Next Article in Journal
TRP Channels as Sensors of Bacterial Endotoxins
Next Article in Special Issue
Trichothecene Genotypes of Fusarium graminearum Populations Isolated from Winter Wheat Crops in Serbia
Previous Article in Journal
Human Poisoning from Marine Toxins: Unknowns for Optimal Consumer Protection
Previous Article in Special Issue
Fusarium Molds and Mycotoxins: Potential Species-Specific Effects
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland

1
Department of Botany and Nature Protection, University of Warmia and Mazury in Olsztyn, Plac Łódzki 1, 10-727 Olsztyn, Poland
2
Department of Systems Engineering, Faculty of Engineering, University of Warmia and Mazury in Olsztyn, Heweliusza 14, 10-718 Olsztyn, Poland
3
Experimental Education Unit, Oczapowskiego 8, 10-719 Olsztyn, Poland
*
Author to whom correspondence should be addressed.
Toxins 2018, 10(8), 325; https://doi.org/10.3390/toxins10080325
Submission received: 17 July 2018 / Revised: 29 July 2018 / Accepted: 7 August 2018 / Published: 10 August 2018
(This article belongs to the Special Issue Recent Advances in Fusarium Research)

Abstract

Fusarium head blight (FHB) of cereals is the major head disease negatively affecting grain production worldwide. In 2016 and 2017, serious outbreaks of FHB occurred in wheat crops in Poland. In this study, we characterized the diversity of Fusaria responsible for these epidemics using TaqMan assays. From a panel of 463 field isolates collected from wheat, four Fusarium species were identified. The predominant species were F. graminearum s.s. (81%) and, to a lesser extent, F. avenaceum (15%). The emergence of the 15ADON genotype was found ranging from 83% to 87% of the total trichothecene genotypes isolated in 2016 and 2017, respectively. Our results indicate two dramatic shifts within fungal field populations in Poland. The first shift is associated with the displacement of F. culmorum by F. graminearum s.s. The second shift resulted from a loss of nivalenol genotypes. We suggest that an emerging prevalence of F. graminearum s.s. may be linked to boosted maize production, which has increased substantially over the last decade in Poland. To detect variation within Tri core clusters, we compared sequence data from randomly selected field isolates with a panel of strains from geographically diverse origins. We found that the newly emerged 15ADON genotypes do not exhibit a specific pattern of polymorphism enabling their clear differentiation from the other European strains.
Key Contribution: F. graminearum s.s. has replaced F. culmorum as the main agent of FHB in Poland. European and American 15ADON strains of F. graminearum s.s. display specific patterns of polymorphism within Tri gene core clusters.

1. Introduction

Fusarium head blight (FHB, syn. scab) is one of the most devastating small-grain cereal diseases worldwide. Although globally FHB mostly affects barley, rye, oats, and triticale, it is considered the most precarious head disease of wheat [1]. Warm and humid weather conditions at the flowering stage are conducive to disease development [2,3,4]. Symptoms may occur over the entire head or on just a few spikelets, which leads to the formation of Fusarium-damaged kernels (FDK) (Figure 1). Accumulation of various mycotoxins in the grain affected by FHB pose a significant risk to food and feed safety [5].
Control of the disease is focused on agricultural practices, fungicides, and cultivar resistance [6]. Among fungicides, azoles play a major role in controlling FHB. However, the increased application of azoles resulted in resistant strains recovered from F. graminearum field populations [7,8,9]. The development of resistant varieties appears to be the most promising approach for managing the disease. However, improvement of resistance to FHB is a continuous challenge because of environment effects, genotype-by-environment interactions [10], and a broad range of Fusarium species associated with FHB.
F. graminearum sensu lato (s.l.) is nowadays the most frequently isolated causal agent of FHB worldwide. Phylogenetic species recognition, with genealogical concordance [11], has provided strong genetic evidence that F. graminearum sensu lato comprises at least 16 biogeographically structured and phylogenetically distinct species, also known as the Fusarium graminearum species complex (FGSC) [12,13,14,15]. F. graminearum sensu stricto (s.s.) is the dominant FGSC species associated with FHB in North and South America [16,17,18,19], whereas F. asiaticum appears to be the major species in temperate regions of Asia [15,20,21,22]. In Europe, F. graminearum s.s. displaced F. culmorum, which had been the major FHB agent of wheat since the 1840s [23]. However, the predomination of F. culmorum in some European localities identified in several surveys may be explained by the influence of climatic conditions in increasing the prevalence of each species [24].
FHB epidemics occurred in Poland in 1974 and 1999, and over the next decade, the incidence of the disease in small grain cereals was rather limited [25,26,27,28]. Despite regional differences in pathogen composition, previous Polish surveys highlighted the general predominance of three species: F. culmorum; F. graminearum s.l.; and, to a lesser extent, F. avenaceum [28,29,30]. Stępień et al. [28] indicated that predominance of F. graminearum is associated with displacement of F. culmorum by F. graminearum, which corresponds to previous surveys from the Netherlands [31] and Luxembourg [32]. However, the suggested shift was not confirmed in further surveys of Wiśniewska et al. [29] by incorporating a much larger panel of field isolates. In the 2009 growing season, FHB outbreaks were reported in both northern and southern Poland [29,33]. A large-scale survey by Chełkowski et al. [33] showed that F. graminearum s.l. and F. culmorum were responsible for the last outbreak, with emphasis on the former.
Both F. culmorum and F. graminearum s.s. can belong to different chemotypes: 3ADON (producing DON and 3ADON), 15ADON (producing DON and 15ADON) (absent in F. culmorum), and NIV (producing NIV and 4ANIV) [34]. Knowledge of chemotype composition within Fusarium field populations has been found to be important in determining population structure, monitoring chemotype shifts, and predicting the presence of trichothecene compounds in grains [22,35,36]. Trichothecene chemotypes appear to differ in pathogenicity [16,37,38], susceptibility to fungicides [39], and may differ in the total amount of toxin produced. For example, the 3ADON chemotype poses a greater risk to food safety than 15ADON, as it was found to produce more DON [16,40,41].
Field populations of trichothecene producers are often characterized by incorporation of mycotoxin genotyping tools allowing rapid detection of 3, 15ADON, and NIV genotypes [42,43,44,45]. Over the last 15 years, shifts between Tri genotypes/chemotypes have been observed in geographically diverse locations such as North America, China, Denmark, and Luxembourg [15,16,22,37,44,46,47].
The important areas in which to focus research on Fusarium species are the natural boundaries and climates of agricultural regions, which may define pathogen potential [6]. The climate in Poland is temperate, with relatively cold winters and warm summers, where northern maritime air from the Atlantic and eastern continental air often collide, causing high daily and annual variability in the weather patterns. This high climate variability may affect pathogen profiles that may differ from fungal populations found in the more humid climate of western Europe. As mentioned earlier, previous data on species composition responsible for FHB epidemics in Poland comes from relatively old surveys [28,29,33]. In addition, there are no current data on the population subdivision of Fusaria associated with Tri genotype differences. There is an urgent need to update results, mainly from the most recent FHB outbreaks, which occurred during the 2016 and 2017 growing seasons. In 2016, the disease occurred over the entire country, while in 2017, FHB occurrence was restricted to northern Poland. We have characterized the collection of field isolates responsible for FHB in Poland in both growing seasons. The isolates were recovered mainly from FDK of wheat from geographically diverse fields. To determine Fusarium species and trichothecene genotypes, we used different TaqMan-based assays. To detect variation within Tri core clusters, we compared sequence data from randomly selected field isolates with a panel of strains from geographically diverse origins. The updated results of this study could be used to develop a reliable plant protection strategy against currently emerged fungal species.

2. Results

2.1. Determination of Fungal Species and Trichothecene Genotypes

From the panel of 463 field isolates collected from wheat, four Fusarium species were identified (Table 1). The predominant species were F. graminearum s.s. (81.2%) and, to a lesser extent, F. avenaceum (14.7%). Both F. culmorum and F. poae were occasionally isolated. Our results indicated high regional and temporal differences in species composition. For example, predomination of F. graminearum s.s. appeared to be complete in wheat samples from northern Poland (Łajsy, Tywęzy, Tczew and Malbork), where F. graminearum s.s. was the solely isolated species. In contrast, other sampling locations (Kętrzyn, Ostrołęka, and Warsaw West Counties, 2017) exhibited a slightly decreased incidence of F. graminearum s.s., ranging from 46.1% to 54.6% of the total FDKs analyzed. Barley samples analyzed in this study showed the lowest (<17%) incidence of F. graminearum s.s. (Table 1).
In 2016, where FHB affected an entire country, F. graminearum s.s. accounted for 91% of the diseased wheat kernels. In 2017, the amount of F. graminearum s.s. isolates recovered from FDKs decreased to 68% and was restricted to northern Poland. Dramatic regional differences were also found when analyzing F. avenaceum distribution. In general, the incidence of F. avenaceum on wheat ranged from 5.3% in 2016 to 27.4% in 2017. However, in three locations (Kętrzyn County, Ostrołęka County, and Warsaw West County), F. avenaceum accounted for over 44% of the diseased kernels. Moreover, an unexpectedly high incidence of F. avenaceum was found on barley kernels from Modzurów, accounting for 80.4% of FDKs. F. avenaceum was not recovered from 5 out of 17 wheat sampling locations.
In contrast to previous surveys by Wiśniewska et al. [29] and Chełkowski et al. [33], a surprisingly low incidence of F. culmorum was found in our study (3.9%). Only one isolate was recognized as F. poae (0.2%). F. culmorum was identified in 4 out of 17 locations. None of the F. poae isolates were found in 2017.
Genotyping of a collection of 394 F. culmorum/F. graminearum s.s. isolates from wheat kernels showed a high prevalence of the 15ADON genotype in Poland. In the 2016 and 2017 growing seasons, the 15ADON genotype accounted for 82.9% and 87.4% of F. culmorum/F. graminearum s.s. isolates, respectively. All 333 isolates identified as 15ADON genotype belonged to F. graminearum s.s. Among the total of 61 3ADON genotypes, 70.5% and 29.5% belonged to F. graminearum and F. culmorum, respectively. The 3ADON genotype was more prevalent in 2016, accounting for 17.1% of the total Tri genotypes. In 2017, a shift towards the 15ADON genotype was observed, leading to a decreased incidence of 3ADON genotypes (12.6%). None of the NIV genotype was determined in our collection of field isolates.

2.2. Comparative Analysis of the Tri Core Cluster

In this study, we asked if an additional level of diversity within core Tri clusters enables specific characterization of the emerged 15ADON genotypes. To achieve it, the complete Tri core clusters from four emerging (isolated in 2016) 15ADON field isolates were compared with the panel of 31 strains from geographically diverse origins. Our collection also included four historical Polish isolates recovered between 2003 and 2004 (Table 2).
Sequence data comparison did not detect gene translocations or gene gain and loss polymorphisms. SNPs (single nucleotide polymorphisms) were the most common type of DNA polymorphism determining genetic variability of the strains within this cluster. All identified SNPs were synonymous.
The emerging 15ADON isolates did not show a specific pattern of polymorphism enabling their clear differentiation from the other European strains. However, we showed that the studied strains displayed polymorphism related to their European and American origins. The most remarkable differences between these two groups were found within the 1333 bp end of the Tri core cluster totaling 55 SNPs (Supplementary Figure S1). Thirty-one SNPs were located within the Tri14 gene (1170 bp), while the remaining 24 SNPs were found within the short (163 bp) upstream region of the Tri14 gene.

3. Discussion

FHB surveys performed in Europe over the last few decades have verified an increased predominance of F. graminearum sensu lato in different European countries, for example, The Netherlands [31], France [48,49], Germany [50], and Italy [51,52].
A previous large-scale survey by Chełkowski et al. [33] highlighted the increasing predomination of F. graminearum s.l. in wheat in Poland during the FHB epidemics in 2009. At the same time, however, considerable incidence of F. culmorum was found in some Polish localities [29,33]. In our study, we showed that F. graminearum s.s. dramatically predominated in the growing seasons of both 2016 and 2017. Our results highlighted, for the first time, a huge disproportion between F. graminearum s.s. and F. culmorum. Although some regional and temporal differences were found, it is worth mentioning that these changes were mainly attributed to a noticeable shift towards F. avenaceum in 2017.
Our results showed that the 15ADON genotype predominated in diseased kernels, ranging from 83% to 87% of the total trichothecene genotypes isolated in 2016 and 2017, respectively. The revealed predomination of the 15ADON genotype in Poland is in line with other European surveys [47,49,50,51,52,53], however, 3ADON genotypes [54] and NIV [55] genotypes have also been observed. Surprisingly, none of the NIV genotypes have been identified within either F. culmorum or F. graminearum s.s.
The emergence of F. graminearum in Europe has been mainly linked to boosted production of maize as the primary host of F. graminearum [23,31,56]. Maize production results in large amounts of residues, which promote the production of ascospores [57], which appear to greatly outnumber airborne conidia [58] and might be carried over long distances [59]. Recently, it was found that 15ADON isolates have an advantage in perithecia formation and ascospore release [60]. The observed dramatic emergence of F. graminearum s.s. in Poland may also be linked to the rise in maize production. Since the last reports on FHB incidence in 2009 [29,33], the maize cultivation area increased by nearly 42%, averaging 595,000 ha in 2016 (http://www.fao.org/faostat/en/#data/QC), which is close to the maize cultivation area in Germany (416,000 ha) and Italy (660,000 ha). In both countries, as well as in France (the largest maize producer in Europe), predomination of the 15ADON genotype of F. graminearum has been highlighted [49,50,51].
Besides cropping systems, changes in climate patterns, such as the increase in annual temperature, have also been suggested as key factors affecting recent emergence of F. graminearum s.s. [31,56,61,62,63]. Indeed, since 1951, reports from Poland have highlighted the increase in the annual mean temperature by 1.1–2.2 °C [64]. The average global temperature for the 2013–2017 period was 1.0 °C above pre-industrial levels and was the highest five-year average on record [65].
Production of different analogs of trichothecene compounds by fungi affect their virulence [16,37,41] and distribution [66,67]. The regional and temporal differences in Tri genotype frequency may change over time and space. In addition, a chemotype occupying a certain geographic location can be replaced by another. Most recent chemotype shifts appear to result from the introduction of new genotypes into new areas [23]. Such examples include 3ADON genotypes of F. graminearum s.s. in Canada [16], 3ADON genotypes of F. asiaticum in Southern China [22], and the NIV genotype of F. asiaticum in the southern United States [68] and Brazil [69].
Kelly and Ward [66] showed that among the number of genomic regions, Tri genes exhibit the strongest signals of selection contributing to population divergence. In this study, we found that the newly emerged Polish 15ADON genotypes do not exhibit specific patterns of polymorphism enabling their clear differentiation from the other European strains. This may suggest previously uncovered evidence of frequent gene flow between different European populations of F. graminearum s.s. [50]. However, we showed that the strains display a pattern of polymorphism within the Tri core cluster regarding their European and American origins. The highest number of SNPs was reported in the Tri14 gene (Supplementary Figure S1). This gene might be required for high virulence of F. graminearum and seems to regulate trichothecene biosynthesis in planta [70]. Even though all SNPs were synonymous, this adaptation might provide better competitiveness in a new environment. The latest evidence from comparative and experimental studies indicates that synonymous mutations may not be selectively neutral [71,72,73,74,75,76]. The revealed geographic pattern of polymorphism highlights hallmarks of divergent evolutionary history of F. graminearum s.s. that reflects barriers in transcontinental introductions. However, we suggest that our finding has been validated with only relatively few strains/isolates, so confirmation is critical with more representative isolates in the future. As stated by Kelly and Ward [66], the localized gene flow or potential transcontinental introductions of novel genotypes into new locations could pose further challenges to FHB management, because selection drives the emergence of more pathogenic fungi. In this regard, international biosecurity regulatory mechanisms incorporating molecular data will be critical to minimize their spread.

4. Materials and Methods

4.1. Fusarium-Damaged Kernels (FDKs)

Kernels with visible FHB symptoms were manually sampled from different wheat fields located in 17 different locations (Figure 2). Additionally, one population of diseased barley kernels from Modzurów were also included. Kernels were plated on potato dextrose agar (PDA) in Petri dishes and incubated at room temperature in darkness. After 4–6 days of incubation, Fusarium-like colonies were transferred to new PDA plates for further analysis. Fusarium-like colonies were selected based on visual observation of fungal growth on PDA. Fusaria grow on PDA rapidly producing abundant, dense, white, and aerial mycelium. They can produce various pigments, with colors ranging from white, through pink, salmon-pink and carmine red, to purple [77].
For storage purposes, colonies were transferred to new PDA plates, and after six days of culturing, mycelia were covered with 1.5 g of sterile soil [78]. All plates were held at RT for 7–10 days until the soil was overgrown by mycelium. A total of 519 Fusarium isolates (463 from wheat kernels and 56 from barley kernels) were assigned with unique isolate codes and were stored at −25 °C in the fungal collection of the Department of Botany and Nature Protection, University of Warmia and Mazury in Olsztyn, Poland.

4.2. Preparation of Cell Lysates for qPCR

A patch of mycelium (approximately 0.1–0.2 mg) was scraped from the surface of the PDA plate and transferred to tubes with 1 mm silica spheres (Lysing matrix C, MP Biomedicals, Santa Ana, CA, USA). Samples were homogenized at 40 s at the speed 6.0 m/s in 1 mL of deionized water on a FastPrep-24 instrument (MP Biomedicals, Santa Ana, CA, USA). After homogenization, 40 µL of homogenate was subsequently diluted with 160 µL of water and incubated for 2 min at 90 °C. 2 µL of aqueous phase was used for qPCR.

4.3. Determination of Fungal Species and Tri Genotypes

Four species-specific TaqMan assays were used to identify all field isolates to the species level (Table 3). Trichothecene genotypes were determined using TaqMan assays targeting the Tri12 gene [43]. Each reaction was carried out in three replicates.

4.4. DNA Sequencing, Assembly, and Annotation of Tri Core Clusters

For next generation sequencing (NGS), DNA from 35 isolates/strains was extracted from 0.1 g of mycelium as previously described in Kulik et al. [82]. A patch of mycelium was scraped from the surface of the PDA plate and homogenized in tubes containing 1 mm silica spheres (Lysing matrix C, MP Biomedicals, Santa Ana, CA, USA) on a FastPrep-24 instrument (MP Biomedicals, Santa Ana, CA, USA). Total genomic DNA was extracted with the use of the Quick-DNA Plant/Seed Miniprep Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol.
Whole-genome sequencing was performed at Macrogen (Seoul, South Korea). Genome libraries were constructed using a TruSeq DNA PCR-free library preparation kit (Illumina, San Diego, CA, USA). An Illumina HiSeq X platform was used to sequence the genomes using a paired-end read length of 2 × 150 bp with an insert size of 350 bp. For assembling, de-multiplexed and trimmed reads were aligned to the complete sequence of the core Tri clusters deposited in the GenBank database under accession numbers: KU572424 (3ADON genotype) and KU572428 (15ADON genotype) [83]. Sequence reads were aligned with Geneious (v.6.1.6 created by Biomatters, Auckland, New Zealand, available from http://www.geneious.com), as previously described in Kulik et al. [82]. Annotations were performed using Geneious software based on sequence data deposited under accession numbers KU572424 and KU572428. Complete core Tri clusters have been deposited in the NCBI database under the GenBank accession numbers MH514924-MH514957. The identity of all 35 analyzed strains were confirmed using TEF1 gene (translation elongation factor). The sequences have been deposited in GeneBank under accession numbers MH572233-MH572267.

Supplementary Materials

The following are available online at https://www.mdpi.com/2072-6651/10/8/325/s1, Figure S1: Comparison of complete sequences of the Tri14 gene of F. graminearum s.s. 15ADON strains from geographically diverse origins. Sequences highlighted with grey indicate the Tri14 gene.

Author Contributions

Conceptualization, K.B. and T.K.; Formal analysis, K.B.; Funding acquisition, T.K.; Investigation, K.B., S.J., T.K., E.R., J.O., M.Ż. and P.Z.; Methodology, K.B., S.J. and T.K.; Project administration, K.B., S.J. and T.K.; Resources, T.K., E.R., J.O. and P.Z.; Supervision, T.K.; Validation, K.B. and T.K.; Visualization, K.B.; Writing—original draft, K.B. and T.K.; Writing—review & editing, E.R.

Funding

This research was funded by the National Science Center, Poland, grant number 2015/19/B/NZ9/01329.

Acknowledgments

We are extremely grateful to Marco Beyer (Luxembourg Institute of Science and Technology, Department Environmental Research and Innovation), Matias Pasquali (Department of Food, Environmental and Nutritional Sciences, University of Milan), Alexander Stakheev (M.M. Shemyakin and Yu.A. Ovchinnikov Institute of Bioorganic chemistry of the Russian Academy of Sciences), and Sebastian Stenglein (Laboratorio de Biología Funcional y Biotecnología (BIOLAB)-CICBA-INBIOTEC, CONICET; Cátedra de Microbiología-Facultad de Agronomía de Azul-UNCPBA) for providing fungal strains for NGS.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; and in the decision to publish the results.

References

  1. Figueroa, M.; Hammond-Kosack, K.E.; Solomon, P.S. A review of wheat diseases—A field perspective. Mol. Plant Pathol. 2018, 19, 1523–1536. [Google Scholar] [CrossRef] [PubMed]
  2. McMullen, M.; Jones, R.; Gallenberg, D. Scab of Wheat and Barley: A Re-emerging Disease of Devastating Impact. Plant Dis. 1997, 81, 1340–1348. [Google Scholar] [CrossRef]
  3. Doohan, F.M.; Brennan, J.M.; Cooke, B.M. Influence of climatic factors on Fusarium species pathogenic to cereals. Eur. J. Plant Pathol. 2003, 109, 755–768. [Google Scholar] [CrossRef]
  4. Wegulo, S.N.; Baenziger, P.S.; Hernandez Nopsa, J.; Bockus, W.; Hallen-Adams, H. Management of Fusarium head blight of wheat and barley. Crop Prot. 2015, 73, 100–107. [Google Scholar] [CrossRef]
  5. Desjardins, A.E. Fusarium Mycotoxins Chemistry, Genetics and Biology; American Phytopathological Society Press: St. Paul, MN, USA, 2006. [Google Scholar]
  6. Basler, R. Diversity of Fusarium species isolated from UK forage maize and the population structure of F. graminearum from maize and wheat. PeerJ 2016, 4, e2143. [Google Scholar] [CrossRef] [PubMed][Green Version]
  7. Klix, M.B.; Verreet, J.A.; Beyer, M. Comparison of the declining triazole sensitivity of Gibberella zeae and increased sensitivity achieved by advances in triazole fungicide development. Crop Prot. 2007, 26, 683–690. [Google Scholar] [CrossRef]
  8. Yin, Y.; Liu, X.; Li, B.; Ma, Z. Characterization of sterol demethylation inhibitor-resistant isolates of Fusarium asiaticum and F. graminearum collected from wheat in China. Phytopathology 2009, 99, 487–497. [Google Scholar] [CrossRef] [PubMed]
  9. Becher, R.; Hettwer, U.; Karlovsky, P.; Deising, H.B.; Wirsel, S.G.R. Adaptation of Fusarium graminearum to tebuconazole yielded descendants diverging for levels of fitness, fungicide resistance, virulence, and mycotoxin production. Phytopathology 2010, 100, 444–453. [Google Scholar] [CrossRef] [PubMed]
  10. Steiner, B.; Buerstmayr, M.; Michel, S.; Schweiger, W.; Lemmens, M.; Buerstmayr, H. Breeding strategies and advances in line selection for Fusarium head blight resistance in wheat. Trop. Plant Pathol. 2017, 42, 165–174. [Google Scholar] [CrossRef]
  11. Taylor, J.W.; Jacobson, D.J.; Kroken, S.; Kasuga, T.; Geiser, D.M.; Hibett, D.S.; Fisher, M.C. Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 2000, 31, 21–32. [Google Scholar] [CrossRef] [PubMed]
  12. O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Corby Kistler, H.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef] [PubMed]
  13. Starkey, D.E.; Ward, T.J.; Aoki, T.; Gale, L.R.; Kistler, H.C.; Geiser, D.M.; Suga, H.; Tóth, B.; Varga, J.; O’Donnell, K. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 2007, 44, 1191–1204. [Google Scholar] [CrossRef] [PubMed]
  14. Sarver, B.A.; Ward, T.J.; Gale, L.R.; Broz, K.; Kistler, H.C.; Aoki, T. Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genet. Biol. 2011, 48, 1096–1107. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, H.; Van der Lee, T.; Waalwijk, C.; Chen, W.; Xu, J.; Xu, J.; Zhang, Y.; Feng, J. Population analysis of the Fusarium graminearum species complex from wheat in China show a shift to more aggressive isolates. PLoS ONE 2012, 7, e31722. [Google Scholar] [CrossRef] [PubMed]
  16. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [PubMed]
  17. Scoz, L.B.; Astolfi, P.; Reartes, D.S.; Schmale III, D.G.; Moraes, M.G.; Del Ponte, E.M. Trichothecene mycotoxin genotypes of Fusarium graminearum sensu stricto and Fusarium meridionale in wheat from southern Brazil. Plant Pathol. 2009, 58, 344–351. [Google Scholar] [CrossRef]
  18. Reynoso, M.M.; Ramirez, M.L.; Torres, A.M.; Chulze, S.N. Trichothecene genotypes and chemotypes in Fusarium graminearum strains isolated from wheat in Argentina. Int. J. Food Microbiol. 2011, 145, 444–448. [Google Scholar] [CrossRef] [PubMed]
  19. Castañares, E.; Albuquerque, D.R.; Dinolfo, M.I.; Pinto, V.F.; Patriarca, A.; Stenglein, S.A. Trichothecene genotypes and production profiles of Fusarium graminearum isolates obtained from barley cultivated in Argentina. Int. J. Food Microbiol. 2014, 179, 57–63. [Google Scholar] [CrossRef] [PubMed]
  20. Suga, H.; Karugia, G.W.; Ward, T.J.; Gale, L.R.; Tomimura, K.; Nakajima, T.; Miyasaka, A.; Koizumi, S.; Kageyama, K.; Hyakumachi, M. Molecular characterization of the Fusarium graminearum species complex in Japan. Phytopathology 2008, 98, 159–166. [Google Scholar] [CrossRef] [PubMed]
  21. Yang, L.; van der Lee, T.; Yang, X.; Yu, D.; Waalwijk, C. Fusarium populations on Chinese barley show a dramatic gradient in mycotoxin profiles. Phytopathology 2008, 98, 719–727. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, H.; Zhang, Z.; van der Lee, T.; Chen, W.Q.; Xu, J.; Xu, J.S.; Yang, L.; Yu, D.; Waalwijk, C.; Feng, J. Population genetic analyses of Fusarium asiaticum populations from barley suggest a recent shift favoring 3ADON producers in southern China. Phytopathology 2010, 100, 328–336. [Google Scholar] [CrossRef] [PubMed]
  23. Van der Lee, T.; Zhang, H.; van Diepeningen, A.; Waalwijk, C. Biogeography of Fusarium graminearum species complex and chemotypes: A review. Food Addit. Contam. Part A 2015, 32, 453–460. [Google Scholar] [CrossRef] [PubMed]
  24. Scherm, B.; Balmas, V.; Spanu, F.; Pani, G.; Delogu, G.; Pasquali, M.; Migheli, Q.L. Fusarium culmorum: Causal agent of foot and root rot and head blight on wheat. Mol. Plant Pathol. 2013, 14, 323–341. [Google Scholar] [CrossRef] [PubMed]
  25. Wakuliński, W.; Chełkowski, J. Fusarium species transmitted with seeds of wheat, rye, barley, oats and triticale. Hodowla Roślin Aklimatyzacja Nasiennictwo 1993, 37, 131–136. [Google Scholar]
  26. Chełkowski, J. Distribution of Fusarium species and their mycotoxins in cereal grains. In Mycotoxins in Agriculture and Food Safety; Sinha, K.K., Bhatnagar, D., Eds.; Marcel Dekker, Inc.: New York, NY, USA, 1998; pp. 45–64. [Google Scholar]
  27. Tomczak, M.; Wiśniewska, H.; Stcępień, Ł.; Kostecki, M.; Chełkowski, J.; Goliński, P. Deoxynivalenol, nivalenol and moniliformin in wheat samples with head blight (scab) symptoms in Poland (1998–2000). Eur. J. Plant Pathol. 2002, 108, 625–630. [Google Scholar] [CrossRef]
  28. Stępień, Ł.; Popiel, D.; Koczyk, G.; Chełkowski, J. Wheat-infecting Fusarium species in Poland-their chemotypes and frequencies revealed by PCR assay. J. Appl. Genet. 2008, 49, 433–441. [Google Scholar] [CrossRef] [PubMed]
  29. Wiśniewska, H.; Stępień, Ł.; Waśkiewicz, A.; Beszterda, M.; Góral, T.; Belter, J. Toxigenic Fusarium species infecting wheat heads in Poland. Cent. Eur. J. Biol. 2014, 9, 163–172. [Google Scholar] [CrossRef]
  30. Kuzdraliński, A.; Nowak, M.; Szczerba, H.; Dudziak, K.; Muszyńska, M.; Leśniowska-Nowak, J. The composition of Fusarium species in wheat husks and grains in south-eastern Poland. J. Integr. Agric. 2017, 16, 1530–1536. [Google Scholar] [CrossRef]
  31. Waalwijk, C.; Kastelein, P.; De Vries, I.; Kerényi, Z.; Van Der Lee, T.; Hesselink, T.; Köhl, J.; Kema, G. Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 2003, 109, 743–754. [Google Scholar] [CrossRef]
  32. Giraud, F.; Pasquali, M.; Jarroudi, M.; Vrancken, C.; Brochot, C.; Cocco, E.; Hoffmann, L.; Delfosse, P.; Bohn, T. Fusarium head blight and associated mycotoxin occurrence on winter wheat in Luxembourg in 2007/2008. Food Addit. Contam. Part A 2010, 27, 825–835. [Google Scholar] [CrossRef] [PubMed]
  33. Chełkowski, J.; Gromadzka, K.; Stępień, Ł.; Lenc, L.; Kostecki, M.; Berthiller, F. Fusarium species, zearalenone and deoxynivalenol content in preharvest scabby wheat heads from Poland. World Mycotoxin J. 2012, 5, 133–141. [Google Scholar] [CrossRef]
  34. Ward, T.J.; Bielawski, J.P.; Kistler, H.C.; Sullivan, E.; O’Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proc. Natl. Acad. Sci. USA 2002, 99, 9278–9283. [Google Scholar] [CrossRef] [PubMed]
  35. Pasquali, M.; Giraud, F.; Brochot, C.; Cocco, E.; Hoffmann, L.; Bohn, T. Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat. Int. J. Food Microbiol. 2010, 137, 246–253. [Google Scholar] [CrossRef] [PubMed]
  36. De Kuppler, A.M.; Steiner, U.; Sulyok, M.; Krska, R.; Oerke, E.C. Genotyping and phenotyping of Fusarium graminearum isolates from Germany related to their mycotoxin biosynthesis. Int. J. Food. Microbiol. 2011, 151, 78–86. [Google Scholar] [CrossRef] [PubMed]
  37. Puri, K.D.; Zhong, S. The 3ADON population of Fusarium graminearum found in North Dakota is more aggressive and produces a higher level of DON than the prevalent 15ADON population in spring wheat. Phytopathology 2010, 100, 1007–1014. [Google Scholar] [CrossRef] [PubMed]
  38. Malihipour, A.; Gilbert, J.; Piercey-Normore, M.; Cloutier, S. Molecular phylogenetic analysis, trichothecene chemotype patterns, and variation in aggressiveness of Fusarium isolates causing head blight in wheat. Plant Dis. 2012, 96, 1016–1025. [Google Scholar] [CrossRef]
  39. Amarasinghe, C.C.; Tamburic-Ilincic, L.; Gilbert, J.; Brûlé-Babel, A.L.; Fernando, W.G.D. Evaluation of different fungicides for control of Fusarium head blight in wheat inoculated with 3ADON and 15ADON chemotypes of Fusarium graminearum in Canada. Can. J. Plant Pathol. 2013, 35, 200–208. [Google Scholar] [CrossRef]
  40. Gilbert, J.; Clear, R.M.; Ward, T.J.; Gaba, D.; Tekauz, A.; Turkington, T.K.; Woods, S.M.; Nowicki, T.; O’Donnell, K. Relative aggressiveness and production of 3- or 15-acetyl deoxynivalenol and deoxynivalenol by Fusarium graminearum in spring wheat. Can. J. Plant Pathol. 2010, 32, 146–152. [Google Scholar] [CrossRef]
  41. Von der Ohe, C.; Gauthier, V.; Tamburic-Ilincic, L.; Brule-Babel, A.; Fernando, W.G.D.; Clear, R.; Ward, T.J.; Miedaner, T. A comparison of aggressiveness and deoxynivalenol production between Canadian Fusarium graminearum isolates with 3-acetyl and 15-acetyldeoxynivalenol chemotypes in field-grown spring wheat. Eur. J. Plant Pathol. 2010, 127, 407–417. [Google Scholar] [CrossRef]
  42. Quarta, A.; Mita, G.; Haidukowski, M.; Santino, A.; Mulè, G.; Visconti, A. Assessment of trichothecene chemotypes of Fusarium culmorum occurring in Europe. Food Addit. Contam. 2005, 22, 309–315. [Google Scholar] [CrossRef] [PubMed]
  43. Kulik, T. Development of TaqMan Assays for 3ADON, 15ADON and NIV Fusarium Genotypes Based on Tri12 Gene. Cereal Res. Commun. 2011, 39, 201–215. [Google Scholar] [CrossRef]
  44. Nielsen, L.K.; Jensen, J.D.; Rodríguez, A.; Jørgensen, L.N.; Justesen, A.F. TRI12 based quantitative real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. Int. J. Food. Microbiol. 2012, 157, 384–392. [Google Scholar] [CrossRef] [PubMed]
  45. Balmas, V.; Scherm, B.; Marcello, A.; Beyer, M.; Hoffmann, L.; Migheli, Q.; Pasquali, M. Fusarium species and chemotypes associated with Fusarium head blight and Fusarium root rot on wheat in Sardinia. Plant Pathol. 2015, 64, 972–979. [Google Scholar] [CrossRef]
  46. Burlakoti, R.R.; Neate, S.M.; Adhikari, T.B.; Gyawali, S.; Salas, B.; Steffenson, B.J.; Schwarz, P.B. Trichothecene profiling and population genetic analysis of Gibberella zeae from barley in North Dakota and Minnesota. Phytopathology 2011, 101, 687–695. [Google Scholar] [CrossRef] [PubMed]
  47. Beyer, M.; Pogoda, F.; Pallez, M.; Lazic, J.; Hoffmann, L.; Pasquali, M. Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads. Int. J. Food Microbiol. 2014, 182, 51–56. [Google Scholar] [CrossRef] [PubMed]
  48. Waalwijk, C.; de Vries, I.M.; Köhl, J.; Xu, X.; van der Lee, T.A.J.; Kema, G.H.J. Development of quantitative detection methods for Fusarium in cereals and their application. In Mycotoxins: Detection Methods, Management, Public Health and Agricultural Trade; Leslie, J., Bandyopadhyay, R., Visconti, A., Eds.; CABI Publishing: Wallingford, UK, 2008; pp. 197–207. [Google Scholar]
  49. Boutigny, A.L.; Ward, T.J.; Ballois, N.; Iancu, G.; Ioos, R. Diversity of the Fusarium graminearum species complex on French cereals. Eur. J. Plant Pathol. 2014, 138, 133–148. [Google Scholar] [CrossRef]
  50. Talas, F.; Parzies, H.K.; Miedaner, T. Diversity in genetic structure and chemotype composition of Fusarium graminearum sensu stricto populations causing wheat head blight in individual fields in Germany. Eur. J. Plant Pathol. 2011, 1, 39–48. [Google Scholar] [CrossRef]
  51. Prodi, A.; Purahong, W.; Tonti, S.; Salomoni, D.; Nipoti, P.; Covarelli, L.; Pisi, A. Difference in chemotype composition of Fusarium graminearum populations isolated from durum wheat in adjacent areas separated by the Apennines in Northern-Central Italy. Plant Pathol. J. 2011, 27, 354–359. [Google Scholar] [CrossRef]
  52. Prodi, A.; Tonti, S.; Nipoti, P.; Pancaldi, D.; Pisi, A. Identification of deoxynivalenol and nivalenol producing chemotypes of Fusarium graminearum isolates from durum wheat in a restricted area of northern Italy. J. Plant Pathol. 2009, 91, 727–731. [Google Scholar] [CrossRef]
  53. Somma, S.; Petruzzella, A.L.; Logrieco, A.F.; Meca, G.; Cacciola, O.S.; Moretti, A. Phylogenetic analyses of Fusarium graminearum strains from cereals in Italy, and characterisation of their molecular and chemical chemotypes. Crop Past. Sci. 2014, 65, 52–60. [Google Scholar] [CrossRef]
  54. Yli-Mattila, T.; Gagkaeva, T.; Ward, T.J.; Aoki, T.; Kistler, H.C.; O’Donnell, K. A novel Asian clade within the Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Russian Far East. Mycologia 2009, 101, 841–852. [Google Scholar] [CrossRef] [PubMed]
  55. Llorens, A.; Hinojo, M.J.; Mateo, R.; González-Jaén, M.T.; Valle-Algarra, F.M.; Logrieco, A.; Jiménez, M. Characterization of Fusarium spp. isolates by PCR-RFLP analysis of the intergenic spacer region of the rRNA gene (rDNA). Int. J. Food Microbiol. 2006, 106, 297–306. [Google Scholar] [CrossRef] [PubMed]
  56. Isebaert, S.; De Sager, S.; Devreese, R.; Verhoeven, R.; Maene, P.; Heremans, B.; Haesaert, G. Mycotoxin-producing Fusarium species occurring in winter wheat in Belgium (Flanders) during 2002–2005. J. Phytopathology 2009, 157, 108–116. [Google Scholar] [CrossRef]
  57. Champeil, A.; Doré, T.; Fourbet, J.F. Fusarium head blight: Epidemiological origin of the effects of cultural practices on head blight attacks and the production of mycotoxins by Fusarium in wheat grains. Plant Sci. 2004, 166, 1389–1415. [Google Scholar] [CrossRef]
  58. Wang, Y.Z. Epidemiology and management of wheat scab in China. In Fusarium Head Scab: Global Status and Future Prospects; Dubin, H.J., Gilchrist, L., Reeves, J., McNab, A., Eds.; CIMMYT: EI Batan, Mexico, 1997; pp. 97–105. [Google Scholar]
  59. Manstretta, V.; Rossi, V. Effects of weather variables on ascospore discharge from Fusarium graminearum perithecia. PLoS ONE 2015, 10, e0138860. [Google Scholar] [CrossRef] [PubMed]
  60. Liu, Y.Y.; Sun, H.Y.; Li, W.; Xia, Y.L.; Deng, Y.Y.; Zhang, A.X.; Chen, H.G. Fitness of three chemotypes of Fusarium graminearum species complex in major winter wheat-producing areas of China. PLoS ONE 2017, 12, e0174040. [Google Scholar] [CrossRef] [PubMed]
  61. Pancaldi, D.; Tonti, S.; Prodi, A.; Salomoni, D.; Dal Pra’, M.; Nipoti, P.; Alberti, I.; Pisi, A. Survey of the main causal agents of Fusarium head blight of durum wheat around Bologna, northern Italy. Phytopathol. Mediterr. 2010, 49, 258–266. [Google Scholar] [CrossRef]
  62. Parikka, P.; Hakala, K.; Tiilikkala, K. Expected shifts in Fusarium species’ composition on cereal grain in Northern Europe due to climatic change. Food Addit. Contam. Part A 2012, 29, 1543–1555. [Google Scholar] [CrossRef] [PubMed]
  63. Gilbert, J.; Haber, S. Overview of some recent research developments in Fusarium head blight of wheat. Can. J. Plant Pathol. 2013, 35, 149–174. [Google Scholar] [CrossRef]
  64. Owczarek, M.; Filipiak, J. Contemporary changes of thermal conditions in Poland, 1951–2015. Bull. Geogr. Phys. Geogr. Ser. 2016, 10, 31–50. [Google Scholar] [CrossRef]
  65. World Meteorological Organization. WMO Statement on the state of the global climate in 2017; WMO-No. 1212; World Meteorological Organization: Geneva, Switzerland, 2018. [Google Scholar]
  66. Kelly, A.C.; Ward, T.J. Population genomics of Fusarium graminearum reveals signatures of divergent evolution within a major cereal pathogen. PLoS ONE 2018, 13, e0194616. [Google Scholar] [CrossRef] [PubMed]
  67. Pasquali, M.; Beyer, M.; Logrieco, A.; Audenaert, K.; Balmas, V.; Basler, R.; Boutigny, A.-L.; Chrpová, J.; Czembor, E.; Gagkaeva, T.; et al. A European Database of Fusarium graminearum and F. culmorum Trichothecene Genotypes. Front. Microbiol. 2016, 7, 406. [Google Scholar] [CrossRef] [PubMed]
  68. Gale, L.R.; Harrison, S.A.; Ward, T.J.; O’Donnell, K.; Milus, E.A.; Gale, S.W.; Kistler, H.C. Nivalenol-type populations of Fusarium graminearum and F. asiaticum are prevalent on wheat in southern Louisiana. Phytopathology 2011, 101, 124–134. [Google Scholar] [CrossRef] [PubMed]
  69. Gomes, L.B.; Ward, T.J.; Badiale-Furlong, E.; Del Ponte, E.M. Species composition, toxigenic potential and pathogenicity of Fusarium graminearum species complex isolates from southern Brazilian rice. Plant Pathol. 2015, 64, 980–987. [Google Scholar] [CrossRef]
  70. Dyer, R.B.; Plattner, R.D.; Kendra, D.F.; Brown, D.W. Fusarium graminearum TRI14 is required for high virulence and DON production on wheat but not for DON synthesis in vitro. J. Agric. Food Chem. 2005, 53, 9281–9287. [Google Scholar] [CrossRef] [PubMed]
  71. Chamary, J.; Hurst, L.D. Evidence for selection on synonymous mutations affecting stability of mRNA secondary structure in mammals. Genome Biol. 2005, 6, R75. [Google Scholar] [CrossRef] [PubMed]
  72. Plotkin, J.B.; Kudla, G. Synonymous but not the same: The causes and consequences of codon bias. Nat. Rev. Genet. 2011, 12, 32–42. [Google Scholar] [CrossRef] [PubMed]
  73. Cuevas, J.M.; Domingo-Calap, P.; Sanjuán, R. The fitness effects of synonymous mutations in DNA and RNA viruses. Mol. Biol. Evol. 2012, 29, 17–20. [Google Scholar] [CrossRef] [PubMed]
  74. Agashe, D.; Martinez-Gomez, N.C.; Drummond, D.A.; Marx, C.J. Good codons, bad transcript: Large reductions in gene expression and fitness arising from synonymous mutations in a key enzyme. Mol. Biol. Evol. 2013, 30, 549–560. [Google Scholar] [CrossRef] [PubMed]
  75. Bailey, S.F.; Hinz, A.; Kassen, R. Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population. Nat. Commun. 2014, 5, 4076. [Google Scholar] [CrossRef] [PubMed]
  76. Agashe, D.; Sane, M.; Phalnikar, K.; Diwan, G.D.; Habibullah, A.; Martinez-Gomez, N.C.; Sahasrabuddhe, V.; Polachek, W.; Wang, J.; Chubiz, L.M.; et al. Large effect beneficial synonymous mutations mediate rapid and parallel adaptation in a bacterium. Mol. Biol. Evol. 2016, 33, 1542–1553. [Google Scholar] [CrossRef] [PubMed]
  77. Bullerman, L.B. Mycotoxins Classifications. In Encyclopedia of Food Sciences and Nutrition, 2nd ed.; Caballero, B., Ed.; Academic Press: Cambridge, UK, 2003; pp. 4080–4089. [Google Scholar]
  78. Smith, D.; Onions, A.H.S. The Preservation and Maintenance of Living Fungi; IMI Technical Handbook No.2; International Mycological Institute, CAB International: Oxford, UK, 1994. [Google Scholar]
  79. Bilska, K.; Kulik, T.; Ostrowska-Kołodziejczak, A.; Buśko, M.; Pasquali, M.; Beyer, M.; Baturo-Cieśniewska, A.; Juda, M.; Załuski, D.; Treder, K.; et al. Development of a highly sensitive FcMito qPCR assay for the quantification of the toxigenic fungal plant pathogen Fusarium culmorum. Toxins 2018, 10, 211. [Google Scholar] [CrossRef] [PubMed]
  80. Kulik, T.; Ostrowska, A.; Buśko, M.; Pasquali, M.; Beyer, M.; Stenglein, S.; Załuski, D.; Sawicki, J.; Treder, K.; Perkowski, J. Development of an FgMito assay: A highly sensitive mitochondrial based qPCR assay for quantification of Fusarium graminearum sensu stricto. Int. J. Food Microbiol. 2015, 210, 16–23. [Google Scholar] [CrossRef] [PubMed]
  81. Waalwijk, C.; van der Heide, R.; de Vries, I.; van der Lee, T.; Schoen, C.; Corainville, G.C.; Häuser-Hahn, I.; Kastelein, P.; Köhl, J.; Lonnet, P.; et al. Quantitative detection of Fusarium species in wheat using TaqMan. Eur. J. Plant Pathol. 2004, 110, 481–494. [Google Scholar] [CrossRef]
  82. Kulik, T.; Buśko, M.; Bilska, K.; Ostrowska-Kołodziejczak, A.; van Diepeningen, A.D.; Perkowski, J.; Stenglein, S. Depicting the discrepancy between tri genotype and chemotype on the basis of strain CBS 139514 from a field population of F. graminearum sensu stricto from Argentina. Toxins 2016, 8, 330. [Google Scholar] [CrossRef] [PubMed]
  83. Kulik, T.; Abarenkov, K.; Buśko, M.; Bilska, K.; van Diepeningen, A.D.; Ostrowska-Kołodziejczak, A.; Krawczyk, K.; Brankovics, B.; Stenglein, S.; Sawicki, J.; Perkowski, J. ToxGen: An improved reference database for the identification of type B-trichothecene genotypes in Fusarium. PeerJ 2017, 5, e2992. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Fusarium head blight of wheat. (A) symptomatic heads. (B) Fusarium-damaged kernels.
Figure 1. Fusarium head blight of wheat. (A) symptomatic heads. (B) Fusarium-damaged kernels.
Toxins 10 00325 g001
Figure 2. Locations of fields from which Fusarium-damaged kernels (FDKs) were collected for analyses.
Figure 2. Locations of fields from which Fusarium-damaged kernels (FDKs) were collected for analyses.
Toxins 10 00325 g002
Table 1. TaqMan-based identification of the Fusarium species and their chemotypes in wheat and barley kernels in Poland.
Table 1. TaqMan-based identification of the Fusarium species and their chemotypes in wheat and barley kernels in Poland.
YearLocalizationNumber of IsolatesF. graminearum s.s.F. culmorumF. avenaceumF. poae
Total15ADON3ADONTotal3ADON
Wheat kernels
2016Dobre Miasto2221 (95.45%)15 (71.43%)6 (28.57%)001 (4.55%)0
Łajsy8585 (100%)75 (88.24%10 (11.76%)0000
Tomaszkowo5754 (94.74%)45 (83.33%)9 (16.67%)1 (1.75%)1 (100%)2 (3.51%)0
Tywęzy55 (100%)5 (100)00000
Nidzica2017 (85%)15 (88.24%)2 (11.76%)003 (15%)0
Kobierzyce76 (85.71%)6 (100%)0001 (14.29)0
Kondratowice1110 (90.91%)10 (100%)00001 (9.09%)
Modzurów5944 (74.58%)37 (84.09%)7 (15.91%)8 (13.56%)8 (100%)7 (11.86%)0
Total in 2016266242 (90.98%)208 (85.95%)34 (14.05%)9 (3.38%)9 (100%)14 (5.26%)1 (0.38%)
2017Zduny119 (81.82%)8 (88.89%)1 (11.11%)002 (18.18%)0
Tczew County2626 (100%)25 (96.15%)1 (3.85%)0000
Malbork66 (100%)6 (100%)00000
Bałcyny85 (62.50%)5 (100%)0003 (37.50%)0
Kętrzyn County116 (54.55%)5 (83.33%)1 (16.67%)005 (45.45%)0
Ostrołęka County7635 (46.05%)31 (88.57%)4 (11.43%)7 (9.21%)7 (100%)34 (44.74%)0
Romaszówka159 (60.00%)7 (77.78%)2 (22.22%)2 (13.33%)2 (100%)4 (26.67%)0
Lipno County3332 (96.97%)32 (100%)0001 (3.03%)0
Warsaw West County116 (54.55%)6 (100%)0005 (45.45%)0
Total in 2017197134 (68.02%)125 (93.28%)9 (6.72%)9 (4.75)9 (100%)54 (27.41%)0
Total wheat kernels463376 (81.21%)333 (88.56%)43 (11.44%)18 (3.89%)18 (100%)68 (14.69%)1 (0.22%)
Barley kernels from Modzurów569 (16.07%)9 (100%)00045 (80.36%)2 (3.57%)
Table 2. List of F. graminearum s.s. 15ADON strains used for comparison of complete core Tri clusters.
Table 2. List of F. graminearum s.s. 15ADON strains used for comparison of complete core Tri clusters.
StrainOriginHostYear of IsolationCulture Collection
16-21-zPoland, Dobre Miastowinter wheat20161
16-92-zPoland, Modzurówwinter wheat20161
16-43-tpPoland, Tomaszkowowinter wheat20161
16-462-zPoland, Modzurówwinter wheat20161
03132Poland, Lewin Brzeskiwinter wheat20031
04286Poland, Bałcynywinter wheat20041
04501Poland, Martągwinter wheat20041
CBS 138561Polandwheat20104
37Germanyunknown19942
74bGermanyunknown20042
N2-1Germany, Uelzenwinter wheat20171
N4-1Germany, Uelzenwinter wheat20171
N4-2Germany, Uelzenwinter wheat20171
N5-1Germany, Uelzenwinter wheat20171
N6-1Germany, Uelzenwinter wheat20171
N6-2Germany, Uelzenwinter wheat20171
N7-1Germany, Uelzenwinter wheat20171
N8-2Germany, Uelzenwinter wheat20171
N10-1Germany, Uelzenwinter wheat20171
N10-2Germany, Uelzenwinter wheat20171
237Luxembourgwinter wheat20072
321Luxembourgwinter wheat20072
630Luxembourgwinter wheat20072
09-03aLuxembourgwinter wheat20092
09-04aLuxembourgwinter wheat20092
09-5aLuxembourgwinter wheat20092
09-13aLuxembourgwinter wheat20092
09-21aLuxembourgwinter wheat20092
09-53bLuxembourgwinter wheat20092
St-6Russia, Stavropol regionwinter wheat20153
St-9Russia, Stavropol regionwinter wheat20143
Kr 275-1Russia, Krasnodar regionwinter wheat20143
433-2Russia, Kabardino-Balkariawinter wheat20143
CBS 134070USA, Illinois, UrbanaMiscanthus giganteusunknown4
GZ3639, CBS 110266USA, Kansaswheatunknown4
CBS 139513Argentina, Tandilbarley20114
CBS 139514Argentina, Tapalquébarley20104
114-2Argentina, Loberiabarley20121
23-4Argentina, Lauquenbarley20111
1—Fungal Culture Collection of the Department of Botany and Nature Protection of the University of Warmia and Mazury in Olsztyn, Poland; 2—Fungal Culture Collection of the Department of Environmental Research and Innovation of the Luxembourg Institute of Science and Technology, Luxembourg; 3—All-Russian Institute of Phytopathology, Russia; 4—Westerdijk Fungal Biodiversity Institute, The Netherlands.
Table 3. List of TaqMan assays used to determine species and trichothecene genotypes.
Table 3. List of TaqMan assays used to determine species and trichothecene genotypes.
Primer/Probe SequenceReaction ReagentsReaction ConditionReferences
Species
F. culmorumF: TCGTTGACGGTGAGGGTTGT
R: GACTCGAACACGTCAACCAACTT
Probe: FAM-CGGTTATTATTTCGAAAAGT- MGB
2 μL gDNA, 14.3 μL H2O, 6.7 μM of each primer, 1.7 μM of probe, 3.6 μL TaqMan Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA).95 °C for 20 s, (95 °C for 1 s, 60 °C for 30 s) × 40[79]
F. graminearum s.s.F: TGGCCTGAATGAAGGATTTCTAG
R: CATCGTTGTTAACTTATTGGAGATG
Probe: FAM-TTAAACACTCAAACACTACA- MGB
[80]
F. avenaceumF: CCATCGCCGTGGCTTTC
R: CAAGCCCACAGACACGTTGT
Probe: FAM-ACGCAATTGACTATTGC-MGB
2 μL gDNA, 10.8 μL H2O, 6.7 μM of each primer, 1.7 μM of probe, 7.2 μL TaqMan Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA).95 °C for 20 s, (95 °C for 1 s, 60 °C for 50 s) × 40[81]
F. poaeF: AAATCGGCGTATAGGGTTGAGATA
R: GCTCACACAGAGTAACCGAAACCT
Probe: FAM-CAAAATCACCCAACCGACCCTTTC-TAMRA
50 °C for 2 min, 95 °C for 10 min, (95 °C for 15 s, 60 °C for 60 s) × 40
Tri genotype
3ADONF: CATGCGGGACTTTGATCGAT
R: TTTGTCCGCTTTCTTTCTATCATAAA
Probe: FAM-CTCACCGATCATGTTC-MGB
2 μL gDNA, 10.8 μL H2O, 6.7 μM of each primer, 1.7 μM of probe, 7.2 μL TaqMan Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA).95 °C for 20 s, (95 °C for 1 s, 60 °C for 50 s) × 40[43]
15ADONF: TCCAATCATTGCCAGCCTCTA
R: TGATGCGGAACATGGTCTGT
Probe: FAM-ATGAGGGACTTTGACCAAT-MGB
NIVF: TCGCCAGTCTCTGCATGAAG
R: CCTTATCCGCTTTCTTTCTATCATAAA
Probe: FAM-CTGATCATGTCCCGCATC-MGB

Share and Cite

MDPI and ACS Style

Bilska, K.; Jurczak, S.; Kulik, T.; Ropelewska, E.; Olszewski, J.; Żelechowski, M.; Zapotoczny, P. Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland. Toxins 2018, 10, 325. https://doi.org/10.3390/toxins10080325

AMA Style

Bilska K, Jurczak S, Kulik T, Ropelewska E, Olszewski J, Żelechowski M, Zapotoczny P. Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland. Toxins. 2018; 10(8):325. https://doi.org/10.3390/toxins10080325

Chicago/Turabian Style

Bilska, Katarzyna, Sebastian Jurczak, Tomasz Kulik, Ewa Ropelewska, Jacek Olszewski, Maciej Żelechowski, and Piotr Zapotoczny. 2018. "Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland" Toxins 10, no. 8: 325. https://doi.org/10.3390/toxins10080325

APA Style

Bilska, K., Jurczak, S., Kulik, T., Ropelewska, E., Olszewski, J., Żelechowski, M., & Zapotoczny, P. (2018). Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland. Toxins, 10(8), 325. https://doi.org/10.3390/toxins10080325

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop