sucrose accumulation in sugarcane. Sugar Tech 2017, 19, 117–124. [Google Scholar] [CrossRef]
- Lee, H.K.; Hwang, W.H.; Jeong, J.H.; Ahn, S.H.; Baek, J.S.; Jeong, H.Y.; Park, H.K.; Ku, B.I.; Yun, J.T.; Lee, G.H.; et al. Analysis of the distribution of assimilation products and the characteristics of transcriptomes in rice by submergence during the ripening stage. BMC Genom. 2019, 20, 18. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Cui, K.; Xu, A.; Nie, L.; Huang, J.; Peng, S. Drought stress condition increases root to shoot ratio via alteration of carbohydrate partitioning and enzymatic activity in rice seedlings. Acta Physiol. Plant. 2015, 37, 9–36. [Google Scholar] [CrossRef]
- Shao, X.W.; Gai, D.S.; Gao, D.P.; Geng, Y.Q.; Guo, L.Y. Effects of salt-alkaline stress on carbohydrate metabolism in rice seedlings. Phyton-Int. J. Exp. Bot. 2022, 91, 745–759. [Google Scholar] [CrossRef]
- Anna, B.K.; Jennifer, M.; Szymon, S.; Justyna, M.; Piotr, O.; Jacek, Z. Sucrose phosphate synthase (SPS), sucrose synthase (SUS) and their products in the leaves of Miscanthus × giganteus and Zea mays at low temperature. Planta 2020, 252, 23. [Google Scholar]
- Xu, N.; Wu, Z.; Li, X.; Yang, M.; Han, J.; Lu, B.; Lu, B.S.; Wang, J. Effects of nicosulfuron on plant growth and sugar metabolism in sweet maize (Zea mays L.). PLoS ONE 2022, 17, e0276606. [Google Scholar] [CrossRef]
- Zhang, W.J.; Wang, J.Q.; Huang, Z.L.; Mi, L.; Xu, K.F.; Wu, J.J.; Fan, Y.H.; Ma, S.Y.; Jiang, D.G. Effects of low temperature at booting stage on sucrose metabolism and endogenous hormone contents in winter wheat spikelet. Front. Plant Sci. 2019, 10, 498–517. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, A.O.; Rocha, D.S., Jr.; Silva, G.B.; Santos, M.G.M.; Camillo, L.R.; de Oliveira, P.H.G.A.; Cavalari, A.A.; Costa, M.G.C. Dynamics of the sucrose metabolism and related gene expression in tomato fruits under water deficit. Physiol. Mol. Biol. Plants 2023, 29, 159–172. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zeng, D.; Liu, Y.; Zhu, W. SlSPS, a sucrose phosphate synthase gene, mediates plant growth and thermotolerance in tomato. Horticulturae 2022, 8, 491–504. [Google Scholar] [CrossRef]
- Yu, Q.; Sun, W.; Han, Y.; Hao, J.; Qin, X.; Liu, C.; Fan, S. Exogenous spermidine improves the sucrose metabolism of lettuce to resist high-temperature stress. Plant Growth Regul. 2022, 96, 497–509. [Google Scholar] [CrossRef]
- Wang, L.; Zhai, Y.; Wu, J.; Stevanato, P.; Sha, S.; Geng, G.; Xu, Y.; Yu, L.; Wang, Y. Low night temperature-induced feedback inhibition of photosynthesis through sucrose accumulation in sugar beet (Beta vulgaris L.) leaves. Environ. Exp. Bot. 2022, 204, 105083. [Google Scholar] [CrossRef]
- Zuo, X.; Cao, S.; Ji, N.; Li, Y.; Zhang, J.; Jin, P.; Zheng, Y. High relative humidity enhances chilling tolerance of zucchini fruit by regulating sugar and ethanol metabolisms during cold storage. Postharvest Biol. Technol. 2022, 189, 111932. [Google Scholar] [CrossRef]
- Li, C.; Sun, L.; Zhu, J.; Cheng, Y.; Huang, R.; Fan, Y.; Guo, M.; Ge, Y. Trehalose maintains the quality of Malus domestica by mediating sucrose and respiratory metabolism. Sci. Hortic. 2022, 295, 110857. [Google Scholar] [CrossRef]
- Wang, X.; Wei, Y.; Chen, Y.; Jiang, S.; Xu, F.; Wang, H.; Shao, X. NMR revealed that trehalose enhances sucrose accumulation and alleviates chilling injury in peach fruit. Sci. Hortic. 2022, 303, 111190. [Google Scholar] [CrossRef]
- Jiang, S.Y.; Chi, Y.H.; Wang, J.Z.; Zhou, J.X.; Cheng, Y.S.; Zhang, B.L.; Ma, A.; Vanitha, J.; Ramachandran, S. Sucrose metabolism gene families and their biological functions. Sci. Rep. 2015, 5, 17583–17607. [Google Scholar] [CrossRef]
- Hongxia, T.; Hanqing, S.; Yufei, W.; Xin, W.; Yanping, G. Effects of water stress on quality and sugar metabolism in ‘Gala’ apple fruit. Hortic. Plant J. 2023, 9, 60–72. [Google Scholar]
- Finn, R.D.; Clements, J.; Eddy, S. RHMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar] [PubMed]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Mcwilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Lescot, M. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef]
- Castleden, C.K.; Aoki, N.; Gillespie, V.J.; MacRae, E.A.; Quick, W.P.; Buchner, P.; Foyer, C.H.; Furbank, R.T.; Lunn, J.E. Evolution and function of the sucrose-phosphate synthase gene families in wheat and other grasses. Plant Physiol. 2004, 135, 1753–1764. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Zhao, J.T.; Hu, B.; Li, J.Q.; Qin, Y.Q.; Chen, L.H.; Qin, Y.H.; Hu, G.B. Identification and expression profile analysis of the sucrose phosphate synthase gene family in Litchi chinensis Sonn. PeerJ 2018, 6, 4379–4391. [Google Scholar] [CrossRef] [PubMed]
- Vimolmangkang, S.; Zheng, H.Y.; Peng, Q.; Jiang, Q.; Wang, H.L.; Fang, T.; Liao, L.; Wang, L.; He, H.P.; Han, Y.P. Assessment of sugar components and genes involved in the regulation of sucrose accumulation in peach fruit. J. Agric. Food Chem. 2016, 64, 6723–6729. [Google Scholar] [CrossRef]
- Huang, T.W.; Luo, X.L.; Wei, M.G.; Shan, Z.Y.; Zhu, Y.M.; Yang, Y.N.; Fan, Z.P. Molecular cloning and expression analysis of sucrose phosphate synthase genes in cassava (Manihot esculenta Crantz). Sci. Rep. 2020, 10, 20707. [Google Scholar] [CrossRef] [PubMed]
- Masaki, O.; Naohiro, A.; Tatsuro, H.; Madoka, Y.; Chikara, O.; Ryu, O. Tissue specificity and diurnal change in gene expression of the sucrose phosphate synthase gene family in rice. Plant Sci. 2011, 181, 159–166. [Google Scholar]
- Ma, P.P.; Zhang, X.T.; Chen, L.P.; Zhao, Q.; Zhang, Q.; Hua, X.T.; Wang, Z.C.; Tang, H.B.; Yu, Q.Y.; Zhang, M.Q.; et al. Comparative analysis of sucrose phosphate synthase (SPS) gene family between Saccharum officinarum and Saccharum spontaneum. BMC Plant Biol. 2020, 20, 422. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.K.; Yang, L.; Zhu, H.J.; Zhou, J.; Sun, H.; Gong, H.J. Structure and expression analysis of sucrose phosphate synthase, sucrose synthase and invertase gene families in Solanum lycopersicum. Int. J. Mol. Sci. 2021, 22, 4698. [Google Scholar] [CrossRef] [PubMed]
- Liao, G.; Li, Y.; Wang, H.; Liu, Q.; Zhong, M.; Jia, D.; Huang, C.; Xu, X. Genome-wide identification and expression profiling analysis of sucrose synthase (SUS) and sucrose phosphate synthase (SPS) genes family in Actinidia chinensis and A. eriantha. BMC Plant Biol. 2022, 22, 215. [Google Scholar] [CrossRef] [PubMed]
- Robi, N.; Gulnaz, P.; Muhammad, N.; Naila, H.; Amtul, S.; Irfan, U. Comparative expression analysis of sucrose phosphate synthase gene family in a low and high sucrose Pakistani sugarcane cultivars. PeerJ 2023, 11, e15832. [Google Scholar]
- Jiafang, S.; Yiran, X.; Songli, Y.; Fuxiao, J.; Yi, H.; Haifeng, C.; Chanjuan, Z. Genome-wide identification of GmSPS gene family in soybean and expression analysis in response to cold stress. Int. J. Mol. Sci. 2023, 24, 12878. [Google Scholar]
- Hu, J.; Duan, Y.; Hu, J.; Zhang, S.; Li, G. Phylogenetic and expression analysis of the sucrose synthase and sucrose phosphatesynthase gene family in potatoes. Metabolites 2024, 14, 70. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Cang, J.; Zhang, D.; Zhang, D.; Lu, Q.W.; Liu, H.L. Effects of SA treatment on winter wheat (Triticum aestivum L.) sucrose metabolism in low temperature. Plant Physiol. J. 2015, 51, 537–545. [Google Scholar]
- Zhao, F.C.; Jing, L.Q.; Yan, F.B.; Lu, D.L.; Lu, W.P. Effects of heat stress during grain filling on sugar accumulation and enzyme activity associated with sucrose metabolism in sweet corn. Acta Agron. Sin. 2013, 39, 1644. [Google Scholar] [CrossRef]
- Alscher, R.G.; Cumming, J.R.; Krikorian, A.D. Stress responses in plants: Adaptation and acclimation mechanisms. Q. Rev. Biol. 1990, 66, 3. [Google Scholar]
- Ana, B.G.; Janice, D.A.; Suresh, L.; Tom, G.; Marc, V.M.; Allan, B.C. Effects of osmoprotectants upon NaCl stress in rice. Plant Physiol. 1997, 115, 159–169. [Google Scholar]
- Quick, W.P.; Chaves, M.M.; Wendler, R.; David, M.; Rodrigues, M.L.; Passaharinho, J.A.; Pereira, J.S.; Adcock, M.D.; Leegood, R.C.; Stitt, M. The effect of water stress on photosynthetic carbon metabolism in four species grown under field conditions. Plant. Cell Environ. 1992, 15, 25–35. [Google Scholar] [CrossRef]
- Carpita, N.; Sabularse, D.; Montezinos, D.; Delmer, D.P. Determination of the pore size of cell walls of living plant cells. Science 1979, 205, 1144–1147. [Google Scholar] [CrossRef]
- Du, Y.L.; Zhao, Q.; Chen, L.R.; Yao, X.D.; Zhang, H.J.; Wu, J.J.; Xie, F.T. Effect of drought stress during soybean R2–R6 growth stages on sucrose metabolism in leaf and seed. Int. J. Mol. Sci. 2020, 21, 618–637. [Google Scholar] [CrossRef]
- Vassey, T.L.; Sharkey, T.D. Mild water stress of Phaseolus vulgaris plants leads to reduced starch synthesis and extractable sucrose phosphate synthase activity. Plant Physiol. 1989, 89, 1066–1070. [Google Scholar] [CrossRef]
- Keller, F.; Ludlow, M.M. Carbohydrate metabolism in drought-stressed leaves of pigeonpea (Cajanus cajan). J. Exp. Bot. 1993, 44, 1351–1359. [Google Scholar] [CrossRef]
- Chen, L.; Zheng, F.; Feng, Z.; Li, Y.; Ma, M.; Wang, G.; Zhao, H. A vacuolar invertase CsVI2 regulates sucrose metabolism and increases drought tolerance in Cucumis sativus L. Int. J. Mol. Sci. 2021, 23, 176–190. [Google Scholar] [CrossRef]
- Wang, Y.; Feng, Y.F.; Yan, M.; Yu, J.; Zhou, X.F.; Bao, J.K.; Zhang, Q.Q.; Wu, C.Y. Effect of saline–alkali stress on sugar metabolism of jujube fruit. Horticulturae 2022, 8, 474. [Google Scholar] [CrossRef]
- Jun, P.; Liu, J.A.; Zhang, L.; Luo, J.Y.; Dong, H.L.; Ma, Y.; Zhao, X.H.; Chen, B.L.; Sui, N.; Zhao, Z.G.; et al. Effects of soil salinity on sucrose metabolism in cotton leaves. PLoS ONE 2016, 11, e0156241. [Google Scholar]
- Geigenberger, P.; Reimholz, R.; Deiting, U.; Sonnewald, U.; Stitt, M. Decreased expression of sucrose phosphate synthase strongly inhibits the water stress-induced synthesis of sucrose in growing potato tubers. Plant J. 1999, 19, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Kawamura, Y.; Uemura, M. Plant Low-Temperature Tolerance and Its Cellular Mechanisms; John Wiley Sons Inc.: Hoboken, NJ, USA, 2014. [Google Scholar]
- Guy, C.L.; Huber, J.L.; Huber, S.C. Sucrose phosphate synthase and sucrose accumulation at low temperature. Plant Physiol. 1992, 100, 502–508. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Xu, F.; Wang, H.; Liu, H.; Yu, L.; Shao, X.; Ni, Z. Differences in sucrose metabolism in peach fruit stored at chilling stress versus nonchilling stress temperatures. HortScience 2015, 50, 1542–1548. [Google Scholar] [CrossRef]
- Kamal, D.S.; Gaurav, P.; Asha, K. Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature. J. Genet. 2021, 100, 71–85. [Google Scholar]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GADPH | TTCTCGTTGAGGGCTATTCCA | CCACAGACTTCATCGGTGACA |
MdSPS1 | GGACACGGACTACGAAGGATTGC | AGTGCCAGGACATCGGATAGAGG |
MdSPS2 | TTGACCCACTTCCACCCTGAAATTG | TCCAGCCTTGCCATTGTGAAGATG |
MdSPS3 | TTGACCCACTTCCACCCTGAAATTG | TCCAGCCTTGCCATTGTGAAGATG |
MdSPS4 | TGACTGGATTGGTTGAGTGCTATGC | AATGTAACCAGCGACTACGACAAGG |
MdSPS5 | CCTCCTGGCATGGACTTCAGTAATG | AACCGCATCACTTCTGACCATATCG |
MdSPS6 | AACTTGCTCGTGCTCTGGCTAATAC | TGGGTTCACCGTAGCTGGAGTC |
MdSPS7 | TGACACCAAGGGAGAGGGATGAAG | CAAGGATGACGCAGCAGCAATTC |
MdSPS8 | ATGGAGATGGGGATGGTGAAGGAG | CTGGCAAGGGCAAGTATCATAGGC |
MdSPS9 | CCCTACGCAGAGAAGCAGAAACG | ATGTCCAGCCTTGCCATTGAGAAG |
MdSPS10 | GTGTGAAGCCAGGAGCCAAGAC | AGTGTAGACAAGGTTGCATCGGAAG |
MdSPS11 | AACTAATCGAGTGAGCAACGGTGAG | CCGCAAGTCATAGCCTCCACAAC |
MdSPS12 | GGGAATCACACAGAGGGCTCAAAC | CCAATATGCTCGTCGTTCTGCTCAG |
MdSPS13 | CTTCAGGCTCCAGATCCCTCTACC | CTCCAGTGTCAGGCAAACCCAAG |
MdSPS14 | ACCAACCTCAGCAGTCCCTCAG | TGACGCAGCAGCAATTCCATAGG |
MdSPS15 | GCCGTTTCAGTCCGACTCGTTAC | ATCCGCCAGCACATATTCTCCAAC |
MdSPS16 | GGTGGTTGTCGCTGGAGAATGC | AGTTTCGGTTCGTGTGGAGTTGAC |
MdSPS17 | GCCGAGGATGCGATCAAGGAAC | ACCCAATTTGAGTGCCATCAGTGAG |
MdSPS18 | TTCTTGCTCCTTTCGTGGCTCTTG | GCACTCTCCGTCAATAAGCTCTTCC |
MdSPS19 | CAGGCGGGCAGGTAGTTTACATTC | CCTTGCTTCGGGTATGAGTCTTGTC |
Gene Name | Gene Accession | GDR | Amino Acid/aa | Molecular Weight/Da | pI | Instability Index | Aliphatic Index | Grand Average of Hydropathicity |
---|---|---|---|---|---|---|---|---|
MdSPS1 | MD02G1022300 | MDP0000288876 | 1055 | 118,220.19 | 6.08 | 47.86 | 89.10 | −0.420 |
MdSPS2 | MD02G1100500 | MDP0000160578 | 806 | 92,581.30 | 6.00 | 32.68 | 94.08 | −0.269 |
MdSPS3 | MD02G1100600 | MDP0000872262 | 807 | 92,569.29 | 6.05 | 31.51 | 94.46 | −0.269 |
MdSPS4 | MD03G1291300 | - | 306 | 34,951.07 | 6.02 | 32.57 | 83.92 | −0.158 |
MdSPS5 | MD04G1013500 | MDP0000783676 | 1065 | 119,183.48 | 6.15 | 42.60 | 83.77 | −0.481 |
MdSPS6 | MD05G1006400 | MDP0000256965 | 1024 | 115,199.99 | 6.76 | 46.62 | 88.32 | −0.444 |
MdSPS7 | MD06G1237200 | - | 899 | 101,283.99 | 6.79 | 37.77 | 85.52 | −0.270 |
MdSPS8 | MD08G1157000 | - | 663 | 74,815.07 | 6.17 | 46.50 | 85.78 | −0.492 |
MdSPS9 | MD09G1280200 | - | 833 | 94,483.07 | 6.37 | 34.36 | 87.94 | −0.300 |
MdSPS10 | MD10G1002300 | - | 516 | 57,616.61 | 6.69 | 43.70 | 95.35 | −0.296 |
MdSPS11 | MD11G1307000 | MDP0000126946 | 812 | 92,891.09 | 5.77 | 38.93 | 89.37 | −0.290 |
MdSPS12 | MD13G1164000 | - | 305 | 34,488.82 | 5.67 | 43.93 | 106.10 | −0.092 |
MdSPS13 | MD13G1164200 | - | 639 | 72,997.50 | 6.03 | 34.68 | 89.72 | −0.254 |
MdSPS14 | MD14G1244000 | MDP0000212593 | 898 | 101,084.66 | 6.81 | 39.45 | 83.44 | −0.276 |
MdSPS15 | MD15G1127900 | MDP0000174537 | 1057 | 118,011.50 | 6.04 | 49.04 | 84.71 | −0.465 |
MdSPS16 | MD15G1164900 | - | 1055 | 118,134.12 | 6.09 | 47.40 | 89.00 | −0.412 |
MdSPS17 | MD15G1223500 | MDP0000250070 | 807 | 92,371.03 | 5.87 | 32.26 | 95.18 | −0.266 |
MdSPS18 | MD16G1164000 | - | 850 | 97,377.40 | 5.99 | 35.33 | 89.46 | −0.229 |
MdSPS19 | MD17G1287000 | - | 843 | 95,854.58 | 7.21 | 39.45 | 86.65 | −0.323 |
Protein | Cytoplasm | Chloroplast | Nucleus | Plasma Membrane | Mitochondria | Peroxisome |
---|---|---|---|---|---|---|
MdSPS1 | 3 | 3 | 6 | 1 | - | - |
MdSPS2 | 7 | - | 2 | 2 | 2 | - |
MdSPS3 | 11 | - | 2 | - | - | - |
MdSPS4 | 2 | 4 | - | 3 | - | - |
MdSPS5 | 4 | 1 | 7 | 1 | - | - |
MdSPS6 | 4.5 | 2 | 3.5 | 1 | - | - |
MdSPS7 | 2.5 | 3 | 3.5 | 4 | - | - |
MdSPS8 | 8 | 3 | 2 | - | - | - |
MdSPS9 | 12 | 1 | - | - | - | - |
MdSPS10 | 6 | 3 | - | 1 | 1 | 1 |
MdSPS11 | 5 | 3 | - | 2 | 3 | - |
MdSPS12 | 12 | 1 | - | - | - | - |
MdSPS13 | 8 | 2 | - | 2 | 2 | - |
MdSPS14 | 4 | 2 | 3 | 2 | - | 2 |
MdSPS15 | 6 | 2 | 4 | 1 | - | - |
MdSPS16 | 3 | 3 | 6 | 1 | - | - |
MdSPS17 | 6 | - | 3 | - | 4 | - |
MdSPS18 | 7 | 6 | - | - | - | - |
MdSPS19 | 11 | 2 | - | - | - | - |
Protein | Alpha Helix/% | Extended Strand/% | Beta Turn/% | Random Coil/% |
---|---|---|---|---|
MdSPS1 | 41.90 | 13.36 | 6.45 | 38.29 |
MdSPS2 | 54.47 | 12.41 | 6.45 | 26.67 |
MdSPS3 | 54.52 | 12.89 | 6.82 | 25.77 |
MdSPS4 | 64.71 | 10.46 | 7.52 | 17.32 |
MdSPS5 | 40.66 | 13.24 | 6.57 | 39.53 |
MdSPS6 | 41.21 | 14.16 | 6.74 | 37.89 |
MdSPS7 | 48.50 | 12.24 | 6.45 | 32.81 |
MdSPS8 | 45.55 | 10.86 | 6.79 | 36.80 |
MdSPS9 | 52.70 | 12.85 | 6.60 | 27.85 |
MdSPS10 | 34.50 | 19.19 | 7.95 | 38.37 |
MdSPS11 | 52.71 | 13.42 | 6.77 | 27.09 |
MdSPS12 | 44.59 | 15.41 | 5.57 | 34.43 |
MdSPS13 | 52.58 | 13.15 | 7.20 | 27.07 |
MdSPS14 | 49.78 | 12.03 | 6.68 | 31.51 |
MdSPS15 | 40.02 | 13.81 | 6.62 | 39.55 |
MdSPS16 | 42.18 | 13.27 | 6.64 | 37.91 |
MdSPS17 | 54.52 | 12.64 | 6.20 | 26.64 |
MdSPS18 | 52.35 | 13.88 | 6.94 | 26.82 |
MdSPS19 | 52.79 | 11.86 | 6.05 | 29.30 |
Amino Acid | Condon | RSCU | Amino Acid | Condon | RSCU |
---|---|---|---|---|---|
Phe | UUU | 1.053 | Ala | GCU | 1.388 |
UUC | 0.947 | GCC | 0.864 | ||
Leu | UUA | 0.762 | GCA | 1.237 | |
UUG | 1.385 | GCG | 0.508 | ||
CUU | 1.342 | Tyr | UAU | 1.091 | |
CUC | 0.912 | UAC | 0.909 | ||
CUA | 0.543 | His | CAU | 1.237 | |
CUG | 1.055 | CAC | 0.763 | ||
Ile | AUU | 1.324 | Gln | CAA | 1.108 |
AUC | 0.867 | CAG | 0.892 | ||
AUA | 0.809 | Asn | AAU | 1.116 | |
Met | AUG | 1 | AAC | 0.884 | |
Val | GUU | 1.469 | Lys | AAA | 0.902 |
GUC | 0.821 | AAG | 1.098 | ||
GUA | 0.561 | Asp | GAU | 1.292 | |
GUG | 1.149 | GAC | 0.709 | ||
Ser | UCU | 1.302 | Glu | GAA | 1.018 |
UCC | 0.796 | GAG | 0.982 | ||
UCA | 1.306 | Cys | UGU | 0.993 | |
UCG | 0.554 | UGC | 1.007 | ||
AGU | 1.061 | Trp | UGG | 1 | |
AGC | 0.982 | Arg | CGU | 0.704 | |
Pro | CCU | 1.242 | CGC | 0.485 | |
CCC | 0.811 | CGA | 0.801 | ||
CCA | 1.327 | CGG | 0.545 | ||
CCG | 0.618 | AGA | 1.947 | ||
Thr | ACU | 1.263 | AGG | 1.519 | |
ACC | 0.918 | Gly | GGU | 0.944 | |
ACA | 1.401 | GGC | 0.889 | ||
ACG | 0.419 | GGA | 1.375 | ||
GGG | 0.79 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, S.; Feng, Y.; Cao, X.; Hu, H.; Yang, J.; Li, W.; Hou, Y.; Ma, Z. Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy 2024, 14, 1237. https://doi.org/10.3390/agronomy14061237
Yang S, Feng Y, Cao X, Hu H, Yang J, Li W, Hou Y, Ma Z. Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy. 2024; 14(6):1237. https://doi.org/10.3390/agronomy14061237
Chicago/Turabian StyleYang, Shangwen, Yongqing Feng, Xuejing Cao, Huanhuan Hu, Jinghua Yang, Wenfang Li, Yingjun Hou, and Zonghuan Ma. 2024. "Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses" Agronomy 14, no. 6: 1237. https://doi.org/10.3390/agronomy14061237
APA StyleYang, S., Feng, Y., Cao, X., Hu, H., Yang, J., Li, W., Hou, Y., & Ma, Z. (2024). Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy, 14(6), 1237. https://doi.org/10.3390/agronomy14061237