Collagen Type I Containing Hybrid Hydrogel Enhances Cardiomyocyte Maturation in a 3D Cardiac Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Medium Composition
2.2. Hydrogel Preparation
2.3. Hydrogel Composition Experiment
2.4. Growth Factor Experiment
2.5. RNA Extraction
2.6. cDNA Preparation
2.7. Quantitative Polymerase Chain Reaction (qPCR)
2.8. Rheometry
2.9. Measurement of Hydrogel Swelling and Degradation
2.10. Scanning Electron Microscopy of Hydrogel
3. Results
3.1. Concentration of Collagen Type I in the Hybrid Hydrogels Influences the Hydrogel Morphology and Stiffness
3.2. Effect of Collagen Type I on Swelling and Degradation of the Hydrogels
3.3. Effect of Collagen Type I on the Structure of the Cardiomyocyte Encapsulated in the Matrigel-Based Hydrogels
3.4. Influence of Collagen Type I on the Expression of Maturation Factors in Cardiomyocytes
3.5. Effects of FGF-4 and TGF-β1 Treatment on the Structure of Cardiomyocyte-Encapsulating Hybrid Hydrogels
3.6. Influence of FGF-4 and TGF-β1 Treatment on the Expression of Maturation Factors in Cardiomyocytes
4. Discussions
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Braam, S.R.; Tertoolen, L.; van de Stolpe, A.; Meyer, T.; Passier, R.; Mummery, C.L. Prediction of drug-induced cardiotoxicity using human embryonic stem cell-derived cardiomyocytes. Stem Cell Res. 2010, 4, 107–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scott, C.W.; Peters, M.F.; Dragan, Y.P. Human induced pluripotent stem cells and their use in drug discovery for toxicity testing. Toxicol. Lett. 2013, 219, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Elliott, N.T.; Yuan, F. A Review of Three-Dimensional In Vitro Tissue Models for Drug Discovery and Transport Studies. J. Pharm. Sci. 2011, 100, 59–74. [Google Scholar] [CrossRef] [PubMed]
- Kolanowski, T.J.; Antos, C.L.; Guan, K. Making human cardiomyocytes up to date: Derivation, maturation state and perspectives. Int. J. Cardiol. 2017, 241, 379–386. [Google Scholar] [CrossRef]
- Thavandiran, N.; Nunes, S.S.; Xiao, Y.; Radisic, M. Topological and electrical control of cardiac differentiation and assembly. Stem Cell Res. Ther. 2013, 4, 14. [Google Scholar] [CrossRef]
- Radisic, M.; Park, H.; Shing, H.; Consi, T.; Schoen, F.J.; Langer, R.; Freed, L.E.; Vunjak-Novakovic, G. Functional assembly of engineered myocardium by electrical stimulation of cardiac myocytes cultured on scaffolds. Proc. Natl. Acad. Sci. USA 2004, 101, 18129. [Google Scholar] [CrossRef]
- Pillekamp, F.; Haustein, M.; Khalil, M.; Emmelheinz, M.; Nazzal, R.; Adelmann, R.; Nguemo, F.; Rubenchyk, O.; Pfannkuche, K.; Matzkies, M.; et al. Contractile Properties of Early Human Embryonic Stem Cell-Derived Cardiomyocytes: Beta-Adrenergic Stimulation Induces Positive Chronotropy and Lusitropy but Not Inotropy. Stem Cells Dev. 2012, 21, 2111–2121. [Google Scholar] [CrossRef]
- Besser, R.R.; Ishahak, M.; Mayo, V.; Carbonero, D.; Claure, I.; Agarwal, A. Engineered Microenvironments for Maturation of Stem Cell Derived Cardiac Myocytes. Theranostics 2018, 8, 124–140. [Google Scholar] [CrossRef] [Green Version]
- Nunes, S.S.; Miklas, J.W.; Liu, J.; Aschar-Sobbi, R.; Xiao, Y.; Zhang, B.; Jiang, J.; Massé, S.; Gagliardi, M.; Hsieh, A.; et al. Biowire: A platform for maturation of human pluripotent stem cell–derived cardiomyocytes. Nat. Methods 2013, 10, 781. [Google Scholar] [CrossRef]
- Sun, X.; Nunes, S.S. Biowire platform for maturation of human pluripotent stem cell-derived cardiomyocytes. Methods 2016, 101, 21–26. [Google Scholar] [CrossRef]
- Borovjagin Anton, V.; Ogle Brenda, M.; Berry Joel, L.; Zhang, J. From Microscale Devices to 3D Printing. Circ. Res. 2017, 120, 150–165. [Google Scholar] [CrossRef] [Green Version]
- Bowers, S.L.K.; Banerjee, I.; Baudino, T.A. The extracellular matrix: At the center of it all. J. Mol. Cell. Cardiol. 2010, 48, 474–482. [Google Scholar] [CrossRef] [PubMed]
- Battista, S.; Guarnieri, D.; Borselli, C.; Zeppetelli, S.; Borzacchiello, A.; Mayol, L.; Gerbasio, D.; Keene, D.R.; Ambrosio, L.; Netti, P.A. The effect of matrix composition of 3D constructs on embryonic stem cell differentiation. Biomaterials 2005, 26, 6194–6207. [Google Scholar] [CrossRef]
- Fong, A.H.; Romero-López, M.; Heylman, C.M.; Keating, M.; Tran, D.; Sobrino, A.; Tran, A.Q.; Pham, H.H.; Fimbres, C.; Gershon, P.D.; et al. Three-Dimensional Adult Cardiac Extracellular Matrix Promotes Maturation of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes. Tissue Eng. Part A 2016, 22, 1016–1025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engler, A.J.; Carag-Krieger, C.; Johnson, C.P.; Raab, M.; Tang, H.-Y.; Speicher, D.W.; Sanger, J.W.; Sanger, J.M.; Discher, D.E. Embryonic cardiomyocytes beat best on a matrix with heart-like elasticity: Scar-like rigidity inhibits beating. J. Cell Sci. 2008, 121, 3794–3802. [Google Scholar] [CrossRef]
- Vanwinkle, W.B.; Snuggs, M.B.; Buja, L.M. Cardiogel: A biosynthetic extracellular matrix for cardiomyocyte culture. Vitr. Cell. Dev. Biol. Anim. 1996, 32, 478–485. [Google Scholar] [CrossRef]
- Tidball, J.G. Distribution of collagens and fibronectin in the subepicardium during avian cardiac development. Anat. Embryol. 1992, 185, 155–162. [Google Scholar] [CrossRef]
- Lu, Y.-Y.; Chen, Y.-C.; Kao, Y.-H.; Wu, T.-J.; Chen, S.-A.; Chen, Y.-J. Extracellular Matrix of Collagen Modulates Intracellular Calcium Handling and Electrophysiological Characteristics of HL-1 Cardiomyocytes With Activation of Angiotensin II Type 1 Receptor. J. Card. Fail. 2011, 17, 82–90. [Google Scholar] [CrossRef]
- Valiente-Alandi, I.; Schafer, A.E.; Blaxall, B.C. Extracellular matrix-mediated cellular communication in the heart. J. Mol. Cell. Cardiol. 2016, 91, 228–237. [Google Scholar] [CrossRef] [Green Version]
- Wells, R.G. The role of matrix stiffness in regulating cell behavior. Hepatology 2008, 47, 1394–1400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zimmermann, W.-H.; Melnychenko, I.; Eschenhagen, T. Engineered heart tissue for regeneration of diseased hearts. Biomaterials 2004, 25, 1639–1647. [Google Scholar] [CrossRef]
- Berg, J.; Hiller, T.; Kissner, M.S.; Qazi, T.H.; Duda, G.N.; Hocke, A.C.; Hippenstiel, S.; Elomaa, L.; Weinhart, M.; Fahrenson, C.; et al. Optimization of cell-laden bioinks for 3D bioprinting and efficient infection with influenza A virus. Sci. Rep. 2018, 8, 13877. [Google Scholar] [CrossRef] [PubMed]
- Borg, T.K.; Gay, R.E.; Johnson, L.D. Changes in the Distribution of Fibronectin and Collagen during Development of the Neonatal Rat Heart. Collagen Relat. Res. 1982, 2, 211–218. [Google Scholar] [CrossRef]
- Kubalak, S.W.; Miller-Hance, W.C.; O’Brien, T.X.; Dyson, E.; Chien, K.R. Chamber specification of atrial myosin light chain-2 expression precedes septation during murine cardiogenesis. J. Biol. Chem. 1994, 269, 16961–16970. [Google Scholar] [PubMed]
- O’Brien, T.X.; Lee, K.J.; Chien, K.R. Positional specification of ventricular myosin light chain 2 expression in the primitive murine heart tube. Proc. Natl. Acad. Sci. USA 1993, 90, 5157–5161. [Google Scholar] [CrossRef] [PubMed]
- Cai, C.-L.; Martin, J.C.; Sun, Y.; Cui, L.; Wang, L.; Ouyang, K.; Yang, L.; Bu, L.; Liang, X.; Zhang, X.; et al. A myocardial lineage derives from Tbx18 epicardial cells. Nature 2008, 454, 104. [Google Scholar] [CrossRef] [PubMed]
- Tatsuguchi, M.; Seok, H.Y.; Callis, T.E.; Thomson, J.M.; Chen, J.-F.; Newman, M.; Rojas, M.; Hammond, S.M.; Wang, D.-Z. Expression of microRNAs is dynamically regulated during cardiomyocyte hypertrophy. J. Mol. Cell. Cardiol. 2007, 42, 1137–1141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Pabon, L.; Murry, C.E. Engineering adolescence: Maturation of human pluripotent stem cell-derived cardiomyocytes. Circ. Res. 2014, 114, 511–523. [Google Scholar] [CrossRef]
- Itoh, N.; Ohta, H.; Nakayama, Y.; Konishi, M. Roles of FGF Signals in Heart Development, Health, and Disease. Front. Cell Dev. Biol. 2016, 4, 110. [Google Scholar] [CrossRef]
- Yamakawa, H.; Muraoka, N.; Miyamoto, K.; Sadahiro, T.; Isomi, M.; Haginiwa, S.; Kojima, H.; Umei, T.; Akiyama, M.; Kuishi, Y.; et al. Fibroblast Growth Factors and Vascular Endothelial Growth Factor Promote Cardiac Reprogramming under Defined Conditions. Stem Cell Rep. 2015, 5, 1128–1142. [Google Scholar] [CrossRef] [Green Version]
- Sakurai, T.; Tsuchida, M.; Lampe, P.D.; Murakami, M. Cardiomyocyte FGF signaling is required for Cx43 phosphorylation and cardiac gap junction maintenance. Exp. Cell Res. 2013, 319, 2152–2165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Azhar, M.; Schultz, J.E.J.; Grupp, I.; Dorn, G.W.; Meneton, P.; Molin, D.G.M.; Gittenberger-de Groot, A.C.; Doetschman, T. Transforming growth factor beta in cardiovascular development and function. Cytokine Growth Factor Rev. 2003, 14, 391–407. [Google Scholar] [CrossRef] [Green Version]
- Schultz, J.E.J.; Witt, S.A.; Glascock, B.J.; Nieman, M.L.; Reiser, P.J.; Nix, S.L.; Kimball, T.R.; Doetschman, T. TGF-β1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II. J. Clin. Investig. 2002, 109, 787–796. [Google Scholar] [CrossRef] [Green Version]
- Yuan, J.; Chen, H.; Ge, D.; Xu, Y.; Xu, H.; Yang, Y.; Gu, M.; Zhou, Y.; Zhu, J.; Ge, T.; et al. Mir-21 Promotes Cardiac Fibrosis After Myocardial Infarction Via Targeting Smad7. Cell. Physiol. Biochem. 2017, 42, 2207–2219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kofidis, T.; Akhyari, P.; Boublik, J.; Theodorou, P.; Martin, U.; Ruhparwar, A.; Fischer, S.; Eschenhagen, T.; Kubis, H.P.; Kraft, T.; et al. In vitro engineering of heart muscle: Artificial myocardial tissue. J. Thorac. Cardiovasc. Surg. 2002, 124, 63–69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, W.; Kong, C.W.; Tong, M.H.; Chooi, W.H.; Huang, N.; Li, R.A.; Chan, B.P. Maturation of human embryonic stem cell-derived cardiomyocytes (hESC-CMs) in 3D collagen matrix: Effects of niche cell supplementation and mechanical stimulation. Acta Biomater. 2017, 49, 204–217. [Google Scholar] [CrossRef] [PubMed]
- Rashedi, I.; Talele, N.; Wang, X.-H.; Hinz, B.; Radisic, M.; Keating, A. Collagen scaffold enhances the regenerative properties of mesenchymal stromal cells. PLoS ONE 2017, 12, e0187348. [Google Scholar] [CrossRef] [PubMed]
- Pelham, R.J., Jr.; Wang, Y.l. Cell locomotion and focal adhesions are regulated by substrate flexibility. Proc. Natl. Acad. Sci. USA 1997, 94, 13661–13665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bischofs, I.B.; Schwarz, U.S. Cell organization in soft media due to active mechanosensing. Proc. Natl. Acad. Sci. USA 2003, 100, 9274. [Google Scholar] [CrossRef]
- Zamir, E.A.; Srinivasan, V.; Perucchio, R.; Taber, L.A. Mechanical Asymmetry in the Embryonic Chick Heart During Looping. Ann. Biomed. Eng. 2003, 31, 1327–1336. [Google Scholar] [CrossRef]
- Ribeiro, A.J.S.; Ang, Y.-S.; Fu, J.-D.; Rivas, R.N.; Mohamed, T.M.A.; Higgs, G.C.; Srivastava, D.; Pruitt, B.L. Contractility of single cardiomyocytes differentiated from pluripotent stem cells depends on physiological shape and substrate stiffness. Proc. Natl. Acad. Sci. USA 2015, 112, 12705. [Google Scholar] [CrossRef]
- Rodriguez, A.G.; Han, S.J.; Regnier, M.; Sniadecki, N.J. Substrate Stiffness Increases Twitch Power of Neonatal Cardiomyocytes in Correlation with Changes in Myofibril Structure and Intracellular Calcium. Biophys. J. 2011, 101, 2455–2464. [Google Scholar] [CrossRef] [Green Version]
- Jacot, J.G.; McCulloch, A.D.; Omens, J.H. Substrate Stiffness Affects the Functional Maturation of Neonatal Rat Ventricular Myocytes. Biophys. J. 2008, 95, 3479–3487. [Google Scholar] [CrossRef] [Green Version]
- Gershlak, J.R.; Resnikoff, J.I.N.; Sullivan, K.E.; Williams, C.; Wang, R.M.; Black, L.D. Mesenchymal stem cells ability to generate traction stress in response to substrate stiffness is modulated by the changing extracellular matrix composition of the heart during development. Biochem. Biophys. Res. Commun. 2013, 439, 161–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scuderi, G.J.; Butcher, J. Naturally Engineered Maturation of Cardiomyocytes. Front. Cell Dev. Biol. 2017, 5, 50. [Google Scholar] [CrossRef] [Green Version]
- Park, E.J.; Watanabe, Y.; Smyth, G.; Miyagawa-Tomita, S.; Meyers, E.; Klingensmith, J.; Camenisch, T.; Buckingham, M.; Moon, A.M. An FGF autocrine loop initiated in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart. Development 2008, 135, 3599. [Google Scholar] [CrossRef] [PubMed]
- Morabito, C.J.; Dettman, R.W.; Kattan, J.; Collier, J.M.; Bristow, J. Positive and Negative Regulation of Epicardial–Mesenchymal Transformation during Avian Heart Development. Dev. Biol. 2001, 234, 204–215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward Primer | Reverse Primer | Company |
---|---|---|---|
MLC2v | CGGAGAAGAGAAGGACTAGGA | ACAGACAAGGTAGGGACAGA | Integrated DNA Technologies (USA) |
TBX18 | CTGGATGACCAAGGCCATATTA | ACAGGCTTGATGGGAGAAAG | Integrated DNA Technologies (USA) |
pre-miR-21 | TGTCGGGTAGCTTATCAGAC | TGTCAGACAGCCCATCGACT | Integrated DNA Technologies (USA) |
β-actin | CTTCTACAATGAGCTGCGTGTGGCTC | GTACATGGCTGGGGTGTTGAAGGTC | Integrated DNA Technologies (USA) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Edalat, S.G.; Jang, Y.; Kim, J.; Park, Y. Collagen Type I Containing Hybrid Hydrogel Enhances Cardiomyocyte Maturation in a 3D Cardiac Model. Polymers 2019, 11, 687. https://doi.org/10.3390/polym11040687
Edalat SG, Jang Y, Kim J, Park Y. Collagen Type I Containing Hybrid Hydrogel Enhances Cardiomyocyte Maturation in a 3D Cardiac Model. Polymers. 2019; 11(4):687. https://doi.org/10.3390/polym11040687
Chicago/Turabian StyleEdalat, Sam G., Yongjun Jang, Jongseong Kim, and Yongdoo Park. 2019. "Collagen Type I Containing Hybrid Hydrogel Enhances Cardiomyocyte Maturation in a 3D Cardiac Model" Polymers 11, no. 4: 687. https://doi.org/10.3390/polym11040687
APA StyleEdalat, S. G., Jang, Y., Kim, J., & Park, Y. (2019). Collagen Type I Containing Hybrid Hydrogel Enhances Cardiomyocyte Maturation in a 3D Cardiac Model. Polymers, 11(4), 687. https://doi.org/10.3390/polym11040687