Bisdemethoxycurcumin Reduces Methicillin-Resistant Staphylococcus aureus Expression of Virulence-Related Exoproteins and Inhibits the Biofilm Formation
Abstract
:1. Introduction
2. Results
2.1. BDMC Reduces the Expression of α-Toxin and Inhibits the Expression of agrA and hla in S. aureus
2.2. BDMC Inhibits Biofilm Formation and Downregulated the Expression of hld
2.3. Expression of Staphylococcus Enterotoxin-Related Exoproteins in MRSA Treated with BDMC
2.4. BDMC Downregulated the Expression of sea and seb in MRSA
2.5. BDMC Reduces the Activity of IL-6 and TNF-α
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Bacterial Strains and Growth Conditions
4.3. Western Blot Assay
4.4. Reverse Transcription and qRT-PCR
4.5. ELISA
4.6. Crystal Violet Biofilm Assay
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yuan, Y.; Zai, Y.; Xi, X.; Ma, C.; Wang, L.; Zhou, M.; Shaw, C.; Chen, T. A novel membrane-disruptive antimicrobial peptide from frog skin secretion against cystic fibrosis isolates and evaluation of anti-MRSA effect using Galleria mellonella model. Biochim. Biophys. Acta (BBA)- Gen. Subj. 2019, 1863, 849–856. [Google Scholar] [CrossRef] [Green Version]
- Dharmaratne, P.; Sapugahawatte, D.N.; Wang, B.; Chan, C.L.; Lau, K.M.; Lau, C.B.; Fung, K.P.; Ng, D.K.; Ip, M. Con-temporary approaches and future perspectives of antibacterial photodynamic therapy (aPDT) against methicillin resistant Staphylococcus aureus (MRSA): A systematic review. Eur. J. Med. Chem. 2020, 200, 112341. [Google Scholar] [CrossRef]
- David, M.Z.; Daum, R.S. Community-Associated Methicillin-Resistant Staphylococcus aureus: Epidemiology and Clinical Consequences of an Emerging Epidemic. Clin. Microbiol. Rev. 2010, 23, 616–687. [Google Scholar] [CrossRef] [Green Version]
- El-Halfawy, O.M.; Czarny, T.L.; Flannagan, R.S.; Day, J.; Bozelli, J.C.; Kuiack, R.C.; Salim, A.; Eckert, P.; Epand, R.M.; McGavin, M.; et al. Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. Nat. Chem. Biol. 2020, 16, 143–149. [Google Scholar] [CrossRef]
- Vestergaard, M.; Frees, D.; Ingmer, H. Antibiotic Resistance and the MRSA Problem. Microbiol. Spectr. 2019, 7, 2. [Google Scholar] [CrossRef]
- Kathirvel, M.; Buchad, H.; Nair, M. Enhancement of the pathogenicity of Staphylococcus aureus strain Newman by a small noncoding RNA SprX1. Med. Microbiol. Immunol. 2016, 205, 563–574. [Google Scholar] [CrossRef]
- Liu, L.; Shen, X.; Yu, J.; Cao, X.; Zhan, Q.; Guo, Y.; Yu, F. Subinhibitory Concentrations of Fusidic Acid May Reduce the Virulence of S. aureus by Down-Regulating sarA and saeRS to Reduce Biofilm Formation and α-Toxin Expression. Front. Microbiol. 2020, 11, 25. [Google Scholar] [CrossRef]
- Anderson, M.J.; Schaaf, E.; Breshears, L.M.; Wallis, H.W.; Johnson, J.R.; Tkaczyk, C.; Sellman, B.R.; Sun, J.; Peterson, M.L. Alpha-Toxin Contributes to Biofilm Formation among Staphylococcus aureus Wound Isolates. Toxins 2018, 10, 157. [Google Scholar] [CrossRef] [Green Version]
- Ueda, Y.; Mashima, K.; Miyazaki, M.; Hara, S.; Takata, T.; Kamimura, H.; Takagi, S.; Jimi, S. Inhibitory effects of polysorbate 80 on MRSA biofilm formed on different substrates including dermal tissue. Sci. Rep. 2019, 9, 3128. [Google Scholar] [CrossRef]
- Brady, R.A.; O’May, G.A.; Leid, J.G.; Prior, M.L.; Costerton, J.W.; Shirtliff, M.E. Resolution of Staphylococcus aureus Biofilm Infection Using Vaccination and Antibiotic Treatment. Infect. Immun. 2011, 79, 1797–1803. [Google Scholar] [CrossRef] [Green Version]
- Naclerio, G.A.; Onyedibe, K.I.; Sintim, H.O. Lipoteichoic Acid Biosynthesis Inhibitors as Potent Inhibitors of S. aureus and E. faecalis Growth and Biofilm Formation. Molecules 2020, 25, 2277. [Google Scholar] [CrossRef]
- Etter, D.; Schelin, J.; Schuppler, M.; Johler, S. Staphylococcal Enterotoxin C-An Update on SEC Variants, Their Structure and Properties, and Their Role in Foodborne Intoxications. Toxins 2020, 12, 584. [Google Scholar] [CrossRef]
- Verreault, D.; Ennis, J.; Whaley, K.; Killeen, S.Z.; Karauzum, H.; Aman, M.J.; Holtsberg, R.; Doyle-Meyers, L.; Didier, P.J.; Zeitlin, L.; et al. Effective Treatment of Staphylococcal Enterotoxin B Aerosol Intoxication in Rhesus Macaques by Using Two Parenterally Administered High-Affinity Monoclonal Antibodies. Antimicrob. Agents Chemother. 2019, 63, e02049-18. [Google Scholar] [CrossRef] [Green Version]
- Söderquist, B.; Källman, J.; Holmberg, H.; Vikerfors, T.; Kihlström, E. Secretion of IL-6, IL-8 and G-CSF by human endothelial cells in vitro in response to Staphylococcus aureus and staphylococcal exotoxins. APMIS 1998, 106, 1157–1164. [Google Scholar]
- Chen, G.; Karauzum, H.; Long, H.; Carranza, D.; Holtsberg, F.W.; Howell, K.A.; Abaandou, L.; Zhang, B.; Jarvik, N.; Ye, W.; et al. Potent Neutralization of Staphylococcal Enterotoxin B In Vivo by Antibodies that Block Binding to the T-Cell Receptor. J. Mol. Biol. 2019, 431, 4354–4367. [Google Scholar] [CrossRef]
- Wünsche, S.; Yuan, L.; Seidel-Morgenstern, A.; Lorenz, H. A Contribution to the Solid State Forms of Bis(demethoxy)curcumin: Co-Crystal Screening and Characterization. Molecules 2021, 26, 720. [Google Scholar] [CrossRef]
- Duro-Castano, A.; Borrás, C.; Herranz-Pérez, V.; Blanco-Gandía, M.C.; Conejos-Sánchez, I.; Armiñán, A.; Mas-Bargues, C.; Inglés, M.; Miñarro, J.; Rodríguez-Arias, M.; et al. Targeting Alzheimer’s disease with multimodal polypeptide-based nanoconjugates. Sci. Adv. 2021, 7, eabf9180. [Google Scholar] [CrossRef]
- Jin, F.; Chen, X.; Yan, H.; Xu, Z.; Yang, B.; Luo, P.; He, Q. Bisdemethoxycurcumin attenuates cisplatin-induced renal injury through anti-apoptosis, anti-oxidant and anti-inflammatory. Eur. J. Pharmacol. 2020, 874, 173026. [Google Scholar] [CrossRef]
- Wang, S.; Kim, M.-C.; Kang, O.-H.; Kwon, D.-Y. The Mechanism of Bisdemethoxycurcumin Enhances Conventional Antibiotics against Methicillin-Resistant Staphylococcus aureus. Int. J. Mol. Sci. 2020, 21, 7945. [Google Scholar] [CrossRef]
- Mun, S.-H.; Kong, R.; Seo, Y.-S.; Zhou, T.; Kang, O.-H.; Shin, D.-W.; Kwon, D.-Y. Subinhibitory concentrations of punicalagin reduces expression of virulence-related exoproteins by Staphylococcus aureus. FEMS Microbiol. Lett. 2016, 363, 22. [Google Scholar] [CrossRef] [Green Version]
- Miller, L.S.; Fowler, V.G.; Shukla, S.K.; Rose, W.E.; Proctor, R.A. Development of a vaccine against Staphylococcus aureus invasive infections: Evidence based on human immunity, genetics and bacterial evasion mechanisms. FEMS Microbiol. Rev. 2020, 44, 123–153. [Google Scholar] [CrossRef] [Green Version]
- Fischer, A.J.; Kilgore, S.H.; Singh, S.B.; Allen, P.D.; Hansen, A.R.; Limoli, D.H.; Schlievert, P.M. High Prevalence of Staphylococcus aureus Enterotoxin Gene Cluster Superantigens in Cystic Fibrosis Clinical Isolates. Genes 2019, 10, 1036. [Google Scholar] [CrossRef] [Green Version]
- Shimamura, Y.; Utsumi, M.; Hirai, C.; Nakano, S.; Ito, S.; Tsuji, A.; Ishii, T.; Hosoya, T.; Kan, T.; Ohashi, N.; et al. Binding of Catechins to Staphylococcal Enterotoxin A. Molecules 2018, 23, 1125. [Google Scholar] [CrossRef] [Green Version]
- Rossiter, S.E.; Fletcher, M.H.; Wuest, W.M. Natural Products as Platforms to Overcome Antibiotic Resistance. Chem. Rev. 2017, 117, 12415–12474. [Google Scholar] [CrossRef]
- Mashayekhi-Sardoo, H.; Mashayekhi-Sardoo, A.; Roufogalis, B.D.; Jamialahmadi, T.; Sahebkar, A. Impact of Curcumin on Microsomal Enzyme Activities: Drug Interaction and Chemopreventive Studies. Curr. Med. Chem. 2021, 28, 7122–7140. [Google Scholar] [CrossRef]
- Miklášová, N.; Herich, P.; Dávila-Becerril, J.; Barroso-Flores, J.; Fischer-Fodor, E.; Valentová, J.; Leskovská, J.; Kožíšek, J.; Takáč, P.; Mojžiš, J. Evaluation of Antiproliferative Palladium(II) Complexes of Synthetic Bisdemethoxycurcumin towards In Vitro Cytotoxicity and Molecular Docking on DNA Sequence. Molecules 2021, 26, 4369. [Google Scholar] [CrossRef]
- Kotha, R.R.; Luthria, D.L. Curcumin: Biological, Pharmaceutical, Nutraceutical, and Analytical Aspects. Molecules 2019, 24, 2930. [Google Scholar] [CrossRef] [Green Version]
- Mihailescu, R.; Tafin, U.F.; Corvec, S.; Oliva, A.; Betrisey, B.; Borens, O.; Trampuz, A. High Activity of Fosfomycin and Rifampin against Methicillin-Resistant Staphylococcus aureus Biofilm In Vitro and in an Experimental Foreign-Body Infection Model. Antimicrob. Agents Chemother. 2014, 58, 2547–2553. [Google Scholar] [CrossRef] [Green Version]
- Shimamura, Y.; Hirai, C.; Sugiyama, Y.; Shibata, M.; Ozaki, J.; Murata, M.; Ohashi, N.; Masuda, S. Inhibitory effects of food additives derived from polyphenols on staphylococcal enterotoxin A production and biofilm formation by Staphylococcus aureus. Biosci. Biotechnol. Biochem. 2017, 81, 2346–2352. [Google Scholar] [CrossRef] [Green Version]
- Qu, D.; Hou, Z.; Li, J.; Luo, L.; Su, S.; Ye, Z.; Bai, Y.; Zhang, X.; Chen, G.; Li, Z.; et al. A new coumarin compound DCH combats methicillin-resistant Staphylococcus aureus biofilm by targeting arginine repressor. Sci. Adv. 2020, 6, eaay9597. [Google Scholar] [CrossRef]
- Takó, M.; Kerekes, E.B.; Zambrano, C.; Kotogán, A.; Papp, T.; Krisch, J.; Vágvölgyi, C. Plant Phenolics and Phenol-ic-Enriched Extracts as Antimicrobial Agents against Food-Contaminating Microorganisms. Antioxidants 2020, 9, 165. [Google Scholar] [CrossRef] [Green Version]
- Coll, F.; Harrison, E.M.; Toleman, M.S.; Reuter, S.; Raven, K.E.; Blane, B.; Palmer, B.; Kappeler, A.R.M.; Brown, N.M.; Török, M.E.; et al. Longitudinal genomic surveillance of MRSA in the UK reveals transmission patterns in hospitals and the community. Sci. Transl. Med. 2017, 9, 413. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Luo, J.; Liu, X.; Kang, O.; Kwon, D. Antibacterial activity and synergy of antibiotics with sanguisorbigenin isolated from Sanguisorba officinalis L. against methicillin-resistant Staphylococcus aureus. Lett. Appl. Microbiol. 2021, 72, 238–244. [Google Scholar] [CrossRef]
- Wang, S.; Kang, O.-H.; Kwon, D.-Y. Trans-Cinnamaldehyde Exhibits Synergy with Conventional Antibiotic against Methicillin-Resistant Staphylococcus aureus. Int. J. Mol. Sci. 2021, 22, 2752. [Google Scholar] [CrossRef]
- Wang, J.; Jiao, H.; Meng, J.; Qiao, M.; Du, H.; He, M.; Ming, K.; Liu, J.; Wang, D.; Wu, Y. Baicalin Inhibits Biofilm Formation and the Quorum-Sensing System by Regulating the MsrA Drug Efflux Pump in Staphylococcus saprophyticus. Front. Microbiol. 2019, 10, 2800. [Google Scholar] [CrossRef]
- Sharifi, A.; Mohammadzadeh, A.; Salehi, T.Z.; Mahmoodi, P.; Nourian, A. Cuminum cyminum L. Essential Oil: A Promising Antibacterial and Antivirulence Agent Against Multidrug-Resistant Staphylococcus aureus. Front. Microbiol. 2021, 12, 667833. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) |
---|---|
16S | F: ACTCCTACGGGAGGCAGCAG |
R: ATTACCGCGGCTGCTGG | |
sea | F: ATGGTGCTTATTATGGTTATC |
R: CGTTTCCAAAGGTACTGTATT | |
seb | F: TGTTCGGGTATTTGAAGATGG |
R: CGTTTCATAAGGCGAGTTGTT | |
agrA | F: TGATAATCCTTATGAGGTGCTT R: CACTGTGACTCGTAACGAAAA |
hla | F: TTGGTGCAAATGTTTC R: TCACTTTCCAGCCTACT |
hld | F: ATTTGTTCACTGTGTCGATAATCC R: GGAGTGATTTCAATGGCACAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Kang, O.-H.; Kwon, D.-Y. Bisdemethoxycurcumin Reduces Methicillin-Resistant Staphylococcus aureus Expression of Virulence-Related Exoproteins and Inhibits the Biofilm Formation. Toxins 2021, 13, 804. https://doi.org/10.3390/toxins13110804
Wang S, Kang O-H, Kwon D-Y. Bisdemethoxycurcumin Reduces Methicillin-Resistant Staphylococcus aureus Expression of Virulence-Related Exoproteins and Inhibits the Biofilm Formation. Toxins. 2021; 13(11):804. https://doi.org/10.3390/toxins13110804
Chicago/Turabian StyleWang, Shu, Ok-Hwa Kang, and Dong-Yeul Kwon. 2021. "Bisdemethoxycurcumin Reduces Methicillin-Resistant Staphylococcus aureus Expression of Virulence-Related Exoproteins and Inhibits the Biofilm Formation" Toxins 13, no. 11: 804. https://doi.org/10.3390/toxins13110804
APA StyleWang, S., Kang, O.-H., & Kwon, D.-Y. (2021). Bisdemethoxycurcumin Reduces Methicillin-Resistant Staphylococcus aureus Expression of Virulence-Related Exoproteins and Inhibits the Biofilm Formation. Toxins, 13(11), 804. https://doi.org/10.3390/toxins13110804