Heterologous Expression of Inulinase Gene in Bacillus licheniformis 24 for 2,3-Butanediol Production from Inulin
Abstract
1. Introduction
2. Results
2.1. Selection of Inulinase: The Inu Gene of Lc. paracasei DSM 23505
2.2. Cloning of the Inu Gene in pBE-S and pMA5 E. coli/Bacillus spp. Shuttle Vectors
2.3. Production of 2,3-BD by B. licheniformis T14 and T26 during Flask-Batch Processes
2.4. Production of 2,3-BD by B. licheniformis T26 from Inulin during the Fermenter-Batch Process
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Media, and Cultivation Conditions
4.2. Molecular cloning of Inulinase Genes into pBE-S and pMA5 Vectors
4.3. Transformation and Clone Selection
4.4. Inulinase Activity Assay
4.5. Analytical Methods
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Maina, S.; Schneider, R.; Alexandri, M.; Papapostolou, H.; Nychas, G.-J.; Koutinas, A.; Venus, J. Volumetric oxygen transfer coefficient as fermentation control parameter to manipulate the production of either acetoin or D(−)2,3-butanediol using bakery waste. Bioresour. Technol. 2021, 335, 125155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, X.J.; Huang, H.; Ouyang, P.K. Microbial 2,3-butanediol production: A state of the art review. Biotechnol. Adv. 2011, 29, 351–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, C.W.; Park, J.M.; Chung, S.C.; Lee, S.Y.; Song, H. Microbial production of 2,3-butanediol for industrial applications. J. Ind. Microbiol. Biotechnol. 2019, 46, 1583–1601. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Cho, S.-Y.; Vu, T.-T.; Duong, H.-P.-Y.; Kim, E. Dehydration of 2,3-Butanediol to 1,3-Butadiene and Methyl Ethyl Ketone: Modeling, Numerical Analysis and Validation Using Pilot-Scale Reactor Data. Catalysts 2021, 11, 999. [Google Scholar] [CrossRef] [Scilit]
- Petrov, K.; Petrova, P. Current Advances in Microbial Production of Acetoin and 2,3-Butanediol by Bacillus spp. Fermentation 2021, 7, 307. [Google Scholar] [CrossRef] [Scilit]
- Maina, S.; Prabhu, A.A.; Vivek, N.; Vlysidis, A.; Koutinas, A.; Kumar, V. Prospects on bio-based 2,3-butanediol and acetoin production: Recent progress and advances. Biotechnol. Adv. 2022, 54, 107783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewing, T.A.; Nouse, N.; van Lint, M.; van Haveren, J.; Hugenholtz, J.; van Es, D.S. Fermentation for the production of biobased chemicals in a circular economy: A perspective for the period 2022–2050. Green Chem. 2022, 24, 6373–6405. [Google Scholar] [CrossRef] [Scilit]
- Hazeena, S.H.; Sindhu, R.; Pandey, A.; Binod, P. Lignocellulosic bio-refinery approach for microbial 2,3-Butanediol production. Bioresour. Technol. 2020, 302, 122873. [Google Scholar] [CrossRef] [Scilit]
- Difonzo, G.; de Gennaro, G.; Caponio, G.R.; Vacca, M.; dal Poggetto, G.; Allegretta, I.; Immirzi, B.; Pasqualone, A. Inulin from Globe Artichoke Roots: A Promising Ingredient for the Production of Functional Fresh Pasta. Foods 2022, 11, 3032. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Dai, J.Y.; Xiu, Z.L. A novel strategy for integrated utilization of Jerusalem artichoke stalk and tuber for production of 2,3-butanediol by Klebsiella pneumoniae. Bioresour. Technol. 2010, 101, 8342–8347. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.H.; Wang, X.D.; Dai, J.Y.; Xiu, Z.L. Microbial production of 2,3-butanediol from Jerusalem artichoke tubers by Klebsiella pneumoniae. Appl. Microbiol. Biotechnol. 2009, 82, 847–852. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Xu, H.; Li, Q.-j.; Feng, X.-h.; Li, S. Optimization of medium for one-step fermentation of inulin extract from Jerusalem artichoke tubers using Paenibacillus polymyxa ZJ-9 to produce R,R-2,3-butanediol. Bioresour. Technol. 2010, 101, 7087–7093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.M.; Oh, B.-R.; Kang, I.Y.; Heo, S.-Y.; Seo, J.-W.; Park, S.-M.; Hong, W.-K.; Kim, C.H. Enhancement of 2,3-butanediol production from Jerusalem artichoke tuber extract by a recombinant Bacillus sp. strain BRC1 with increased inulinase activity. J. Ind. Microbiol. Biotechnol. 2017, 44, 1107–1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.X.; Chen, C.; Li, K.; Wang, Y.; Gao, C.; Ma, C.Q.; Xu, P. Efficient simultaneous saccharification and fermentation of inulin to 2,3-butanediol by thermophilic Bacillus licheniformis ATCC 14580. Appl. Environ. Microbiol. 2014, 80, 6458–6464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lü, C.; Ge, Y.; Cao, M.; Guo, X.; Liu, P.; Gao, C.; Xu, P.; Ma, C. Metabolic Engineering of Bacillus licheniformis for Production of Acetoin. Front. Bioeng. Biotechnol. 2020, 8, 125. [Google Scholar] [CrossRef] [Scilit]
- Jurchescu, I.M.; Hamann, J.; Zhou, X.; Ortmann, T.; Kuenz, A.; Prusse, U.; Lang, S. Enhanced 2,3-butanediol production in fed batch cultures of free and immobilized Bacillus licheniformis DSM 8785. Appl. Microbiol. Biotechnol. 2013, 97, 6715–6723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kallbach, M.; Horn, S.; Kuenz, A.; Prusse, U. Screening of novel bacteria for the 2,3-butanediol production. Appl. Microbiol. Biotechnol. 2017, 101, 1025–1033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Zhang, L.; Li, K.; Wang, Y.; Gao, C.; Han, B.; Ma, C.; Xu, P. A newly isolated Bacillus licheniformis strain thermophilically produces 2,3-butanediol, a platform and fuel bio-chemical. Biotechnol. Biofuels 2013, 6, 123. [Google Scholar] [CrossRef] [Scilit]
- Tsigoriyna, L.; Ganchev, D.; Petrova, P.; Petrov, K. Highly efficient 2,3-butanediol production by Bacillus licheniformis via complex optimization of nutritional and technological parameters. Fermentation 2021, 7, 118. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Y.; Zhang, J.; Li, L.; Wen, Z.; Nomura, C.T.; Wu, S.; Chen, S. Engineering Bacillus licheniformis for the production of me-so-2,3-butanediol. Biotechnol. Biofuels 2016, 9, 117. [Google Scholar] [CrossRef] [Scilit]
- Qi, G.; Kang, Y.; Li, L.; Xiao, A.; Zhang, S.; Wen, Z.; Xu, D.; Chen, S. Deletion of meso-2,3-butanediol dehydrogenase gene budC for enhanced D-2,3-butanediol production in Bacillus licheniformis. Biotechnol. Biofuels 2014, 7, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrova, P.; Petlichka, S.; Petrov, K. New Bacillus spp. with potential for 2,3-butanediol production from biomass. J. Biosci. Bioeng. 2020, 130, 20–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsigoriyna, L.; Petrov, K. Production of 2,3-butanediol from fructose by Bacillus licheniformis 24. Acta Microbiol. Bulg. 2021, 37, 183–187. Available online: https://actamicrobio.bg/archive/issue-4-2021/amb-4-2021-article-2.pdf (accessed on 18 March 2023).
- Petrova, P.; Velikova, P.; Popova, L.; Petrov, K. Direct conversion of chicory flour into L(+)-lactic acid by the highly effective inulinase producer Lactobacillus paracasei DSM 23505. Bioresour. Technol. 2015, 186, 329–333. [Google Scholar] [CrossRef] [Scilit]
- Velikova, P.; Petrov, K.; Petrova, P. The cell wall anchored β-fructosidases of Lactobacillus paracasei: Overproduction, purification, and gene expression control. Proc. Biochem. 2017, 52, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Scilit]
- Ge, Y.; Li, K.; Li, L.; Gao, C.; Zhang, L.; Ma, C.; Xu, P. Contracted but effective production of enantiopure 2,3-butanediol by thermophilic and GRAS Bacillus licheniformis. Green Chem. 2016, 18, 4693–4703. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.J.; Liu, P.H.; Qin, J.Y.; Xu, P. Statistical optimization of medium components for enhanced acetoin production from molasses and soybean meal hydrolysate. Appl. Microbiol. Biotechnol. 2007, 74, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Deshmukh, A.N.; Nipanikar-Gokhale, P.; Jain, R. Engineering of Bacillus subtilis for the Production of 2,3-Butanediol from Sugarcane Molasses. Appl. Biochem. Biotechnol. 2016, 179, 321–331. [Google Scholar] [CrossRef] [Scilit]
- Dai, J.Y.; Cheng, L.; He, Q.F.; Xiu, Z.L. High acetoin production by a newly isolated marine Bacillus subtilis strain with low requirement of oxygen supply. Proc. Biochem. 2015, 50, 1730–1734. [Google Scholar] [CrossRef] [Scilit]
- Sikora, B.; Kubik, C.; Kalinowska, H.; Gromek, E.; Białkowska, A.; Jędrzejczak-Krzepkowska, M.; Schüett, F.; Turkiewicz, M. Application of byproducts from food processing for production of 2,3-butanediol using Bacillus amyloliquefaciens TUL 308. Prep. Biochem. Biotechnol. 2016, 46, 610–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Białkowska, A. Strategies for efficient and economical 2,3-butanediol production: New trends in this field. World J. Microbiol. Biotechnol. 2016, 32, 200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perego, P.; Converti, A.; del Borghi, M. Effects of temperature, inoculum size and starch hydrolyzate concentration on butanediol production by Bacillus licheniformis. Bioresour. Technol. 2003, 89, 125–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Liu, P.; Guo, G.; Liu, Z.; Zhong, L.; Guo, L.; Chen, C.; Hao, N.; Ouyang, P. Production of acetoin and its derivative tetramethylpyrazine from okara hydrolysate with Bacillus subtilis. AMB Express 2023, 13, 25. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Zhang, X.; Ren, K.; Han, R.; Lu, R.; Bao, T.; Pan, X.; Yang, T.; Xu, M.; Rao, Z. Acetoin production from lignocellulosic biomass hydrolysates with a modular metabolic engineering system in Bacillus subtilis. Biotechnol. Biofuels 2022, 15, 87. [Google Scholar] [CrossRef] [Scilit]
- De Oliveira, R.L.; da Silva, S.P.; Converti, A.; Porto, T.S. Production, Biochemical Characterization, and Kinetic/Thermodynamic Study of Inulinase from Aspergillus terreus URM4658. Molecules 2022, 27, 6418. [Google Scholar] [CrossRef] [Scilit]
- Krupa-Kozak, U.; Drabińska, N.; Rosell, C.M.; Piłat, B.; Starowicz, M.; Jeliński, T.; Szmatowicz, B. High-Quality Gluten-Free Sponge Cakes without Sucrose: Inulin-Type Fructans as Sugar Alternatives. Foods 2020, 9, 1735. [Google Scholar] [CrossRef] [Scilit]
- Xie, S.; Li, Z.; Zhu, G.; Song, W.; Yi, C. Cleaner production and downstream processing of bio-based 2,3-butanediol: A review. J. Clean. Prod. 2022, 343, 131033. [Google Scholar] [CrossRef] [Scilit]
- Dai, J.Y.; Guan, W.T.; Xiu, Z.L. Bioconversion of inulin to 2,3-butanediol by a newly isolated Klebsiella pneumoniae producing inulinase. Proc. Biochem. 2020, 98, 247–253. [Google Scholar] [CrossRef] [Scilit]
- Mera, A.; de Lima, M.Z.T.; Bernardes, A.; Garcia, W.; Muniz, J.R.C. Low-resolution structure, oligomerization and its role on the enzymatic activity of a sucrose-6-phosphate hydrolase from Bacillus licheniformis. Amino Acids 2019, 51, 599–610. [Google Scholar] [CrossRef] [Scilit]
- Klaewkla, M.; Pichyangkura, R.; Chunsrivirot, S. Computational Design of Oligosaccharide-Producing Levansucrase from Bacillus licheniformis RN-01 to Increase Its Stability at High Temperature. J. Phys. Chem. B 2021, 125, 5766–5774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doan, C.T.; Tran, T.N.; Nguyen, T.T.; Tran, T.P.H.; Nguyen, V.B.; Tran, T.D.; Nguyen, A.D.; Wang, S.-L. Production of Sucrolytic Enzyme by Bacillus licheniformis by the Bioconversion of Pomelo Albedo as a Carbon Source. Polymers 2021, 13, 1959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muras, A.; Romero, M.; Mayer, C.; Otero, A. Biotechnological applications of Bacillus licheniformis. Crit. Rev. Biotechnol. 2021, 41, 609–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, D.; Wang, H.; He, P.; Chengjun Zhu, C.; Wang, Q.; Wei, X.; Nomura, C.T.; Chen, S. A novel strategy to improve protein secretion via overexpression of the SppA signal peptide peptidase in Bacillus licheniformis. Microb. Cell Fact. 2017, 16, 70. [Google Scholar] [CrossRef] [Scilit]
- Shen, P.; Niu, D.; Liu, X.; Tian, K.; Permaul, K.; Singh, S.; Mchunu, N.P.; Wang, Z. High-efficiency chromosomal integrative amplification strategy for overexpressing α-amylase in Bacillus licheniformis. J. Ind. Microbiol. Biotechnol. 2022, 49, kuac009. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.; Ma, Y.; Zhao, Y.; Shen, W.; Chen, X. Systematic engineering of transport and transcription to boost alkaline α-amylase production in Bacillus subtilis. Appl. Microbiol. Biotechnol. 2020, 104, 2973–2985. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Ma, X.; Zhang, L.; Ding, Z.; Xu, S.; Gu, Z.; Shi, G. Engineering of Bacillus Promoters Based on Interacting Motifs between UP Elements and RNA Polymerase (RNAP) α-Subunit. Int. J. Mol. Sci. 2022, 23, 13480. [Google Scholar] [CrossRef] [Scilit]
- Petrova, P.; Petrov, K. Direct starch conversion into L-(+)-lactic acid by a novel amylolytic strain of Lactobacillus paracasei B41. Starch 2012, 64, 10–17. [Google Scholar] [CrossRef] [Scilit]
- Arsov, A.; Petrov, K.; Petrova, P. Enhanced activity by genetic complementarity: Heterologous secretion of clostridial cellulases by Bacillus licheniformis and Bacillus velezensis. Molecules 2021, 26, 5625. [Google Scholar] [CrossRef] [Scilit]
- Xue, G.-P.; Johnson, J.S.; Dalrymple, B.P. High osmolarity improves the electro-transformation efficiency of the gram-positive bacteria Bacillus subtilis and Bacillus licheniformis. J. Microbiol. Methods 1999, 34, 183–191. [Google Scholar] [CrossRef] [Scilit]







| Construct | Number of Transformants | Clones Analyzed | Positive Clones * |
|---|---|---|---|
| pBES_Inu | 2638 | 89 | 7 |
| pBES_Inu-tr | 2415 | 62 | 7 |
| pMA5_Inu | 458 | 164 | 0 |
| Primer | Sequence (5′–3′) | Position in Gene | T (°C) | Purpose |
|---|---|---|---|---|
| InuF | atggatgaaaagaaacattacaagatg | 1–27 | 60 | PCR |
| InuR | ttagactcgcttcacccgcctc | 3617–3645 | 60 | PCR |
| InuF-tr_Xho | gtcaatctcgagatggatgaaaagaaacattacaagatgtat | 1–30 | 60 | Cloning |
| InuR-tr_Xba | ggtcattctagactattagatagttaagtcgctgatctttgtcgtgcc | 2163–2193 | 60 | Cloning |
| InuF_Nhe | gatcagctagcatggatgaaaagaaacattacaagat | 1–26 | 57 | Cloning |
| InuR_Nhe | cagtagctagcttagactcgcttcacccgcctctttaacc | 3616–3645 | 57 | Cloning |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsigoriyna, L.; Arsov, A.; Petrova, P.; Gergov, E.; Petrov, K. Heterologous Expression of Inulinase Gene in Bacillus licheniformis 24 for 2,3-Butanediol Production from Inulin. Catalysts 2023, 13, 841. https://doi.org/10.3390/catal13050841
Tsigoriyna L, Arsov A, Petrova P, Gergov E, Petrov K. Heterologous Expression of Inulinase Gene in Bacillus licheniformis 24 for 2,3-Butanediol Production from Inulin. Catalysts. 2023; 13(5):841. https://doi.org/10.3390/catal13050841
Chicago/Turabian StyleTsigoriyna, Lidia, Alexander Arsov, Penka Petrova, Emanoel Gergov, and Kaloyan Petrov. 2023. "Heterologous Expression of Inulinase Gene in Bacillus licheniformis 24 for 2,3-Butanediol Production from Inulin" Catalysts 13, no. 5: 841. https://doi.org/10.3390/catal13050841
APA StyleTsigoriyna, L., Arsov, A., Petrova, P., Gergov, E., & Petrov, K. (2023). Heterologous Expression of Inulinase Gene in Bacillus licheniformis 24 for 2,3-Butanediol Production from Inulin. Catalysts, 13(5), 841. https://doi.org/10.3390/catal13050841

