Next Article in Journal
Study on the Changes in the Microbial Community in Rhizosphere Soil of Blueberry Plants at Different Growth Stages
Previous Article in Journal
Feasibility of Nondestructive Soluble Sugar Monitoring in Tomato: Quantified and Sorted through ATR-FTIR Coupled with Chemometrics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Combining Physiology and Transcriptome Data Screening for Key Genes in Actinidia arguta Response to Waterlogging Stress

1
College of Life Science, Jilin Agricultural University, Changchun 130118, China
2
College of Horticulture, Jilin Agricultural University, Changchun 130118, China
3
College of Landscape Architecture, Changchun University, Changchun 130022, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(10), 2391; https://doi.org/10.3390/agronomy14102391
Submission received: 8 September 2024 / Revised: 10 October 2024 / Accepted: 14 October 2024 / Published: 16 October 2024
(This article belongs to the Section Water Use and Irrigation)

Abstract

:
Actinidia arguta is a cold-resistant fruit tree but intolerant to waterlogging. Waterlogging stress is the major abiotic stress in A. arguta growth, and several pathways are involved in the response mechanisms. Fifteen physiological indices and transcriptome data of two A. arguta cultivars, which showed two forms under waterlogging, were used to identify the major factor following the leaf senescence in waterlogging. Through principal component analysis (PCA) of 15 physiological indices in ‘Kuilv’ and ‘Lvwang’, the hormone contents were selected as the most important principal component (PCA 2) out of four components in response to waterlogging stress. According to the analysis of transcriptome data, 21,750 differentially expressed genes were identified and 10 genes through WGCNA, including hormone metabolism and sucrose metabolism, were screened out on the 6th day of waterlogging. In particular, the ABA signal transduction pathway was found to be closely related to the response to waterlogging based on the correlation analysis between gene expression level and plant hormone content, which may have regulated physiological indicators and morphological changes together with other hormones. Overall, the phenomenon of leaves falling induced by ABA might be a protective mechanism. The results provided more insights into the response mechanism of coping with waterlogging stress in A. arguta.

1. Introduction

Actinidia arguta (Sieb. et Zucc.) Planch. ex Miq. is a large deciduous vine of the genus Actinidia belonging to the family Actinidiaceae, which has high nutritional value, unique flavor, and excellent taste [1]. It is mainly distributed in China, Japan, the Korean Peninsula, and Russia and has garnered increasing interest [2]. In China, the cultivation area of A. arguta is about 1200 hm2 [3], and the annual yield has reached 1000 t [4]. A. arguta is a cold-resistant fruit tree but intolerant to waterlogging compared with Actinidia chinensis and Actinidia valvata [5] and shows obvious morphological changes on the 6th day of waterlogging stress, while the plants sustain varied degrees of damage to their leaves and roots [6]. With the increasing global rainfall [7], more and more stem rot and freezing damage will occur in A. arguta after waterlogging stress, resulting in death. Different A. arguta resources respond differently to waterlogging stress which reflects the waterlogging tolerance. The waterlogging tolerance of A. arguta resources is currently little understood, and the morphology-based approach to resource evaluation in kiwifruit is quite generic and does not provide a comprehensive description of all damage forms. Therefore, unveiling the morphological response mechanisms underlying waterlogging will provide reference for a more accurate resource evaluation method, which is the first step to screening waterlogging-tolerant resources of A. arguta.
Plants directly reflect morphological changes after suffering from waterlogging stress [8]. Under waterlogging conditions, leaf yellowing [9], shedding, plant wilting [8], and other phenomena occur. At the same time, adaptive morphological changes, such as stomatal closure [10], formation of adventitious roots [11], aerenchyma, and internode elongation [12], are also induced. These morphological changes are to take plants out of the hypoxic environment and obtain oxygen for protection and are related to changes in hormone contents. Plant hormones are signaling molecules produced by plants which can affect physiological processes at extremely low concentrations. They are carried to various sections after synthesis, where they control the expression of downstream genes to adapt to the changing surroundings. Waterlogging can lead to changes in endogenous hormone synthesis and signal transduction in plants; for example, red pepper maintains its growth by increasing the content of auxin and ethylene under waterlogging stress [13], and exogenous indole acetic acid (IAA) can enable plants to adapt to this stress by increasing the synthesis of organic matter [14]. Abscisic acid (ABA) can affect the water and proline contents of plant leaves, thereby enhancing the adaptability to stress [15]. Upon waterlogging, the gene expression profiling of kiwifruit was analyzed by transcriptome sequencing, which showed that differentially expressed genes were enriched in plant hormone signal transduction in the first place [16]. Ethylene may regulate the response of kiwifruit to waterlogging together with GA3, ABA, and BR signaling pathways [17]. The auxin signaling molecules IAA 13 and ARF 19 regulated the formation of aerenchyma by inducing LBD transcription factors [18]. The roots of citrus rootstocks elongated under waterlogging stress, and the expression of genes associated with auxin synthesis, protein expansion, and glucan hydrolase significantly increased [19]. In summary, the morphological changes occurring in these plants are all those that hormones as signaling molecules are responsible for in response to waterlogging. Therefore, we conjecture that the phenomena of yellowing and defoliation of A. arguta after waterlogging are regulated by endogenous hormones to cope with stress. At present, several hormone-related genes, such as IAA and PYL, have been identified by molecular techniques, but how these genes lead to premature leaf senescence in waterlogging is unknown.
To date, several studies have uncovered the transcriptome and physiological changes of kiwifruit. Nonetheless, little information is currently available on response mechanisms underlying A. arguta’s adaptation to waterlogging. When exploring waterlogging tolerance, the focus should be on the indicators, such as the adaptive mechanisms during waterlogging, to improve the survival rate of plants. A principal component analysis (PCA) was performed with 15 physiological indices affected by different levels of waterlogging stress. At the same time, transcriptome sequencing was carried out using leaves during the key time period for the morphological changes to elucidate the internal factors of adaptive morphology in response to waterlogging stress. More precisely, which physiological indicators were involved in this response and the genes expressed should be known. These findings may serve as the foundation for a precise technique of resource evaluation that will screen A. arguta germplasm for waterlogging tolerance.

2. Materials and Methods

2.1. Plant Materials

To elucidate the factors associated with A. arguta waterlogging tolerance, the primary cultivars of the male plant, ‘Lvwang’, and the female plant, ‘Kuilv’, were chosen as re-search plant materials due to their varying levels of tolerance following waterlogging. In June 2019, the semi-lignified vegetative branches of ‘Kuilv’ and ‘Lvwang’ (provided by Genbank for A. arguta, Jilin Agricultural University Field, Changchun city, Jilin Province, China) were cut into 15 cm pieces for cultivation in a plastic shed. The temperature and humidity were maintained from 25~30 °C and 95~100% RH. After rooting, the plastic shed was removed. In April 2020, the one-year-old seedlings were transplanted into 0.035 m3 pots. Then, they were transferred to the greenhouse (18–30 °C, 50~70% RH) for daily management.
In July 2020, healthy and uniformly grown plants were selected to conduct waterlogging for 0, 3, 6, 9, and 12 days, and these treatments are abbreviated as D0, D3, D6, D9, and D12 in the following, respectively. An appropriate amount of water was added to pots every day to keep the soil moist at 75–85% in D0, while plants were waterlogged 2 cm above the soil surface on different days, at D3, D6, D9, and D12. After the waterlogging treatment, excess water was discharged from the pot. Each treatment was repeated three times, with ten plants per replicate. The leaves were frozen in liquid nitrogen after collection and stored in a refrigerator at −80 °C.

2.2. Calculation of Waterlogging Index and Yellowing Area Ratio

The waterlogging index was calculated according to kiwifruit [5] and the morphology under waterlogging was divided into 6 levels as follows: level 0: no symptoms of damage, level 1: 1/3 of plant leaves were damaged, level 2: 2/3 of plant leaves were damaged, level 3: all plant leaves were damaged or 1/3 of leaves dried and fell off, level 4: 2/3 leaves dried and fell off, and level 5: all leaves dried and fell and the plant died.
Waterlogging index (%) = [∑ (number of each level × number of trees in this level)/(the highest level ×total tree number)] × 100 %
The yellowing area ratio of leaves (%) was calculated using ImageJ 2022 (https://imagej.nih.gov/ij/features.html, accessed on 27 October 2023).

2.3. Measurement of Antioxidant Enzyme Activities

The activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were determined as described in Zhu et al. [20] by the absorbance at 560 nm, 470 nm, and 240 nm, respectively.

2.4. Determination of Reactive Oxygen Forms

The hydrogen (H2O2), malondialdehyde (MDA), and superoxide anion (O2) contents were determined as described in Deng et al. [21].

2.5. Plant Hormone Content Measurement

Indole-3-acetic acid (IAA), abscisic acid (ABA), and gibberellin (GA3) contents were determined according to Zhou [22], with slight modifications. Using high-performance liquid chromatography (HPLC; Agilent 1260, Santa Clara, CA, USA), 1 g of the sample was first ground on ice and then extracted with 15 mL of 80% methanol at 4 °C for 16 h. The extract was centrifuged at 6000 r/min for 10 min. After centrifugation, the supernatant was collected, and the filter residue was mixed at a volume ratio of 1:5 and then extracted twice. The supernatant was added to 0.2 g PVP in a shaker and filtered by filter paper at room temperature for 20 min. The filtrate was passed through a solid phase extraction (SPE) C18 column, and the effluent was evaporated at 40 °C. The evaporation bottle was rinsed with 10 mL phosphate buffer (pH 3.5). The aqueous phase was extracted with ethyl acetate 3 times, and the ethyl acetate phase was combined and evaporated. Finally, the sample was dissolved in 2 mL methanol and passed through a 0.45 µm organic membrane filter. The column temperature was set to 35 °C. The mobile phase A was pure (100%) methanol, and the mobile phase B was the aqueous solution of glacial acetic acid (PH 3.2), with the isocratic elution of V (A):V (B) = 5.5:4.5. The flow rate was 1 mL/min, and the wavelength was 254 nm; the injection volume was 10 µL of each sample, and the external standard method was used for quantification.

2.6. Determination of Soluble Sugar Content

The soluble sugars were determined by a reagent kit (Solarbio BC0035, Beijing, China).

2.7. Measurement of Chlorophyll Content

The leaves were cut into pieces and immersed in 10 mL ethanol:acetone (1:1) until the leaves turned white, and the absorbance values were determined at 665 nm, 649 nm, and 470 nm.
Chlorophyll content (mg/g) = (pigment concentration × extract volume × dilution)/sample weight

2.8. Evaluation of Root Activity

The root activity was measured using the 2,3,5-triphenyltetrazolium chloride (TTC) staining method according to Onanuga et al. [23].

2.9. Transcriptome Analysis

Through the morphology and physiology changes, the indices changed more obviously in D6. The leaves of ‘Kuilv’ and ‘Lvwang’ plants grown under normal management, waterlogging for 3 days, and waterlogging for 6 days were selected, mentioned as K0, K3, K6, L0, L3, L6 in the following, and total RNA was extracted by the Trizol reagent kit (Invitrogen, CA, Carlsbad, CA, USA). The quantity and purity of total RNA samples were analyzed using the Bioanalyzer 2100 and RNA 1000 Nano Lab Chip Kit (Agilent, CA, Santa Clara, CA, USA) with RNA integrity number (RIN) value > 7.0. Poly (A) RNA was purified from total RNA (5 µg) using poly-T oligo-attached magnetic beads in two rounds of purification. Thereafter, the paired-end sequencing was performed on an Illumina Novaseq™ 6000 sequencing platform (LC Sciences, Houston, TX, USA) following the vendor’ s recommended protocol.
Firstly, Cutadapt and Perl in-house scripts were used to remove the reads that contained adaptor contamination, low-quality bases, and undetermined bases. Then, the quality of sequencing data, including the Q20, Q30, and GC content of the clean data, was verified using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). All downstream analyses were performed on clean data of high quality. All assembled unigenes were aligned against the databases, including non-redundant (NR) protein sequences (http://www.ncbi.nlm.nih.gov/), Gene Ontology (GO) (http://www.geneontology.org), SwissProt (http://www.expasy.ch/sprot/), Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/), and EggNOG (http://eggnogdb.embl.de/) using DIAMOND with a threshold E-value < 0.00001.
Salmon was used to determine expression levels for unigenes by calculating transcripts per million reads (TPM). The differentially expressed unigenes were selected with log 2 (fold change) > 1 or log 2 (fold change) < –1 and statistical significance (p-value < 0.05) by R package EdgeR 2.7.

2.10. WGCNA

The WGCNA software package (R package 4.3.0) was used to calculate the co-expression similarity coefficient between genes. According to gene expression and physiological index, the soft power value was set at 8. Then, 14,400 differentially expressed genes were used to make the heatmap. Combining the gene expression and physiological index, the correlation coefficient and p-value were calculated, and the modules related to the physiological index were screened.

2.11. Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR) Analysis

The qRT-PCR primers for candidate genes were designed by Primer 5 and synthesized by Sangon Biotech Co. (Shanghai, China). In this study, the leaves of plants exposed to three different levels of waterlogging stress were used as materials, and β-actin (Table 1) was used as the internal reference gene. The relative expression level of genes was calculated using the 2−CT method. The total reaction system was 20 µL, including 10 µL of 2x SYBR Green Supermix, 0.4 µL of forward primer, 0.4 µL of reverse primer, 1 µL of cDNA, and 7.8 µL of ddH2O. The reaction procedure was as follows: 94 °C 30 s, 94 °C 5 s, and 60 °C 30 s, with 45 cycles. Three biological replicates were considered for each sample.

2.12. Statistical Analysis

Excel 2019 was used to sort out the data and SPSS Statistics 20.0 was used for principal component analysis and correlation. SigmaPlot 15.0 was used to create diagrams. Cytoscape was used to visualize the WGCNA.

3. Results

3.1. Morphological Changes in A. arguta Plants under Waterlogging Stress

There was no significant change in ‘Kuilv’ and ‘Lvwang’ after 3 days of waterlogging stress, and the physiological indices increased slightly, which may be due to the response to short-term waterlogging stress. At D6, two morphological differences appeared. ‘Lvwang’ plants showed wilting, and the leaves of ‘Kuilv’ plants turned yellow from the stem to the base. At D9, leaves of ‘Kuilv’ began to fall off, and the whole plant of ‘Lvwang’ wilted, whereas most leaves fell off at D12 in both varieties (Figure 1). The morphologies of A. arguta with different waterlogging tolerances were different which may be due to two different regulatory mechanisms. However, the morphological characteristics of the plants changed significantly at D6, and therefore, 6 days were set as a critical period during which the mechanisms of morphological changes in A. arguta in response to waterlogging stress can be explored.

3.2. Principal Component Analysis (PCA)

The principal component analysis was performed by measuring 15 morphological and physiological indicators of ‘Lvwang’ and ‘Kuilv’. Based on an eigenvalue greater than 1, four principal components were considered, and the cumulative contribution rate of components from PCA was found to be 90.441% (Table 2), which could basically describe each indicator. The obtained characteristic value of PCA 1 was 6.413, and its contribution rate was 42.752%. The main feature vectors included the waterlogging index, yellowing area ratio, and root activity, which could describe the changes in morphological indices in response to waterlogging stress. The characteristic value of PCA 2 was 4.055, and its contribution rate was 27.033%. Among the corresponding eigenvectors, the values for GA3, IAA, and ABA contents were the highest. The characteristic value of PCA 3 was 1.873, and its contribution rate was 12.488%, with the characteristic value of the SOD enzyme activity being the highest. The characteristic value of PCA 4 was 1.225, and its contribution rate was 8.168%. Therefore, PCA 1 could best describe the morphological characteristics of A. arguta grown under waterlogging stress, while PCA 2 reflected the changes in contents of hormones during waterlogging, and the other principal components described the response of plants in terms of physiological stress indicators.
PCA cluster analysis (Figure 2) of all indicators showed that D0 treatment was clustered in the third quadrant and transferred to the second quadrant after 3 days of waterlogging treatment, while D6, D9, and D12 treatments were gradually dispersed and transferred to the first and second quadrants. It shows that the effect of PCA 2 is gradually enhanced after waterlogging treatment, and the hormone level with a high eigenvalue may be the main factor affecting the waterlogging response of A. arguta.

3.3. Changes in Hormone Content

The content of GA3 in leaves of A. arguta changed significantly during waterlogging as observed in Figure 3a, and in both ‘Lvwang’ and ‘Kuilv’, it increased significantly within the first 3 days, 169% and 66.9% higher than its values at D0, respectively. On the 6th day of waterlogging, the content of GA3 in ‘Lvwang’ decreased to 91% of D0 and decreased to 60% of D0 on D12. The content of GA3 in ‘Kuilv’, increased to its highest at D6 but decreased to the lowest at D12, and there was no significant difference from that at D0. This indicated that under short-term waterlogging stress, different A. arguta varieties both showed reactions, but the response mode might be different in the later period of waterlogging, which may be due to the difference between varieties.
The IAA content in leaves of both ‘Lvwang’ and ‘Kuilv’ showed a trend of first increasing and then decreasing (Figure 3b), and the amplitudes were 137% and 390% of D0, respectively. The content of IAA in leaves of ‘Kuilv’ was generally higher than in ‘Lvwang’, indicating that the former had a high adaptation to waterlogging stress and could maintain its growth and development.
The ABA content in leaves of ‘Lvwang’ and ‘Kuilv’ increased with the prolonged waterlogging, by 37.7% and 18.8% compared with D0, respectively. The ABA content of the former increased significantly to 0.19 at D6, while that of the latter was generally higher than the value at D0 but not significantly different (Figure 3c). Therefore, ABA might be the main factor that showed response to waterlogging stress through plant wilting and falling leaves.
GA3 and IAA are plant growth hormones, while ABA is a growth-inhibiting hormone. With the increase in duration of waterlogging, the ratio of growth hormones to the growth-inhibiting hormone increased first and then decreased, indicating that the plant regulated the secretion of growth hormones to maintain its active growth (Figure 3d). When the duration of waterlogging increased, plant performance decreased, and hormone synthesis was impaired; meanwhile, some hormones were involved in signal transduction pathways, and thus, hormone contents decreased. Therefore, the phenomena of plant wilting and yellowing at D6 might be due to the decrease in the ratio of auxin to abscisic acid, which changed the plant hormonal balance.

3.4. Transcriptome Data Analysis

3.4.1. Sequence and Unigene Annotation

According to the transcriptome data, the average number of each sample was calculated, and a total of 269.43 million clean reads were obtained. The clean data reached 36.88 Gb, and the GC content ranged between 45.52% and 46.55% (Table 3).
At present, a total of 87,522 unigenes have been annotated. In this study, the obtained gene sequences were compared against the selected known public databases, including GO, KEGG, Pfam, SwissProt, EggNOG, and NR (Table 4), to which a total of 37,229 (42.54%), 28,690 (32.78%), 31,794 (36.33%), 30,324 (34.65%), 41,870 (47.84%), and 44,659 (51.03%) genes were aligned, respectively. Through the comparison of the NR database for species detection, the species with the highest identification rate with A. arguta was found to be Actinidia chinensis Planch (72.95%), followed by Vitis vinifera L. (7.27%) (Figure 4).

3.4.2. Differential Gene Expression Analysis

Compared with the control group, the number of differentially expressed genes in A. arguta increased under waterlogging stress, and there were more up-regulated differentially expressed genes than down-regulated genes in each group. The number of differentially expressed genes reached 11,587 at L3 in ‘Lvwang’, while that in ‘Kuilv’ gradually increased to 10,163 at K6. This indicated that the different plant varieties may have responded in a different way to waterlogging stress. In ‘Lvwang’, the transcriptional response was faster, while differential genes of ‘Kuilv’ gradually increased to adapt to waterlogging stress. The differentially expressed genes in these two varieties were compared by Venn diagram, revealing differential expression of 261 genes upon waterlogging stress (Figure 5).

3.4.3. GO and KEGG Pathway Enrichment Analyses

To screen out the waterlogging-responsive genes, GO and KEGG pathway enrichment analyses were performed on the selected 120 differentially expressed genes as described in Figure 6. A total of 470 GO terms were enriched for the 120 identified DEGs. The results showed that DEGs enriched in biological processes accounted for 41.3% of all DEGs, mainly in the auxin signaling pathway, DNA-binding transcription factor activity, and protein phosphorylation. The DEGs enriched in the cellular component accounted for 30.6%, mainly in the cytoplasm, plasma membrane, and membrane composition. The DEGs enriched in molecular function, however, accounted for at least 28.1%, mainly concentrated in the cytoplasm, Golgi apparatus, and membrane (Figure 6a). The results of the KEGG pathway enrichment analysis showed that most DEGs were enriched in plant hormone signal transduction, starch and sucrose metabolism, and plant–pathogen interaction, the top three pathways (Figure 6b). Therefore, the biological processes and metabolic pathway enrichment analysis revealed that hormone regulation was one of the most efficient ways to respond to waterlogging stress in A. arguta.

3.4.4. WGCNA Analysis

In this study, WGCNA was used to analyze the gene expression of ‘Kuilv’ and ‘Lvwang’ in the three periods. These genes were divided into four color modules. It can be seen from the heat map that the hormone-related gene set is in the blue module. According to the relationship between genes, Cytoscape was used to visualize the relationship in network correlation analysis. Ten hub genes were found in the blue module, including TRINITY_DN35799_c0_g1, TRINITY_DN35238_c1_g1, TRINITY_DN29872_c0_g1, TRINITY_DN23774_c0_g1, and TRINITY_DN39806_c1_g1. TRINITY_DN24637_c0_g2, TRINITY_DN27128_c0_g2, TRINITY_DN39013_c0_g1, TRINITY_DN21398_c0_g1, TRINITY_DN22687_c0_g1. Therefore, we speculate that this module plays an important role in the process of waterlogging response and may act as a signal molecule to regulate the whole physiological process of waterlogging stress.

3.4.5. Gene Expression in the Plant Hormone Signal Pathway under Waterlogging

Waterlogging stress induced a significant increase in IAA, GA3, and ABA contents in A. arguta. To investigate how hormones are involved in response to waterlogging stress, the related genes expressed during waterlogging were screened (Figure 7). Seven genes participating in the plant hormone signal transduction pathways were screened, including IAA, ABA, etc.
Under waterlogging, the PYL genes and PP2C protein-regulated genes were up-regulated in K3 and L3, but down-regulated in K6 and L6, which may activate the Snrk2 activity (Figure 8). The ARF transcription factors regulated by auxin showed different expressions and were up-regulated in ‘Kuilv’ and down-regulated in ‘Lvwang’. The IAA response protein-regulated genes (IAA) were both up-regulated and significant in ‘Kuilv’. Therefore, auxin may be the key factor causing the difference in waterlogging tolerance between ‘Kuilv’ and ‘Lvwang’. Otherwise, the gene COI was selected in this pathway, which may participate in the regulation of leaf senescence. According to the gene expression heat map, there were five genes (Table 5) whose expression changed significantly upon waterlogging, which included TRINITY_DN35799_c0_g1, TRINITY_DN35238_c1_g1, TRINITY_DN29872_c0_g1, RINITY_DN23774_c0_g1, and TRINITY_DN39806_c1_g1. These genes were observed to play an important role in the response of A. arguta to waterlogging stress.

3.4.6. Gene Expression in the Starch and Sucrose Metabolism Pathway under Waterlogging

Among the DEGs selected by WGCNA, three hub genes were involved in starch and sucrose metabolism pathway and one gene participated in plant–pathogen interaction, including alpha, alpha-trehalose-phosphate synthase (TPS11), granule-bound starch synthase (WAXY), beta-amylase (BAM3), and calmodulin-related protein (Tnnc2). The key differential genes in the starch and sucrose metabolic pathway are mainly in the trehalose metabolism module. SUS, TPS, and BAM genes were significantly up-regulated, and WAXY genes were down-regulated, which contributed to the synthesis of trehalose. Among them, TPS genes were up-regulated more significantly in ‘Kuilv’, which may be related to the difference in waterlogging tolerance between the two varieties. Trehalose metabolism may be one of the main ways for A. arguta to respond to waterlogging (Figure 9 and Table 6).

3.5. Real-Time Quantitative PCR (qRT-PCR) Analysis

A total of 10 DEGs were selected randomly by enrichment analysis of the first three KEGG pathways to verify the accuracy of RNA sequencing data using qRT-PCR. These DEGs included TRINITY_DN35238_c1_g1, TRINITY_DN35799_c0_g1, TRINITY_DN23774_c0_g1, TRINITY_DN29872_c0_g1, TRINITY_DN39806_c1_g1, TRINITY_DN18816_c0_g1, TRINITY_DN20426_c0_g1, TRINITY_DN20808_c0_g1, TRINITY_DN20826_c0_g1, and TRINITY_DN21323_c0_g1. The qRT-PCR results showed that the relative expression of the candidate genes was consistent with the trend of the transcriptional level detected in transcriptome data (Figure 10). In general, transcriptome data were found to be reliable, the PYL, IAA, and ARF genes involved in the plant hormone signal transduction pathway were expressed, and, thus, they were selected as waterlogging-responsive genes.

4. Discussion

4.1. Responses of Hormones to Waterlogging Stress in A. arguta

The response of plants to waterlogging stress is mainly reflected in morphology. In this study, the main varieties of the male plant ‘Lvwang’ and the female plant ‘Kuilv’ were selected as plant materials. The principal component analysis (PCA) of physiological indices in A. arguta demonstrated that the morphological and hormonal variables could reflect the response of the plant to waterlogging. As the duration of waterlogging increased, the leaves gradually started turning yellow and fell; the leaves of ‘Kuilv’ fell off from the stem base, while those of ‘Lvwang’ all wilted and then fell off. The change in the contents of hormones was considered as the second principal component (PCA 2), and GA3 and IAA contents showed a trend of first increasing and then decreasing, while the ABA content increased to its highest level and then became constant on D3, which was similar to the change observed in ginkgo under waterlogging [24]. Changes in the contents of growth hormones and growth-inhibiting hormones might be the main reason for morphological changes. Therefore, changes in plant hormone contents could act as signals in mediating physiological processes under waterlogging stress [25].

4.2. Responses of Hormone-Related Genes to Waterlogging Stress in A. arguta

Under waterlogging conditions, DEGs were mostly enriched in plant hormone signal transduction and starch and sucrose metabolism pathways, which means plant hormone and soluble sugar played an important role in response to waterlogging [16]. According to the results of the gene expression in the present study, the ABA receptor PYL, the auxin response regulatory gene protein IAA, auxin response factor ARF, and jasmonic acid receptor COI had important roles in the regulation of leaves yellowing and falling off in A. arguta.
The increase in the ABA content is the direct cause of stomatal closure under waterlogging stress [26], which reduces photosynthesis, affecting the growth of plants [27]. PYL family proteins are the important components of the ABA signal transduction pathway, which perceive ABA signals as ABA receptors. Under waterlogging conditions, the expression of the PYL genes and the content of the receptor protein increased, binding to proteins PP2Cs, which could activate SnRK2 kinase activity through the accumulation of ABA. SnRK2 kinases can directly act on anion channels and control the pore size in guard cells to regulate transpiration and photosynthesis in leaves, thereby regulating transpiration in plants. Under drought stress, ABA could promote leaf senescence by binding to PYL receptors and PP2C inhibitors, thereby increasing leaf survival and plant drought resistance [28]. This is similar to the results of this study, indicating that the mechanism of waterlogging response in A. arguta may be similar to the mechanism of drought tolerance. To reduce energy consumption, leaf abscission may occur, which causes the transfer of nutrients from aging organs through programmed cell death in leaves [29], thereby improving waterlogging tolerance, which may be an escape strategy [30].
At present, AUX/IAA, GH3, and SAUR have been studied as auxin-responsive genes, whose expression is regulated by the ARF family of transcription factors. The AUX/IAA family of proteins is a negative regulator of auxin signal transduction in the auxin signaling pathway, thereby not conducive to auxin signal transduction, and can dissociate the activity of its downstream ARF and inactivate it. In this study, the expression of the ARF transcription factor gene family in leaves significantly increased on the 6th day of waterlogging stress to promote the synthesis of auxin. Similarly, the expression of two auxin-sensing factors was detected in the roots of cucumber to promote the formation of adventitious roots [31], indicating that plants employed the response mechanisms both in their aboveground and underground parts after sensing waterlogging. The increase in IAA made A. arguta maintain its growth under waterlogging stress, and the leaves at the top of the elongated internode [32] could obtain more oxygen.
Jasmonic acid, together with other hormones, can regulate the responses to biotic and abiotic stresses. It can inhibit cell division by inhibiting cell-cycle-related proteins, thereby inhibiting the elongation of plant leaves, while promoting the degradation of chloroplasts and causing leaf yellowing and senescence [33]. COI is the receptor protein of jasmonic acid, which binds first to SCFCOI 1 and JA-lle to form a complex and then to the JAZ protein, the substrate for SCFCOI 1, in the process of signal transduction. Jasmonic acid induces the degradation of JAZ proteins via the ubiquitin–proteasome pathway, relieves the inhibition of the synthesis of JAZ proteins, and activates the signal transmission of jasmonates. To date, the mechanism of action of COI in response to waterlogging stress has not yet been explored. The COI 3 gene can improve the tolerance of rice to high salt stress [34] but reduce the tolerance to drought. Compared with wild type, it shows an earlier yellowing phenomenon, indicating that COI gene may promote leaf senescence [35], which is consistent with the phenotype of A. arguta after waterlogging. Moreover, studies have shown that jasmonic acid and ABA have a synergistic effect [36] and the former can up-regulate the expression of ABA receptors from the PYL family [37]. A PYL mutant was found to be more sensitive to the combination of JA and ABA than to ABA alone. Therefore, the phenomenon occurring in this study suggesting that waterlogging stress promotes leaf senescence may be caused by the synergistic action of ABA and JA.

4.3. Responses of Sucrose Metabolism Genes to Waterlogging Stress in A. arguta

When plants are subjected to waterlogging stress, the respiration mode changes from aerobic respiration to anaerobic respiration, and glycolysis is the main way to provide energy, which made the substrates such as sugar more important under waterlogging. Waterlogging stress can initiate the translation of sugar and related synthase genes, and the content of sucrose and trehalose in waterlogging-tolerant varieties will increase [17]. In this study, four key genes in the starch and sucrose metabolism pathway included alpha, alpha-trehalose-phosphate synthase (TPS), sucrose synthase (SUS), granule-bound starch synthase (WAXY), and beta-amylase (BAM) genes. WAXY was down-regulated and TPS, SUS, and BAM were up-regulated, which all provided more precursors for the trehalose metabolism module. Trehalose plays an important role in a variety of stress conditions, as it can stabilize cell osmotic pressure during cell dehydration [38] and avoid damage to cells by crystals by accumulating when subjected to cold damage [39]. At the same time, the trehalose metabolism module can regulate the energy switch protein kinase SnRK1 [40] to balance the glycogen distribution of plants. Therefore, the differences between the two phenotypes and waterlogging tolerance produced in this study may be caused by the regulation of trehalose. The up-regulation of the trehalose synthase gene inhibited the activity of SnRK1, thereby reducing the production of energy and storing more glycogen to withstand waterlogging (Figure 11).

5. Conclusions

In this study, different forms of two varieties were shown in early stress. ‘Lvwang’ showed wilting might promote plant dormancy to withstand waterlogging by a static strategy. ‘Kuilv’ becomes yellow from the basal stem, which might eliminate some leaves and save nutrients to supply the upper part of the plant to grow normally to escape the water surface. Connected with the morphological changes due to waterlogging stress, the ABA signaling pathway was found to be the most relevant by physiological responses and transcriptome data. A. arguta responded to waterlogging stress by regulating the levels of various hormones. ABA and JA may simultaneously regulate the senescence of leaves, while the growth hormone IAA maintains plant growth. There may be mutual regulation between ABA and sugar or other nutrients, which determines the difference in waterlogging tolerance. However, further research is required to verify how the two mechanisms affect the tolerance of A. arguta which may provide evidence in developing an accurate evaluation method and screen waterlogging-tolerant germplasm resources.

Author Contributions

J.G. and J.A. designed the research content; J.G., G.S., X.L., Y.L. and W.A. performed the research; D.S. and Z.W. guided the experiments; J.G. wrote the article. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Jilin Provincial Scientific and Technological Development Program (20210202086NC), the Talent Introduction Fund of Jilin Agricultural University (0214-202022920).

Data Availability Statement

The data analyzed during the current study are not publicly available as we have other original research based on the transcriptome data but they are available from the corresponding author on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ai, J. Cultivation and Processing Technology of Actinidia arguta, 1st ed.; China Agriculture Press: Beijing, China, 2014. [Google Scholar]
  2. Zhao, J.P.; Wang, Y.L.; Lu, X.L.; Shen, Z.H.; Wang, M.T.; Li, Q.; Wang, R.L. Climatic suitable area analysis and response to climate change of Actinidia arguta in China. Chin. J. Eco-Agric. 2020, 28, 1523–1532. [Google Scholar] [CrossRef]
  3. Li, Y.D. Report on the Development of Small Berry Industry in China, 1st ed.; China Agriculture Press: Beijing, China, 2016. [Google Scholar]
  4. Wang, D.L.; Zhou, W.J.; Yao, P.; Zhao, F.J.; Huang, G.H. Quantitative Classification of Phenotypic Traits of Kiwifruit Germplasm Resources with Soft Dates. North. Hortic. 2022, 10, 33–40. [Google Scholar]
  5. Bai, D.F. Screening of waterlogging tolerant germplasm resources and research of physiological mechanism in Actinidia. Chin. Acad. Agric. Sci. 2019. [Google Scholar]
  6. Reid, J.B.; Petrie, R.A. Effects of soil aeration on root demography in kiwifruit. New Zealand J. Crop Hortic. Sci. 1991, 19, 423–432. [Google Scholar] [CrossRef]
  7. Clark, R.T.; Dong, X.Q.; Ho, C.H.; Sun, J.H.; Yuan, H.L.; Takemi, T. Preface to the Special Issue on Summer 2020: Record Rainfall in Asia—Mechanisms, Predictability and Impacts. Adv. Atmos. Sci. 2021, 38, 1977–1979. [Google Scholar] [CrossRef]
  8. Li, X.; Zhao, J.P. Effects of Continuous Flooding on the Morphology and Some Physiological Indicators of Peach Seedlings. Mod. Agric. Sci. Technol. 2010, 3, 129–130+133. [Google Scholar] [CrossRef]
  9. Ren, B.Z.; Yu, W.Z.; Liu, P.; Zhao, B.; Zhang, J.W. Responses of photosynthetic characteristics and leaf senescence in summer maize to simultaneous stresses of waterlogging and shading. Crop J. 2023, 11, 269–277. [Google Scholar] [CrossRef]
  10. Wang, X.; He, Y.; Zhang, C.; Tian, Y.A.; Lin, H. Physiological and transcriptional responses of Phalaris arundinacea under waterlogging conditions. J. Plant Physiol. 2021, 261, 153428. [Google Scholar] [CrossRef]
  11. Li, Z.; Bai, D.; Zhong, Y.; Abid, M.; Qi, X.; Hu, C.; Fang, J. Physiological Responses of Two Contrasting Kiwifruit (Actinidia spp.) Rootstocks against Waterlogging Stress. Plants 2021, 10, 2586. [Google Scholar] [CrossRef]
  12. Zhang, Y.; Cao, G.; Qu, L.J.; Gu, H. Characterization of Arabidopsis MYB transcription factor gene AtMYB17 and its possible regulation by LEAFY and AGL15. J. Genet. Genom. 2009, 36, 99–107. [Google Scholar] [CrossRef]
  13. Zhang, Y.; Ou, L.; Zhao, J.; Liu, Z.; Li, X. Transcriptome analysis of hot pepper plants identifies waterlogging resistance related genes. Chil. J. Agric. Res. 2019, 79, 296–306. [Google Scholar] [CrossRef]
  14. Xia, T.; Li, H.L.; Wan, L.; Zhou, Q.; Jiang, H. Alleviation effects of IAA foliar spray on waterlogging stressed rapeseed at budding stage. Chin. J. Oil Crop Sci. 2015, 37, 55. [Google Scholar] [CrossRef]
  15. Malick Cisse, E.; Zhang, Z.; Li, D.D. Exogenous ABA and IAA modulate physiological and hormonal adaptation strategies in Cleistocalyx operculatus and Syzygium jambos under long-term waterlogging conditions. BMC Plant Biol. 2022, 22, 523. [Google Scholar] [CrossRef]
  16. Zhang, J.Y.; Sheng, N.M.; Zheng, H.X.; Ji, P.J.; Xiao, D.W.; Gang, G.; Zhong, R. De novo transcriptome sequencing and comparative analysis of differentially expressed genes in kiwifruit under waterlogging stress. Mol. Breed. 2015, 35, 208. [Google Scholar] [CrossRef]
  17. Li, Z.; Zhong, Y.; Bai, D.F.; Abid, M.; Zhang, Y.; Lin, M.; Fang, J. Comparative Transcriptome Analysis of Two Contrasting Kiwifruit (Actinidia) Genotypes under Waterlogging Stress. Preprints 2020, 105, 2020070395. [Google Scholar] [CrossRef]
  18. Yamauchi, T.; Tanaka, A.; Inahashi, H.; Nishizawa, N.K.; Tsutsumi, N.; Inukai, Y.; Nakazono, M. Fine control of aerenchyma and lateral root development through AUX/IAA- and ARF-dependent auxin signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 20770–20775. [Google Scholar] [CrossRef]
  19. Xie, R.; Zheng, L.; Jiao, Y.; Huang, X. Understanding physiological and molecular mechanisms of citrus rootstock seedlings in response to root zone hypoxia by RNA-Seq. Environ. Exp. Bot. 2021, 192, 104647. [Google Scholar] [CrossRef]
  20. Zhu, F.; Xi, D.; Deng, X.; Peng, X.; Tang, H.; Chen, Y.; Jian, W.; Feng, H.; Lin, H. The chilli veinal mottle virus regulates expression of the tobacco mosaic virus resistance genen and jasmonic acid/ethylene signaling is essential for systemic resistance against chilli veinal mottle virus in tobacco. Plant Mol. Biol. Rep. 2014, 32, 382–394. [Google Scholar] [CrossRef]
  21. Deng, X.G.; Zhu, T.; Zhang, D.W.; Lin, H.H. The alternative respiratory pathway is involved in brassinosteroid-induced environmental stress tolerance in Nicotiana benthamiana. J. Exp. Bot. 2015, 66, 6219–6232. [Google Scholar] [CrossRef]
  22. Zhou, Y.; Wu, Y.X.; Li, Y.X.; Wen, G.Q.; Nie, F. Study on the determination of endogenous hormones in blueberry leaves by high performance liquid chromatography. China Fruits 2018, 3, 88–91+94. [Google Scholar] [CrossRef]
  23. Onanuga, A.O.; Adl, S. Effect of Phytohormones, Phosphorus and Potassium on Cotton Varieties (Gossypium hirsutum) Root Growth and Root Activity Grown in Hydroponic Nutrient Solution. J. Agric. Sci. 2012, 4, 342–345. [Google Scholar] [CrossRef]
  24. He, S.T.; Liu, G.Q.; Fan, W.G. Effect of flooding stress on hormones and cell solute in Ginkgo. J. Anhui Agric. Sci. 2006, 7, 1292–1294+1318. [Google Scholar] [CrossRef]
  25. Arbona, V.; Gómez-Cadenas, A. Hormonal Modulation of Citrus Responses to Flooding. J. Plant Growth Regul. 2008, 27, 241–250. [Google Scholar] [CrossRef]
  26. Else, M.; Janowiak, F.; Atkinson, C.; Jackson, M. Root signals and stomatal closure in relation to photosynthesis, chlorophyll a fluorescence and adventitious rooting of flooded tomato plants. Ann. Bot. 2008, 2, 313–323. [Google Scholar] [CrossRef] [PubMed]
  27. Ahmed, S.; Nawata, E.; Sakuratani, T. Changes of endogenous ABA and ACC, and their correlations to photosynthesis and water relations in mungbean (Vigna radiata (L.) Wilczak cv. KPS1) during waterlogging. Environ. Exp. Bot. 2006, 57, 278–284. [Google Scholar] [CrossRef]
  28. Zhao, Y.; Chan, Z.; Gao, J.; Xing, L.; Cao, M.; Yu, C.; Zhu, Y. ABA receptor PYL9 promotes drought resistance and leaf senescence. Proc. Natl. Acad. Sci. USA 2016, 113, 1949–1954. [Google Scholar] [CrossRef]
  29. Uauy, C.; Distelfeld, A.; Fahima, T.; Blechl, A.; Dubcovsky, J. A NAC Gene Regulating Senescence Improves Grain Protein, Zinc, and Iron Content in Wheat. Science 2006, 314, 1298–1301. [Google Scholar] [CrossRef]
  30. Bashar, K.; Tareq, M.; Amin, M.; Honi, U.; Tahjib-Ul-Arif, M.; Sadat Hossen, Q. Phytohormone-Mediated Stomatal Response, Escape and Quiescence Strategies in Plants under Flooding Stress. Agronomy 2019, 9, 43. [Google Scholar] [CrossRef]
  31. Qi, X.H.; Xu, X.W.; Lin, X.J.; Zhang, W.J.; Chen, X.H. Identification of differentially expressed genes in cucumber (Cucumis sativus L) root under waterlogging stress by digital gene expression profile. Genomics 2012, 99, 160–168. [Google Scholar] [CrossRef]
  32. Yamauchi, T.; Colmer, T.D.; Pedersen, O.; Nakazono, M. Regulation of root traits for internal aeration and tolerance to soil waterlogging-flooding stress. Plant Physiol. 2018, 176, 1118. [Google Scholar] [CrossRef]
  33. Pérez-Sálamo, I.; Krasauskas, J.; Gates, S.; Eva, K.; Díaz-Sánchez, E.K.; Devoto, A. An Update on Core Jasmonate Signalling Networks, Physiological Scenarios, and Health Applications. Annu. Plant Rev. Online 2019, 2. [Google Scholar] [CrossRef]
  34. Fatehi, F.; Hosseinzadeh, A.; Alizadeh, H.; Brimavandi, T.; Struik, P.C. The proteome response of salt-resistant and salt-sensitive barley genotypes to long-term salinity stress. Mol. Biol. Rep. 2012, 39, 6387–6397. [Google Scholar] [CrossRef] [PubMed]
  35. Min, Q. Study on Application of Rice OsCOI3 Gene to Improve Stress Resistance of Crops; Chongqing University: Chongqing, China, 2021. [Google Scholar]
  36. Zhang, N. Regulation of ESSD Germination by Glutathione S-Transferase U7(AtGSTU7) in Arabidopsis thaliana; Northeast Forestry University: Heilongjiang, China, 2021. [Google Scholar]
  37. Aleman, F.; Yazaki, J.; Lee, M.; Takahashi, Y.; Schroeder, J.I. An ABA-increased interaction of the PYL6 ABA receptor with MYC2 Transcription Factor: A putative link of ABA and JA signaling. Sci. Rep. 2016, 6, 28941. [Google Scholar] [CrossRef] [PubMed]
  38. Li, C.; Lu, X.; Liu, Y.; Xu, J.; Yu, W. Trehalose alleviates the inhibition of adventitious root formation caused by drought stress in cucumber through regulating ros metabolism and activating trehalose and plant hormone biosynthesis. Plant Physiol. Biochem. 2023, 205, 108159. [Google Scholar] [CrossRef] [PubMed]
  39. Gao, C.Y. Based on metabonomics reveals the mechanism of trehalose promoting catharanthus roseus against low temperature stress. Bot. Res. 2021, 10, 468–484. [Google Scholar] [CrossRef]
  40. Tsai, A.Y.; Gazzarrini, S. Trehalose-6-phosphate and snrk1 kinases in plant development and signaling: The emerging picture. Front. Plant Sci. 2014, 5, 119. [Google Scholar] [CrossRef]
Figure 1. Morphological changes in ‘Kuilv’ and ‘Lvwang’ under different numbers of waterlogged days. (a) Photos of ‘Kuilv’ waterlogging for 0, 3, 6, 9, and 12 days. (b) Photos of ‘Lvwang’ waterlogging for 0, 3, 6, 9, and 12 days.
Figure 1. Morphological changes in ‘Kuilv’ and ‘Lvwang’ under different numbers of waterlogged days. (a) Photos of ‘Kuilv’ waterlogging for 0, 3, 6, 9, and 12 days. (b) Photos of ‘Lvwang’ waterlogging for 0, 3, 6, 9, and 12 days.
Agronomy 14 02391 g001
Figure 2. PCA cluster analysis of PCA 1 and PCA 2 to show the changes in main indicators.
Figure 2. PCA cluster analysis of PCA 1 and PCA 2 to show the changes in main indicators.
Agronomy 14 02391 g002
Figure 3. Changes in hormones content of different varieties under waterlogging. (a) Content of GA3. (b) Content of IAA. (c) Content of ABA. (d) GA3+IAA/ABA ratio of content. K and L represent the treatment of ‘Kuilv’ and ‘Lvwang’, respectively. Mean values followed by the same letter within a colum do not deffer significantly according to analysis of variance at p ≤ 0.05.
Figure 3. Changes in hormones content of different varieties under waterlogging. (a) Content of GA3. (b) Content of IAA. (c) Content of ABA. (d) GA3+IAA/ABA ratio of content. K and L represent the treatment of ‘Kuilv’ and ‘Lvwang’, respectively. Mean values followed by the same letter within a colum do not deffer significantly according to analysis of variance at p ≤ 0.05.
Agronomy 14 02391 g003
Figure 4. Comparison of NR database.
Figure 4. Comparison of NR database.
Agronomy 14 02391 g004
Figure 5. DEG number statistics and Venn diagram between different waterlogging days. (a) DEG number. (b) Venn diagram.
Figure 5. DEG number statistics and Venn diagram between different waterlogging days. (a) DEG number. (b) Venn diagram.
Agronomy 14 02391 g005
Figure 6. GO enrichment barplot (a) and KEGG enrichment scatterplot. (b) of the waterlogging-responsive DEGs in ‘Lvwang’ and ‘Kuilv’.
Figure 6. GO enrichment barplot (a) and KEGG enrichment scatterplot. (b) of the waterlogging-responsive DEGs in ‘Lvwang’ and ‘Kuilv’.
Agronomy 14 02391 g006
Figure 7. Co-expression network visualization results. (a) The visualization of gene modules, the same color means that these genes correspond to the same module; (b) module and associated biological characteristics. (c) Co-expression network of genes in the MEblue module.The color of yellow represent the interaction frequency.
Figure 7. Co-expression network visualization results. (a) The visualization of gene modules, the same color means that these genes correspond to the same module; (b) module and associated biological characteristics. (c) Co-expression network of genes in the MEblue module.The color of yellow represent the interaction frequency.
Agronomy 14 02391 g007
Figure 8. Gene-expression-related plant hormone signal pathway pattern under waterlogging.
Figure 8. Gene-expression-related plant hormone signal pathway pattern under waterlogging.
Agronomy 14 02391 g008
Figure 9. Gene-expression-related starch and sucrose metabolism pathway pattern under waterlogging.
Figure 9. Gene-expression-related starch and sucrose metabolism pathway pattern under waterlogging.
Agronomy 14 02391 g009
Figure 10. Log 2 fold changes of ten genes in quantitative real-time PCR (qRT-PCR) and RNA-seq.
Figure 10. Log 2 fold changes of ten genes in quantitative real-time PCR (qRT-PCR) and RNA-seq.
Agronomy 14 02391 g010
Figure 11. A schematic model of transcriptional regulation in A. arguta in response to waterlogging. Red and blue text indicate up- and down-regulated genes.
Figure 11. A schematic model of transcriptional regulation in A. arguta in response to waterlogging. Red and blue text indicate up- and down-regulated genes.
Agronomy 14 02391 g011
Table 1. The primer sequences for ten candidate genes in qRT-PCR.
Table 1. The primer sequences for ten candidate genes in qRT-PCR.
NameForwardReverse
TRINITY_DN35238_c1_g1TAGGTTTGGGAGGCTACTGACTACATTGATTCTCGTTTCG
TRINITY_DN23774_c0_g1CCATCACAAGCAAGAGGGAGATGGGACATCACCAACAAGCAC
TRINITY_DN35799_c0_g1AGGCATCAATGAGAACAACAGGATTCCCGTTAGGATAGAGTA
TRINITY_DN29872_c0_g1TACAAAGATCCGAAACAGCCACTCCCTCCTCCACTCAACA
TRINITY_DN39806_c1_g1CCTTGTGGGAGGGTTATGTGCTGATGACGGAAATGGACTA
TRINITY_DN18816_c0_g1ACAGACACTCACCGTTCAGGCAATAAGGCTACAACAGGA
TRINITY_DN20426_c0_g1ATCTGCCGAACATGGCTACTCACCACCACTCCTTTACTTACACC
TRINITY_DN20808_c0_g1GGTCGCCCTGTCGTTATTCAGAACCCGTAGTCGCCAAACA
TRINITY_DN20826_c0_g1CCATCACAAGCAAGAGGGAGATGGGACATCACCAACAAGCAC
TRINITY_DN21323_c0_g1TGAGGGAGGCTGAGAAAGAGATTGGCTTGTAACTTGGGAG
β-actinGCCCTGGGAGCATCATCACCTGAAACGGAACTGGAATGG
Table 2. The principal component analysis of 15 physiological indicators in A. arguta under waterlogging.
Table 2. The principal component analysis of 15 physiological indicators in A. arguta under waterlogging.
Component
PCA 1PCA 2PCA 3PCA 4
Waterlogging index0.9460.1990.067−0.133
Yellow area ratio0.9380.2670.0140.160
Dry matter reduction−0.914−0.032−0.1600.212
Root activity−0.896−0.3660.1130.016
GA30.413−0.752−0.3740.189
IAA0.155−0.8530.3870.046
ABA−0.199−0.6250.5830.362
SOD0.4220.1000.775−0.432
CAT−0.428−0.4030.760−0.269
POD−0.1260.7610.0920.506
MDA0.3490.1130.7140.533
H2O20.7670.098−0.0610.331
O20.5330.7620.020−0.132
Chlorophyll content−0.5440.692−0.2670.088
Soluble sugar−0.5640.5390.460−0.186
Principle component6.4134.0551.8731.225
Contribution ratio (%)42.75227.03312.4888.168
Cumulative contribution ratio (%)42.75269.78582.27390.441
Contribution rate weight0.4730.2990.1380.09
Extraction method: principal component. Four components have been extracted.
Table 3. List of data output quality.
Table 3. List of data output quality.
SampleRaw ReadsValid ReadsValid BasesValid (%)Q20%Q30%GC%
K351,907,68851,110,2947.12G98.4797.4192.3946.39
K641,258,89840,280,7485.63G97.6398.1594.3545.52
K035,929,31935,143,1804.91G97.8198.1594.3445.92
L351,824,24751,018,1257.11G98.4497.4192.3846.55
L642,992,41742,021,5865.88G97.7298.1794.4245.81
L045,522,74644,540,1906.23G97.8498.1494.3246.02
Total269,435,315264,114,12336.88G————————
Note: K0, L0 represent the normal management of ‘Kuilv’ and ‘Lvwang’ without waterlogging stress; K3, L3 represent ‘Kuilv’ and ‘Lvwang’ waterlogging treatment for 3 days; K6, L6 represent ‘Kuilv’ and ‘Lvwang’ waterlogging treatment for 6 days.
Table 4. Statistics of unigene annotation results.
Table 4. Statistics of unigene annotation results.
DatabaseNumberRatio (%)
All87,522100.00
GO37,22942.54
KEGG28,69032.78
Pfam31,79436.33
SwissProt30,32434.65
EggNOG41,87047.84
NR44,65951.03
Table 5. Plant-hormone-signal-related gene annotation.
Table 5. Plant-hormone-signal-related gene annotation.
Gene IDNameAnnotationKEGG Pathway
TRINITY_DN35238_c1_g1PYL10Abscisic acid receptor PYR/PYL familyPlant hormone signal
TRINITY_DN35799_c0_g1PYL7
TRINITY_DN24637_c0_g2Os05g0537400Protein phosphatase 2C
TRINITY_DN23774_c0_g1IAA7Auxin-responsive protein
TRINITY_DN29872_c0_g1ARF18Auxin response factor
TRINITY_DN39806_c1_g1COI1Coronatine-insensitive protein
Table 6. Starch- and sucrose-metabolism-related gene annotation.
Table 6. Starch- and sucrose-metabolism-related gene annotation.
Gene IDNameAnnotationKEGG Pathway
TRINITY_DN21398_c0_g1SUSSucrose synthaseStarch and sucrose metabolism
TRINITY_DN39013_c0_g1TPS11Alpha, alpha-trehalose-phosphate synthase
TRINITY_DN27128_c0_g2WAXYGranule-bound starch synthase
TRINITY_DN22687_c0_g1BAM3Beta-amylase
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Geng, J.; Shi, G.; Li, X.; Liu, Y.; An, W.; Sun, D.; Wang, Z.; Ai, J. Combining Physiology and Transcriptome Data Screening for Key Genes in Actinidia arguta Response to Waterlogging Stress. Agronomy 2024, 14, 2391. https://doi.org/10.3390/agronomy14102391

AMA Style

Geng J, Shi G, Li X, Liu Y, An W, Sun D, Wang Z, Ai J. Combining Physiology and Transcriptome Data Screening for Key Genes in Actinidia arguta Response to Waterlogging Stress. Agronomy. 2024; 14(10):2391. https://doi.org/10.3390/agronomy14102391

Chicago/Turabian Style

Geng, Jiaqi, Guangli Shi, Xiang Li, Yumeng Liu, Wenqi An, Dan Sun, Zhenxing Wang, and Jun Ai. 2024. "Combining Physiology and Transcriptome Data Screening for Key Genes in Actinidia arguta Response to Waterlogging Stress" Agronomy 14, no. 10: 2391. https://doi.org/10.3390/agronomy14102391

APA Style

Geng, J., Shi, G., Li, X., Liu, Y., An, W., Sun, D., Wang, Z., & Ai, J. (2024). Combining Physiology and Transcriptome Data Screening for Key Genes in Actinidia arguta Response to Waterlogging Stress. Agronomy, 14(10), 2391. https://doi.org/10.3390/agronomy14102391

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop