Polymer Pen Lithography-Fabricated DNA Arrays for Highly Sensitive and Selective Detection of Unamplified Ganoderma Boninense DNA
Abstract
1. Introduction
2. Experimental Section
2.1. Materials and Equipment
2.2. Preparation of Capture DNA-AuNP Conjugates
2.3. Preparation of Reporter DNA Arrays by PPL
2.3.1. Preparation of Materials
2.3.2. PPL Printing of Reporter DNA Arrays
2.4. Extraction of Genomic DNA
2.5. Hybridisation Experiment on PPL Arrays
3. Results and Discussion
3.1. PPL Fabrication of Reporter DNA Probe Arrays
3.2. The Hybridisation of Patterned Substrates with Single-Stranded Target DNA
3.3. Detection, Sensitivity and Selectivity for Genomic DNA of G. Boninense
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tran, H.; Killops, K.L.; Campos, L.M. Advancements and challenges of patterning biomolecules with sub-50 nm features. Soft Matter 2013, 9, 6578–6586. [Google Scholar] [CrossRef]
- Schmidt, R.C.; Healy, K.E. Controlling biological interfaces on the nanometer-length scale. J. Biomed. Mater. Res. A 2009, 90, 1252–1261. [Google Scholar] [CrossRef]
- Kim, D.-H.; Lee, H.; Lee, Y.K.; Nam, J.-M.; Levchenko, A. Biomimetic nanopatterns as enabling tools for analysis and control of live cells. Adv. Mater. 2010, 22, 4551–4566. [Google Scholar] [CrossRef]
- Kumar, A.; Whitesides, G.M. Features of gold having micrometre to centimetre dimensions can be formed through a combination of stamping with an elastomeric stamp and an alkanethiol ‘ink’ followed by chemical etching. Appl. Phys. Lett. 1993, 63, 2002–2004. [Google Scholar] [CrossRef]
- Kumar, A.; Biebuyck, H.A.; Whitesides, G.M. Patterning self-assembled monolayers: Applications in materials science. Langmuir 1994, 10, 1498–1511. [Google Scholar] [CrossRef]
- Jang, M.G.; Nam, Y. Agarose-assisted micro-contact printing for high-quality biomolecular micro-patterns. Macromol. Biosci. 2015, 15, 613–621. [Google Scholar] [CrossRef]
- Salaita, K.; Wang, Y.; Mirkin, C.A. Applications of dip-pen nanolithography. Nat. Nanotechnol. 2007, 2, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.C.; Reinhoudt, D.N.; Otto, C.; Subramaniam, V.; Velders, A.H. Strategies for patterning biomolecules with dip-pen nanolithography. Small 2011, 7, 989–1002. [Google Scholar] [CrossRef]
- Mirkin, C.A. The power of the pen: Development of massively parallel dip-pen nanolithography. ACS Nano 2007, 1, 79–83. [Google Scholar] [CrossRef]
- Huo, F.; Zheng, Z.; Zheng, G.; Giam, L.R.; Zhang, H.; Mirkin, C.A. Polymer pen lithography. Science 2008, 321, 1658–1660. [Google Scholar] [CrossRef]
- Brinkmann, F.; Hirtz, M.; Greiner, A.M.; Weschenfelder, M.; Waterkotte, B.; Bastmeyer, M.; Fuchs, H. Interdigitated multicolored bioink micropatterns by multiplexed polymer pen lithography. Small 2013, 9, 3266–3275. [Google Scholar] [CrossRef]
- Zheng, Z.; Daniel, W.L.; Giam, L.R.; Huo, F.; Senesi, A.J.; Zheng, G.; Mirkin, C.A. Multiplexed protein arrays enabled by polymer pen lithography: Addressing the inking challenge. Angew. Chem. Int. Ed. 2009, 48, 7626–7629. [Google Scholar] [CrossRef]
- Kumar, R.; Weigel, S.; Meyer, R.; Niemeyer, C.M.; Fuchs, H.; Hirtz, M. Multi-color polymer pen lithography for oligonucleotide arrays. Chem. Commun. 2016, 52, 12310–12313. [Google Scholar] [CrossRef]
- Roth, S.B.; Jalava, J.; Ruuskanen, O.; Ruohola, A.; Nikkari, S. Use of an oligonucleotide array for laboratory diagnosis of bacteria responsible for acute upper respiratory infections. J. Clin. Microbiol. 2004, 42, 4268–4274. [Google Scholar] [CrossRef]
- Jain, K.K. Applications of nanobiotechnology in clinical diagnostics. Clin. Chem. 2004, 53, 2002–2007. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Li, J. Nanotechnology: Moving from microarrays toward nanoarrays. In Methods in Molecular Biology: Microarrays, 2nd ed.; Rampal, J.B., Ed.; Humana Press: New York, NY, USA, 2007; Volume 1, pp. 411–436. [Google Scholar]
- Wong, L.S.; Khan, F.; Micklefield, J. Selective covalent protein immobilization: Strategies and applications. Chem. Rev. 2009, 109, 4025–4053. [Google Scholar] [CrossRef] [PubMed]
- Ho, Y.W.; Nawawi, A. Ganoderma boninense pathogen from basal stem rot of oil palm (Elaeis guineensis) in Peninsular Malaysia. Pertanika 1985, 8, 425–428. [Google Scholar]
- Susanto, A.; Sudharto, P.S.; Purba, R.Y. Enhancing biological control of basal stem rot disease Ganoderma boninense in oil palm plantations. Mycopathologia 2005, 159, 153–157. [Google Scholar] [CrossRef] [PubMed]
- Hushiarian, R.; Yusof, N.A.; Dutse, S.W. Detection and control of Ganoderma boninense: Strategies and perspectives. SpringerPlus 2013, 2, 555. [Google Scholar] [CrossRef]
- Darmono, T.W.; Suharyanto, A. Recognition of field materials of Ganoderma sp. associated with basal stem rot in oil palm by a polyclonal antibody. Menara Perkeb. 1995, 63, 15–22. [Google Scholar]
- Shamala, S.; Chris, D.; Sioban, O.; Idris, A. Preliminary studies on the development of monoclonal antibodies against mycelia of Ganoderma boninense, the causal pathogen of basal stem rot of oil palm. Mal. J. Microbiol. 2006, 2, 30–34. [Google Scholar]
- Madihah, A.Z.; Idris, A.S.; Rafidah, A.R. Polyclonal antibodies of Ganoderma boninense isolated from Malaysian oil palm for detection of basal stem rot disease. Afr. J. Biotechnol. 2014, 13, 3455–3463. [Google Scholar] [CrossRef]
- Dutse, S.W.; Yusof, N.A.; Ahmad, H.; Hussein, M.Z.; Hushiarian, R. DNA-based biosensor for detection of Ganoderma boninense, an oil palm pathogen utilising newly synthesised ruthenium complex [Ru(phen)2(qtpy)]2 based on a PEDOT-PSS/Ag nanoparticles modified electrode. Int. J. Electrochem. Sci. 2013, 8, 11048–11057. [Google Scholar]
- Dutse, S.W.; Yusof, N.A.; Ahmad, H.; Hussein, M.Z.; Zainal, Z.; Hushiarian, R.; Hajian, R. An electrochemical biosensor for the determination of Ganoderma boninense pathogen based on a novel modified gold nanocomposite film electrode. Anal. Lett. 2014, 47, 819–832. [Google Scholar] [CrossRef]
- Hushiarian, R.; Yusof, N.A.; Abdullah, A.H.; Alang Ahmad, S.A.; Dutse, S.W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Anal. Chem. Res. 2015, 6, 17–25. [Google Scholar] [CrossRef]
- Markom, M.A.; Md Shakaff, A.Y.; Adom, A.H.; Ahmad, M.N.; Hidayat, W.; Abdullah, A.H.; Fikri, N.A. Intelligent electronic nose system for basal stem rot disease detection. Comput. Electron. Agr. 2009, 66, 140–146. [Google Scholar] [CrossRef]
- Akanbi, F.S.; Yusof, N.A.; Abdullah, J.; Sulaiman, Y.; Hushiarian, R. Detection of quinoline in G. boninense-infected plants using functionalized multi-walled carbon nanotubes: A field study. Sensors 2017, 17, 1538. [Google Scholar] [CrossRef]
- Najmie, M.M.K.; Khalid, K.; Sidek, A.A.; Jusoh, M.A. Density and ultrasonic characterization of oil palm trunk infected by Ganoderma Boninense disease. Meas. Sci. Rev. 2011, 11, 160–164. [Google Scholar] [CrossRef]
- Lelong, C.C.; Roger, J.-M.; Brégand, S.; Dubertret, F.; Lanore, M.; Sitorus, N.; Raharjo, D.; Caliman, J.-P. Evaluation of oil-palm fungal disease infestation with canopy hyperspectral reflectance data. Sensors 2010, 10, 734–747. [Google Scholar] [CrossRef] [PubMed]
- Santoso, H.; Gunawan, T.; Jatmiko, R.H.; Darmosarkoro, W.; Minasny, B. Mapping and identifying basal stem rot disease in oil palms in North Sumatra with QuickBird imagery. Precis. Agric. 2011, 12, 233–248. [Google Scholar] [CrossRef]
- Ahmadi, P.; Muharam, F.M.; Ahmad, K.; Mansor, S.; Seman, I.A. Early detection of Ganoderma basal stem rot of oil palms using artificial neural network spectral analysis. Plant Dis. 2017, 101, 1009–1016. [Google Scholar] [CrossRef]
- Hashim, I.C.; Shariff, A.R.M.; Bejo, S.K.; Muharam, F.M.; Ahmad, K. Classification for non-infected and infected Ganoderma boninense of oil palm trees using ALOS PALSAR-2 backscattering coefficient. Iop Conf. Ser. Earth Environ. Sci. 2018, 169, 012066. [Google Scholar] [CrossRef]
- Taton, T.A.; Mirkin, C.A.; Letsinger, R.L. Scanometric DNA array detection with nanoparticle probes. Science 2000, 289, 1757–1760. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Hosford, J.; Heath, W.P.; Wong, L.S. Large-area scanning probe nanolithography facilitated by automated alignment of probe arrays. RSC Adv. 2015, 5, 61402–61409. [Google Scholar] [CrossRef]
- Lee, I.-N.; Hosford, J.; Wang, S.; Hunt, J.A.; Curran, J.M.; Heath, W.P.; Wong, L.S. Large-area scanning probe nanolithography facilitated by automated alignment and its application to substrate fabrication for cell culture studies. J. Vis. Exp. 2018, 136, e56967. [Google Scholar] [CrossRef]
- Li, F.; Zhang, H.; Dever, B.; Li, X.; Le, X.C. Thermal stability of DNA functionalized gold nanoparticles. Bioconjugate Chem. 2013, 24, 1790–1797. [Google Scholar] [CrossRef]
- Demers, L.M.; Ginger, D.S.; Park, S.-J.; Li, Z.; Chung, S.-W.; Mirkin, C.A. Direct patterning of modified oligonucleotides on metals and insulators by dip-pen nanolithography. Science 2002, 296, 1836–1838. [Google Scholar] [CrossRef]
- Ho, Y.W.; Nawawi, A. Isolation, growth and sporophore development of Ganoderrna boninense from oil palm in Malaysia. Pertanika 1986, 9, 69–73. [Google Scholar]
- Amer, O.E.; Mahmoud, M.A.; El-Samawaty, A.M.A.; Sayed, S.R.M. Non liquid nitrogen-based-method for isolation of DNA from filamentous fungi. Afr. J. Biotechnol. 2011, 10, 14337–14341. [Google Scholar]
- Storhoff, J.J.; Lucas, A.D.; Garimella, V.; Bao, Y.P.; Müller, U.R. Homogeneous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticle probes. Nat. Biotechnol. 2004, 22, 883–887. [Google Scholar] [CrossRef] [PubMed]
- Long, E.O.; David, I.D. Repeated genes in eukaryotes. Annu. Rev. Biochem. 1980, 49, 727–764. [Google Scholar] [CrossRef] [PubMed]
- Wolf, L.K.; Gao, Y.; Georgiadis, R.M. Sequence-dependent DNA immobilisation: Specific versus nonspecific contributions. Langmuir 2004, 20, 3357–3361. [Google Scholar] [CrossRef] [PubMed]
- Utomo, C.; Werner, S.; Niepold, F.; Demising, H.B. Identification of ganoderma, the causal agent of basal stem rot disease in oil palm using a molecular method. Mycopathologia 2005, 159, 159–170. [Google Scholar] [CrossRef] [PubMed]
- Chong, K.P.; Lum, M.S.; Foong, C.P.; Wong, C.W.L.; Atong, M.; Rossall, S. First identification of Ganoderma boninense isolated from Sabah based on PCR and sequecne homology. Afr. J. Biotechnol. 2011, 10, 14718–14723. [Google Scholar] [CrossRef]




| Name | Sequence (5′ → 3′) |
|---|---|
| Capture probe | (Thiol C6)CCTGCTGCGTTCTTCTTCAT |
| Reporter probe | CGATGCGAGAGCCAA(Thiol C3) |
| Target | TTGGCTCTCGCATCGATGAAGAAGAACGCAGCAGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rani, E.; Mohshim, S.A.; Ahmad, M.Z.; Goodacre, R.; Alang Ahmad, S.A.; Wong, L.S. Polymer Pen Lithography-Fabricated DNA Arrays for Highly Sensitive and Selective Detection of Unamplified Ganoderma Boninense DNA. Polymers 2019, 11, 561. https://doi.org/10.3390/polym11030561
Rani E, Mohshim SA, Ahmad MZ, Goodacre R, Alang Ahmad SA, Wong LS. Polymer Pen Lithography-Fabricated DNA Arrays for Highly Sensitive and Selective Detection of Unamplified Ganoderma Boninense DNA. Polymers. 2019; 11(3):561. https://doi.org/10.3390/polym11030561
Chicago/Turabian StyleRani, Ekta, Siti Akhtar Mohshim, Muhammad Zamharir Ahmad, Royston Goodacre, Shahrul Ainliah Alang Ahmad, and Lu Shin Wong. 2019. "Polymer Pen Lithography-Fabricated DNA Arrays for Highly Sensitive and Selective Detection of Unamplified Ganoderma Boninense DNA" Polymers 11, no. 3: 561. https://doi.org/10.3390/polym11030561
APA StyleRani, E., Mohshim, S. A., Ahmad, M. Z., Goodacre, R., Alang Ahmad, S. A., & Wong, L. S. (2019). Polymer Pen Lithography-Fabricated DNA Arrays for Highly Sensitive and Selective Detection of Unamplified Ganoderma Boninense DNA. Polymers, 11(3), 561. https://doi.org/10.3390/polym11030561

