Infection of the Western Flower Thrips, Frankliniella occidentalis, by the Insect Pathogenic Fungus Beauveria bassiana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Entomopathogenic Fungi and Insects
2.2. Insect Bioassays Using F. occidentalis
2.3. Histopathological Observations
2.3.1. Light Microscopy
2.3.2. Scanning Electron Microscopy
2.4. Genes Expression Analyses by Real-Time Reverse Transcription RT-PCR
2.5. Statistical Analysis
3. Results
3.1. Insect Mortality and Fungal Attachment to the Insect Body
3.2. Conidial Germination and Penetration of the Insect Cuticle
3.3. Histopathology: Fungal Hyphal Body Proliferation Inside the Insect Host
3.4. Expression of Fungal Virulence-Related Genes during the Infection Time Course
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cloyd, R.A. Western flower thrips (Thysanoptera: Thripidae) and insecticide resistance: An overview and strategies to mitigate insecticide resistance development. J. Entomol. Sci. 2016, 51, 257–273. [Google Scholar] [CrossRef]
- Ortiz-Urquiza, A.; Keyhani, N.O. Stress response signaling and virulence: Insights from entomopathogenic fungi. Curr. Genet. 2015, 61, 239–249. [Google Scholar] [CrossRef]
- Ortiz-Urquiza, A.; Keyhani, N.O. Molecular genetics of Beauveria bassiana infection of insects. Adv. Genet. 2016, 94, 165–249. [Google Scholar]
- Ortiz-Urquiza, A.; Keyhani, N.O. Action on the surface: Entomopathogenic fungi versus the insect cuticle. Insects 2013, 4, 357–374. [Google Scholar] [CrossRef]
- Wanchoo, A.; Lewis, M.W.; Keyhani, N.O. Lectin mapping reveals stage-specific display of surface carbohydrates in in vitro and haemolymph-derived cells of the entomopathogenic fungus Beauveria bassiana. Microbiology 2009, 155, 3121–3133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Y.; Liu, X.; Keyhani, N.O.; Tang, G.; Pei, Y.; Zhang, W.; Tong, S. Regulatory cascade and biological activity of Beauveria bassiana oosporein that limits bacterial growth after host death. Proc. Natl. Acad. Sci. USA 2017, 114, E1578–E1586. [Google Scholar] [CrossRef] [Green Version]
- Pedrini, N.; Ortiz-Urquiza, A.; Huarte-Bonnet, C.; Zhang, S.; Keyhani, N.O. Targeting of insect epicuticular lipids by the entomopathogenic fungus Beauveria bassiana: Hydrocarbon oxidation within the context of a host-pathogen interaction. Front. Microbiol. 2013, 4, 24. [Google Scholar] [CrossRef] [Green Version]
- Santoro, P.; Zorzetti, J.; Constanski, K.; Neves, P.M.O.J. Conidial production, virulence, and stress tolerance of Beauveria bassiana conidia after successive in vitro subculturing. Rev. Colomb. Entomol. 2014, 40, 85–90. [Google Scholar]
- Gomes, D.C.; Machado, N.R.; Santi, L.; Broetto, L.; Vainstein, M.H.; Meyer-Fernandes, J.R.; Schrank, A.; Beys-da-Silva, W.O. Inhibition of ecto-phosphatase activity in conidia reduces adhesion and virulence of Metarhizium anisopliae on the host insect Dysdercus peruvianus. Curr. Microbiol. 2013, 66, 467–474. [Google Scholar] [CrossRef]
- Ravindran, K.; Qiu, D.; Sivaramakrishnan, S. Sporulation characteristics and virulence of Metarhizium anisopliae against subterranean termites (Coptotermes formosanus). Int. J. Microbiol. Res. 2015, 6, 1–4. [Google Scholar]
- Mohan, V.; Nivea, R.; Menon, S. Evaluation of ectomycorrhizal fungi as potential bio-control agents against selected plant pathogenic fungi. J. Acad. Indus. Res. 2015, 3, 408–412. [Google Scholar]
- Zhang, S.; Xia, Y.; Kim, B.; Keyhani, N.O. Two hydrophobins are involved in fungal spore coat rodlet layer assembly and each play distinct roles in surface interactions, development and pathogenesis in the entomopathogenic fungus, Beauveria bassiana. Mol. Microbiol. 2011, 80, 811–826. [Google Scholar] [CrossRef]
- Kirkland, B.H.; Westwood, G.S.; Keyhani, N.O. Pathogenicity of entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae to ixodidae tick species dermacentor variabilis, Rhipicephalus sanguineus, and Ixodes scapularis. J. Med. Entomol. 2004, 41, 705–711. [Google Scholar] [CrossRef] [Green Version]
- Fan, Y.; Borovsky, D.; Hawkings, C.; Ortiz-Urquiza, A.; Keyhani, N.O. Exploiting host molecules to augment mycoinsecticide virulence. Nat. Biotechnol. 2012, 30, 35–37. [Google Scholar] [CrossRef]
- Faria, M.R.; Wraight, S.P. Mycoinsecticides and mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biol. Control. 2007, 43, 237–256. [Google Scholar] [CrossRef]
- Bielza, P. Insecticide resistance management strategies against the western flower thrips, Frankliniella occidentalis. Pest Manag. Sci. 2008, 64, 1131–1138. [Google Scholar] [CrossRef]
- Shipp, J.L.; Binns, M.R.; Hao, X.; Wang, K. Economic injury levels for western flower thrips (Thysanoptera: Thripidae) on greenhouse sweet pepper. J. Econ. Entomol. 1998, 91, 671–677. [Google Scholar] [CrossRef]
- Kirk, W.D.J.; Terry, L.I. The spread of the western flower thrips Frankliniella occidentalis (Pergande). Agr. Forest Entomol. 2003, 5, 301–310. [Google Scholar] [CrossRef]
- Morse, J.G.; Hoddle, M.S. Invasion Biology of Thrips. Annu. Rev. Entomol. 2006, 51, 67–89. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wu, Q.; Xu, B.; Zhu, G. The occurrence and damage of Frankliniella occidentalis (Thysanoptera: Thripidae): A dangerous alien invasive pest in Beijing. Plant Prot. 2003, 4, 58–59. [Google Scholar]
- Reitz, S.R.; Gao, Y.L.; Kirk, W.D.J.; Hoddle, M.S.; Leiss, K.A.; Funderburk, J.E. Invasion Biology, Ecology, and Management of Western Flower Thrips. Annu Rev Entomol. 2020, 65, 17–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wraight, S.P.; Ugine, T.A.; Ramos, M.E.; Sanderson, J.P. Efficacy of spray applications of entomopathogenic fungi against western flower thrips infesting greenhouse impatiens under variable moisture conditions. Biol. Control. 2016, 97, 31–47. [Google Scholar] [CrossRef] [Green Version]
- Ugine, T.A.; Wraight, S.P.; Brownbridge, M.; Sanderson, J.P. Development of a novel bioassay for estimation of median lethal concentrations (LC50) and doses (LD50) of the entomopathogenic fungus Beauveria bassiana, against western flower thrips, Frankliniella occidentalis. J. Invertebr. Pathol. 2005, 89, 210–218. [Google Scholar] [CrossRef]
- Ugine, T.A.; Wraight, S.P.; Sanderson, J.P. Acquisition of lethal doses of Beauveria bassiana by western flower thrips exposed to foliar spray residues of formulated and unformulated conidia. J. Invert. Pathol. 2005, 90, 10–23. [Google Scholar] [CrossRef]
- Ansari, M.A.; Brownbridge, M.; Shah, F.A.; Butt, T.M. Efficacy of entomopathogenic fungi against soil-dwelling life stages of western flower thrips, Frankliniella occidentalis, in plant-growing media. Entomol. Exper. Appl. 2008, 127, 80–87. [Google Scholar] [CrossRef]
- Skinner, M.; Gouli, S.; Frank, C.E.; Parker, B.L.; Kim, J.S. Management of Frankliniella occidentalis (Thysanoptera: Thripidae) with granular formulations of entomopathogenic fungi. Biol. Control. 2012, 63, 246–252. [Google Scholar] [CrossRef]
- Zhang, X.; Wu, S.; Reitz, S.; Gao, Y. Simultaneous application of entomopathogenic Beauveria bassiana granules and predatory mites Stratiolaelaps scimitus for control of western flower thrips, Frankliniella occidentalis. J. Pest Sci. 2021, 94, 119–127. [Google Scholar] [CrossRef]
- Duan, Y.L.; Wu, H.; Ma, Z.Y.; Yang, L.; Ma, D.Y. Scanning electron microscopy and histopathological observation of Beauveria bassiana infection of Colorado potato beetle larvae. Microb. Pathog. 2017, 10, 435–439. [Google Scholar] [CrossRef]
- Kenneth, J.L.; Thomas, D.S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar]
- Hong, M.; Peng, G.; Keyhani, N.O.; Xia, Y. Application of the entomogenous fungus, Metarhizium anisopliae, for leafroller (Cnaphalocrocis medinalis) control and its effect on rice phyllosphere microbial diversity. Appl. Microbiol. Biotechnol. 2017, 101, 6793–6807. [Google Scholar] [CrossRef]
- Willmott, A.L.; Cloyd, R.A.; Zhu, K.Y. Efficacy of pesticide mixtures against the western flower thrips (Thysanoptera: Thripidae) under laboratory and greenhouse conditions. J. Econ. Entomol. 2013, 106, 247–256. [Google Scholar] [CrossRef] [Green Version]
- Kivett, J.M.; Cloyd, R.A.; Bello, N.M. Insecticide rotation programs with entomopathogenic organisms for suppression of western flower thrips (Thysanoptera: Thripidae) adult populations under greenhouse conditions. J. Econ. Entomol. 2015, 108, 1936–1946. [Google Scholar] [CrossRef] [PubMed]
- Vestergaard, S.; Butt, T.M.; Bresciani, J.; Gillespie, A.T.; Eilenberg, J. Light and electron microscopy studies of the infection of the western flower thrips Frankliniella occidentalis (Thysanoptera: Thripidae) by the entomopathogenic fungus Metarhizium anisopliae. J. Inverteb. Pathol. 1999, 73, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Holder, D.J.; Keyhani, N.O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microbiol. 2005, 71, 5260–5266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toledo, A.V.; de Remes Lenicov, A.M.M.; Lastra, C.C.L. Histopathology caused by the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, in the adult planthopper, Peregrinus maidis, a maize virus vector. J. Insect. Sci. 2010, 10, 35. [Google Scholar] [CrossRef] [Green Version]
- Güerri-Agulló, B.; Gómez-Vidal, S.; Asensio, L.; Barranco, P.; Lopez-Llorca, L.V. Infection of the red plam weevil (Rhynchophorus ferrugineus) by the entomopathogenic fungus Beauveria bassiana: A SEM study. Microsc. Res. Tech 2010, 73, 714–725. [Google Scholar]
- Shabrawy, E.H.A.; Eweis, E.A.; Sewify, G.E.; Naroz, M.H. Investigation of certain stored products insects infected with the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae using scanning electron microscopy. Egypt J. Biol. Pest Cotrol. 2012, 22, 87–92. [Google Scholar]
- Liu, Z.; Lei, Z.; Hua, B.; Wang, H.; Liu, T. Germination behavior of Beauveria bassiana (Deuteromycotina: Hyphomycetes) on Bemisia tabaci (Hemiptera:Aleyrodidae) nymphs. J. Entomol. Sci. 2010, 45, 322–334. [Google Scholar] [CrossRef]
- James, R.R.; Buckner, J.S.; Freeman, T.P. Cuticular lipids and silverleaf whitefly stage affect conidial germination of Beauveria bassiana and Paecilomyces fumosoroseus. J. Invertebr. Pathol. 2003, 84, 67–74. [Google Scholar] [CrossRef]
- Wang, C.; St Leger, R.J. The MAD1 adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin enables attachment to plants. Eukaryot. Cell. 2007, 6, 808–816. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.; Xie, Y.; Xue, J.; Zhang, Y.; Zhang, X. Ultrastructural and cytochemical characterization of brown soft scale Coccus hesperidum (Hemiptera: Coccidae) infected by the Lecanicillium lecanii(Ascomycota: Hypocreales). Micron 2011, 42, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Schreiter, G.; Butt, T.M.; Beckett, A.; Vestergaard, S.; Moritz, G. Invasion and development of Verticillium lecanii in the western flower thrips, Frankliniella occidentalis. Mycol. Res. 1994, 98, 1025–1034. [Google Scholar] [CrossRef]
- Gao, Y.; Xie, Y.; Xiong, Q.; Liu, W.; Xue, J. Ultrastructural exploration on the histopathological change in Phenacoccus fraxinus infected with Lecanicillium lecanii. PLoS ONE 2015, 10, e0117428. [Google Scholar] [CrossRef] [Green Version]
- Cito, A.; Barzanti, G.P.; Strangi, A.; Francardi, V.; Zanfini, A.; Dreassi, E. Cuticle-degrading proteases and toxins as virulence markers of Beauveria bassiana (Balsamo) Vuillemin. J. Basic Microbiol. 2016, 56, 941–948. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Gao, Y.; Zhang, Y.; Wang, E.; Xu, X.; Lei, Z. An entomopathogenic strain of Beauveria bassiana against Frankliniella occidentalis with no detrimental effect on the predatory mite Neoseiulus barkeri. evidence from laboratory bioassay and scanning electron microscopic observation. PLoS ONE 2014, 9, e0084732. [Google Scholar]
- Dikgolz, V.E.; Toledo, A.V.; Topa, P.E.; Lastra, C.C.L. Evaluation of histological techniques for the detection of fungal infections caused by Leptolegnia chapmanii (Oomycetes: Saprolegniales) in Aedes aegypti (Diptera: Culicidae) larvae. Folia Microbiol. 2005, 50, 125–127. [Google Scholar] [CrossRef]
- Gao, T.; Wang, Z.; Yü, H.; Keyhani, N.O.; Huang, Z. Lack of resistance development in Bemisia tabaci to Isaria fumosorosea after multiple generations of selection. Sci. Rep. 2017, 7, 42727. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Widemann, E.; Bernard, G.; Lesot, A.; Pinot, F.; Pedrini, N.; Keyhani, N.O. CYP52X1, representing new cytochrome P450 subfamily, displays fatty acid hydroxylase activity and contributes to virulence and growth on insect cuticular substrates in entomopathogenic fungus Beauveria bassiana. J. Biol. Chem. 2012, 287, 13477–13486. [Google Scholar] [CrossRef] [Green Version]
- Lewis, M.W.; Robalino, I.V.; Keyhani, N.O. Uptake of the fluorescent probe FM4-64 by hyphae and haemolymph-derived in vivo hyphal bodies of the entomopathogenic fungus Beauveria bassiana. Microbiology 2009, 155, 3110–3120. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Xia, Y.; Keyhani, N.O. Contribution of the gas1 gene of the entomopathogenic fungus Beauveria bassiana, encoding a putative glycosylphosphatidylinositol-anchored beta-1,3-glucanosyltransferase, to conidial thermotolerance and virulence. Appl. Environ. Microbiol. 2011, 77, 2676–2684. [Google Scholar] [CrossRef] [Green Version]
Gene | Gene Accession | Sequence (5′-3′) | Sequence (3′-5′) |
---|---|---|---|
ATP-binding cassette transporter (Pdr5) | BBA_07660 | TCCTGCCCTTCTTCCTCGTCATG | AGAGCACGCCGCCGACATAG |
ATP-binding cassette transporter (Pdr2) | BBA_08779 | CGACGAGACGCAGGTTCATTCTTC | GACAGCCGAAGGAGCCAATGC |
Protein kinase A cAMP-dependent subunit | BBA_05916 | CATCAGGCAAGTCCGTCCAG | TGCTGCGTGTTCATTAGGTTG |
Cuticle-degrading protease 1(Pr1) | BBA_00443 | AGACAGTGGCTCGGGTTCG | TCTGGGCGGCATCCCTATT |
Beauvericin biosynthetic protein | BBA_09727 | TAAAGGGACTCGACATGCTCA | GGGGTCACTTGTATCAATCTTGTAC |
β-1,3 Glucan synthase | BBA_10207 | CCGCTGTATCCCACGAAATG | AAGAACGGTGACAGGGAGCA |
Perilipin homolog 1 | BBA_08759 | CAACGTCGAGGGCTCTGTC | CGGCGAAGGTCTTGTAGGC |
Mitogen-activated protein kinases hog1 | BBA_01244 | TGAGCGGGAAGCCCTTGTT | GACGTGTCGGCGAATAGCG |
Cytochrome P450 Monooxygenase CYP52 × 1 | GU566074 | ACCGCAACCCGAAACCAATC | CCGAATATCCAATATCCTGTCCCT |
Cytochrome P450 Monooxygenase CYP5293A | BBA_04705 | GCTTCGCCGGCATGTCG | CAACCTCGTCATCTAGCGTCACTG |
Cytochrome c synthase | BBA_05718 | CGAAGCGGTAGTTAGAAGGTGC | CGACATTTTGCTCGACTCTGAAG |
Actin | BBA_04860 | ACCCTCCGCTACCCCATTG | CGGGGGCGTTGAACGTCT |
Rate (%) | Time (Post-Inoculation, h) | |||
---|---|---|---|---|
4 | 8 | 12 | 18 | |
Germination | 82.69 ± 1.33 | 100 + 0 | 100 + 0 | 100 + 0 |
Penetration | 46.15 ± 1.26 | 82.26 ± 0.61 | 100 + 0 | 100 + 0 |
Shriveling | 0 + 0 | 51.61 ± 1.22 | 57.41 ± 0.71 | 67.38 ± 0.82 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Zheng, C.; Keyhani, N.O.; Gao, Y.; Wang, J. Infection of the Western Flower Thrips, Frankliniella occidentalis, by the Insect Pathogenic Fungus Beauveria bassiana. Agronomy 2021, 11, 1910. https://doi.org/10.3390/agronomy11101910
Zhang Z, Zheng C, Keyhani NO, Gao Y, Wang J. Infection of the Western Flower Thrips, Frankliniella occidentalis, by the Insect Pathogenic Fungus Beauveria bassiana. Agronomy. 2021; 11(10):1910. https://doi.org/10.3390/agronomy11101910
Chicago/Turabian StyleZhang, Zhijian, Changying Zheng, Nemat O. Keyhani, Yulin Gao, and Junping Wang. 2021. "Infection of the Western Flower Thrips, Frankliniella occidentalis, by the Insect Pathogenic Fungus Beauveria bassiana" Agronomy 11, no. 10: 1910. https://doi.org/10.3390/agronomy11101910
APA StyleZhang, Z., Zheng, C., Keyhani, N. O., Gao, Y., & Wang, J. (2021). Infection of the Western Flower Thrips, Frankliniella occidentalis, by the Insect Pathogenic Fungus Beauveria bassiana. Agronomy, 11(10), 1910. https://doi.org/10.3390/agronomy11101910