Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Drought Stress Experiment
2.2. Data Collection
2.3. Collection of Leaf Samples for Molecular Analyses
2.4. Total RNA Isolation and cDNA Synthesis
2.5. Quantitative Real-Time PCR Analysis
2.6. Statistical Analyses
2.6.1. Greenhouse Data Analysis
2.6.2. Gene Expression Data Analysis
3. Results and Discussion
3.1. Analysis of Variance (ANOVA) of Morpho-Physiological Data
3.2. Impacts of Drought Stress on the Leaf Chlorophyll Content and Overall Plant Performance
3.3. Effect of Drought Stress on the Expression Levels of Selected Drought-Responsive Genes
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Budak, H.; Kantar, M.; Kurtoglu, K.Y. Drought Tolerance in Modern and Wild Wheat. Sci. World J. 2013, 2013, 548246. [Google Scholar] [CrossRef] [PubMed]
- Pruthvi, V.; Rama, N.; Govind, G.; Nataraja, K.N. Expression analysis of drought stress specific genes in Peanut (Arachis hypogaea, L.). Physiol. Mol. Biol. Plants 2013, 19, 277–281. [Google Scholar] [CrossRef]
- Carvalho, M.; Castro, I.; Moutinho-Pereira, J.; Correia, C.; Egea-Cortines, M.; Matos, M.; Rosa, E.; Carnide, V.; Lino-Neto, T. “Evaluating stress responses in cowpea under drought stress. J. Plant Physiol. 2019, 241, 153001. [Google Scholar] [CrossRef]
- Dadson, R.B.; Hashem, F.M.; Javaid, I.; Joshi, J.; Allen, A.L.; Devine, T.E. Effect of Water Stress on the Yield of Cowpea (Vigna unguiculata L. Walp.) Genotypes in the Delmarva Region of the United States. J Agron. Crop Sci. 2005, 191, 210–217. [Google Scholar] [CrossRef]
- Liang, G.; Liu, J.; Zhang, J.; Guo, J. Effects of drought stress on photosynthetic and physiological parameters of tomato. J. Am. Soc. Hortic. Sci. 2020, 145, 12–17. [Google Scholar] [CrossRef]
- Ahmed, K.; Shabbir, G.; Ahmed, M.; Noor, S.; Mohi Ud Din, A.; Qamar, M.; Rehman, N. Expression profiling of TaARGOS homoeologous drought responsive genes in bread wheat. Sci. Rep. 2022, 12, 3595. [Google Scholar] [CrossRef]
- Fang, Y.; Xiong, L. General mechanisms of drought response and their application in drought resistance improvement in plants. Cell. Mol. Life Sci. 2015, 72, 673–689. [Google Scholar] [CrossRef]
- Melloul, M.; Iraqi, D.; El Alaoui, M.; Erba, G.; Alaoui, S.; Ibriz, M.; Elfahime, E. Identification of differentially expressed genes by cDNA-AFLP technique in response to drought stress in Triticum durum. Food Technol. Biotechnol. 2014, 52, 479–488. [Google Scholar] [CrossRef]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional Regulatory Networks in Cellular Responses and Tolerance to Dehydration and Cold Stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef]
- Yang, S.; Vanderbeld, B.; Wan, J.; Huang, Y. Narrowing down the targets: Towards successful genetic engineering of drought-tolerant crops. Mol. Plant 2010, 3, 469–490. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, P.K. Global climate change and Indian horticulture. Indian J. Agric. Sci. 2008, 78, 911–919. [Google Scholar] [CrossRef]
- Liang, C.; Wang, W.; Wang, J.; Ma, J.; Li, C.; Zhou, F.; Zhang, S.; Yu, Y.; Zhang, L.; Li, W.; et al. Identification of differentially expressed genes in sunflower (Helianthus annuus) leaves and roots under drought stress by RNA sequencing. Bot. Stud. 2017, 58, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Gnankambary, K.; Sawadogo, N.; Diéni, Z.; Batieno, T.B.J.; Tignegré, J.B.D.S.; Sawadogo, M.; Ouédraogo, T.J. Assessment of Cowpea (Vigna unguiculata (L.) Walp.) Mutant Lines for Drought Tolerance. Int. J. Agron. 2020, 2020, 8823498. [Google Scholar] [CrossRef]
- Transparency Market Research. Cowpeas Market|Global Industry Report. Available online: https://www.transparencymarketresearch.com/cowpeas-market.html (accessed on 13 September 2021).
- Boukar, O.; Belko, N.; Chamarthi, S.; Togola, A.; Batieno, J.; Owusu, E.; Haruna, M.; Diallo, S.; Umar, M.L.; Olufajo, O.; et al. Cowpea (Vigna unguiculata): Genetics, genomics and breeding. Plant Breed. 2018, 138, 415–424. [Google Scholar] [CrossRef]
- Olorunwa, O.J.; Shi, A.; Barickman, T.C. Varying drought stress induces morpho-physiological changes in cowpea (Vigna unguiculata (L.) genotypes inoculated with Bradyrhizobium japonicum. Plant Stress 2021, 2, 100033. [Google Scholar] [CrossRef]
- Ravelombola, W.; Shi, A.; Qin, J.; Weng, Y.; Bhattarai, G.; Zia, B.; Zhou, W.; Mou, B. Investigation on various aboveground traits to identify drought tolerance in cowpea seedlings. HortScience 2018, 53, 1757–1765. [Google Scholar] [CrossRef]
- Ritte, I.P.; Egnin, M.; Idehen, O.; Mortley, D.; Bernard, G.C.; Binagwa, P.H.; Brown, A.P.; Bonsi, C.K. Evaluation of Cowpea Morpho-physiological and Yield Responses to Vegetative and Pre-Anthesis Water-Deficit Stress Tolerance under Greenhouse Conditions. Eur. J. Appl. Sci. 2022, 10, 391–411. [Google Scholar] [CrossRef]
- Cui, Q.; Xiong, H.; Yufeng, Y.; Eaton, S.; Imamura, S.; Santamaria, J.; Ravelombola, W.; Mason, R.E.; Wood, L.; Mozzoni, L.A.; et al. Evaluation of drought tolerance in Arkansas Cowpea lines at seedling stage. HortScience 2020, 55, 1132–1143. [Google Scholar] [CrossRef]
- Nkoana, K.D.; Gerrano, A.S.; Gwata, E.T. Evaluation of diverse cowpea [Vigna unguiculata (L.) walp.] germplasm accessions for drought tolerance. Legume Res. 2019, 42, 168–172. [Google Scholar] [CrossRef]
- Singh, B.B.; Mai-Kodomi, Y.; Terao, T. A simple screening method for drought tolerance in cowpes. Indian J. Genet. 1999, 59, 211–220. [Google Scholar]
- Verbree, D.A.; Singh, B.B.; Payne, W.A. Genetics and Heritability of Shoot Drought Tolerance in Cowpea Seedlings. Crop Sci. 2015, 55, 146–153. [Google Scholar] [CrossRef]
- Bharadwaj, N.; Barthakur, S.; Biswas, A.D.; Kumar Das, M.; Kour, M.; Ramteke, A.; Gogoi, N. Transcript expression profiling in two contrasting cultivars and molecular cloning of a SKP-1 like gene, a component of SCF-ubiquitin proteasome system from mungbean Vigna radiate L. Sci. Rep. 2019, 9, 8103. [Google Scholar] [CrossRef] [PubMed]
- Iuchi, S.; Yamaguchi-Shinozaki, K.; Urao, T.; Terao, T.; Shinozaki, K. Novel drought-inducible genes in the highly drought-tolerant cowpea: Cloning of cDNAs and analysis of the expression of the corresponding genes. Plant Cell Physiol. 1996, 37, 1073–1082. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, L.; Zhang, T.; Yang, X.; Li, D. Functional characterization of KS-Type dehydrin ZmDHN13 and its related conserved domains under oxidative stress. Sci. Rep. 2017, 7, 7361. [Google Scholar] [CrossRef] [PubMed]
- Iuchi, S.; Kobayashi, M.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol. 2000, 123, 553–562. [Google Scholar] [CrossRef] [PubMed]
- Ippolito, S.D.; Rey-Burusco, M.F.; Feingold, S.E.; Guevara, M.G. Role of proteases in the response of plants to drought. Plant Physiol. Biochem. 2021, 168, 1–9. [Google Scholar] [CrossRef]
- Urano, K.; Maruyama, K.; Ogata, Y.; Morishita, Y.; Takeda, M.; Sakurai, N.; Suzuki, H.; Saito, K.; Shibata, D.; Kobayashi, M.; et al. Characterization of the ABA-regulated global responses to dehydration in Arabidopsis by metabolomics. Plant J. 2009, 57, 1065–1078. [Google Scholar] [CrossRef] [PubMed]
- Hermans, C.; Porco, S.; Verbruggen, N.; Bush, D.R. Chitinase-like protein CTL1 plays a role in altering root system architecture in response to multiple environmental conditions. Plant Physiol. 2010, 152, 904–917. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Fatokun, C.A.; Boukar, O.; Muranaka, S. Evaluation of cowpea (Vigna unguiculata (L.) Walp.) germplasm lines for tolerance to drought. Plant Genet. Resour. Characterisation Util. 2012, 10, 171–176. [Google Scholar] [CrossRef]
- Owusu, E.Y.; Amegbor, I.K.; Mohammed, H.; Kusi, F.; Atopkle, I.; Sie, E.K.; Ishahku, M.; Zakaria, M.; Iddrisu, S.; Kendey, H.A.; et al. Genotype × environment interactions of yield of cowpea (Vigna unguiculata (L.) Walp) inbred lines in the Guinea and Sudan Savanna ecologies of Ghana. J. Crop Sci. Biotechnol. 2020, 23, 453–460. [Google Scholar] [CrossRef]
- Jain, D.; Chattopadhyay, D. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance. BMC Plant Biol. 2010, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Polania, J.; Poschenrieder, C.; Rao, I.; Beebe, S. Root traits and their potential links to plant ideotypes to improve drought resistance in common bean. Theor. Exp. Plant Physiol. 2017, 29, 143–154. [Google Scholar] [CrossRef]
- Rong-hual, L.I.; Pei-pol, G.U.O.; Baumz, M.; Grand, S.; Ceccarelli, S. Evaluation of Chlorophyll Content and Fluorescence Parameters as Indicators of Drought Tolerance in Barley. Agric. Sci. China 2006, 5, 751–757. [Google Scholar] [CrossRef]
- Mai-Kodomi, Y.; Singh, B.B.; Terao, T.; Myers, O.; Yopp, J.H.; Gibson, P.J. Two mechanisms of drought tolerance in cowpea. Indian J. Genet. Plant Breed. 1999, 59, 309–316. [Google Scholar]
- Mai-Kodomi, Y.; Singh, B.B.; Terao, T.; Myers, O.; Yopp, J.H.; Gibson, P.J. Inheritance of drought tolerance in cowpea. Indian J. Genet. Plant Breed. 1999, 59, 317–323. [Google Scholar]
- Kuroda, M.; Ozawa, T.; Imagawa, H. Changes in chloroplast peroxidase activities in relation to chlorophyll loss in barley leaf segments. Physiol. Plant. 1990, 80, 555–560. [Google Scholar] [CrossRef]
- Xu, W.; Rosenow, D.T.; Nguyen, H.T. Short Communication Stay green trait in grain sorghum relationship between visual rating and leaf chlorophyll concentration. Plant Breed. 2000, 119, 365–367. [Google Scholar] [CrossRef]
- Nunes, C.; Moreira, R.; Pais, I.; Semedo, J.; Simões, F.; Veloso, M.M.; Scotti-Campos, P. Cowpea Physiological Responses to Terminal Drought—Comparison between Four Landraces and a Commercial Variety. Plants 2022, 11, 593. [Google Scholar] [CrossRef]
- Kamal, N.M.; Gorafi, Y.S.A.; Abdelrahman, M.; Abdellatef, E.; Tsujimoto, H. Stay-Green Trait: A Prospective Approach for Yield Potential, and Drought and Heat Stress Adaptation in Globally Important Cereals. Int. J. Mol. Sci. 2019, 20, 5837. [Google Scholar] [CrossRef]
- Guo, P.; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R.; Von Korff, M.; Varshney, R.K.; Graner, A.; Valkoun, J. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. J. Exp. Bot. 2009, 60, 3531–3544. [Google Scholar] [CrossRef] [PubMed]
- Ingram, J.; Bartels, D. The molecular basis of dehydration tolerance in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 377–403. [Google Scholar] [CrossRef] [PubMed]
- Sales, C.R.G.; Ribeiro, R.V.; Silveira, J.A.G.; Machado, E.C.; Martins, M.O.; Lagôa, A.M.M.A. Superoxide dismutase and ascorbate peroxidase improve the recovery of photosynthesis in sugarcane plants subjected to water deficit and low substrate temperature. Plant Physiol. Biochem. 2013, 73, 326–336. [Google Scholar] [CrossRef] [PubMed]
- Agbicodo, E.M.; Fatokun, C.A.; Muranaka, S.; Visser, R.G.F.; Van Der, C.G.L. Breeding drought tolerant cowpea: Constraints, accomplishments, and future prospects. Euphytica 2009, 167, 353–370. [Google Scholar] [CrossRef]
- De Vega, J.J.; Teshome, A.; Klaas, M.; Grant, J.; Finnan, J.; Barth, S. Physiological and transcriptional response to drought stress among bioenergy grass Miscanthus species. Biotechnol. Biofuels 2021, 14, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Min, H.; Chen, C.; Wei, S.; Shang, X.; Sun, M.; Xia, R.; Liu, X.; Hao, D.; Chen, H.; Xie, Q. Identification of Drought Tolerant Mechanisms in Maize Seedlings Based on Transcriptome Analysis of Recombination Inbred Lines. Front. Plant Sci. 2016, 7, 1080. [Google Scholar] [CrossRef] [PubMed]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef]
- Zhang, X.; Lei, L.; Lai, J.; Zhao, H.; Song, W. Effects of drought stress and water recovery on physiological responses and gene expression in maize seedlings. BMC Plant Biol. 2018, 18, 1–16. [Google Scholar] [CrossRef]
- Dreher, K.; Callis, J. Ubiquitin, hormones and biotic stress in plants. Ann. Bot. 2007, 99, 787–822. [Google Scholar] [CrossRef] [PubMed]
- Iuchi, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T.; Tabata, S.; Kakubari, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 2001, 27, 325–333. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Li, G.-J.; Bressan, R.A.; Song, C.-P.; Zhu, J.-K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol. 2020, 62, 25–54. [Google Scholar] [CrossRef] [PubMed]
- Daszkowska-Golec, A. The Role of Abscisic Acid in Drought Stress: How ABA Helps Plants to Cope with Drought Stress. In Drought Stress Tolerance in Plants; Molecular and Genetic Perspective; Hossain, M.A., Wani, S.H., Bhattacharjee, S., Burritt, D.J., Tran, L.-S.P., Eds.; Springer: Cham, Switzerland, 2016; pp. 123–151. [Google Scholar] [CrossRef]
- Nawaz, M.; Wang, Z. Abscisic Acid and Glycine Betaine Mediated Tolerance Mechanisms under Drought Stress and Recovery in Axonopus compressus: A New Insight. Sci. Rep. 2020, 10, 6942. [Google Scholar] [CrossRef]
- Xiong, Y.; Song, X.; Mehra, P.; Yu, S.; Li, Q.; Tashenmaimaiti, D.; Bennett, M.; Kong, X.; Bhosale, R.; Huang, G. ABA-auxin cascade regulates crop root angle in response to drought. Curr. Biol. 2025, 35, 542–553. [Google Scholar] [CrossRef] [PubMed]
- Ye, Y.; Ding, Y.; Jiang, Q.; Wang, F.; Sun, J.; Zhu, C. The role of receptor-like protein kinases (RLKs) in abiotic stress response in plants. Plant Cell Rep. 2016, 36, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Morris, E.R.; Walker, J.C. Receptor-like protein kinases: The keys to response. Curr. Opin. Plant Biol. 2003, 6, 339–342. [Google Scholar] [CrossRef]
- Kim, H.; Hwang, H.; Hong, J.W.; Lee, Y.N.; Ahn, I.P.; Yoon, I.S.; Yoo, S.D.; Lee, S.; Lee, S.C.; Kim, B.G. A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth. J. Exp. Bot. 2012, 63, 1013–1024. [Google Scholar] [CrossRef] [PubMed]
- Kovacs, D.; Kalmar, E.; Torok, Z.; Tompa, P. Chaperone activity of ERD10 and ERD14, two disordered stress-related plant proteins. Plant Physiol. 2008, 147, 381–390. [Google Scholar] [CrossRef] [PubMed]
- Eichenberger, S. Dehydrin Patterns in Wheat Leaves During Severe Drought and Recovery. Master’s Thesis, Faculty of Science, University of Bern, Bern, Switzerland, 2009. [Google Scholar]
- Zhang, H.M.; Zhang, L.S.; Liu, L.; Zhu, W.N.; Yang, W.B. Changes of dehydrin profiles induced by drought in winter wheat at different developmental stages. Biol. Plant. 2013, 57, 797–800. [Google Scholar] [CrossRef]
# | Plant Name | Av. 1 Seed Size (mg) | Status | Origin | Drought Sensitivity | Other Traits |
---|---|---|---|---|---|---|
1. | Mississippi Silver | 163.33 | Comm. Var. | United States | Susceptible | Fusarium wilt (R), Root-knot nematodes (R) |
2. | Top Pick Brown | 186.67 | Comm. Var. | United States | Tolerant | Diseases (R) |
3. | Top Pick Cream | 133.33 | Comm. Var. | United States | Susceptible | Unknown |
4. | Big Boy | 340.00 | Comm. Var. | United States | Tolerant | Unknown |
5. | California Blackeye #5 | 186.67 | Comm. Var. | United States | Tolerant | Fusarium wilt (R), Nematodes (R) |
6. | Lady | 90.00 | Comm. Var. | United States | Tolerant | Unknown |
7. | Pinkeye Purple Hull BVR | 176.67 | Comm. Var. | United States | Tolerant | Black-eye Cowpea Mosaic Virus (R) |
8. | Black Crowder | 196.67 | Comm. Var. | United States | Tolerant | Unknown |
9. | TVu7362 | 120.00 | Accession | Nigeria | Promising | Unknown |
10. | TVu11987 | 143.33 | Accession | Sudan | Promising | Unknown |
11. | LOBIA-I-SEFADE | 243.33 | Accession | Afghanistan | Promising | Unknown |
12. | UCR 242 | 160.00 | Accession | Tanzania | Susceptible | Unknown |
13. | TVnu 113 | 30.00 | Accession | Tanzania | Susceptible | Unknown |
14. | K929 | 146.67 | Accession | Iraq | Susceptible | Unknown |
15. | White Acre | 130.00 | Comm. Var. | United States | Susceptible | Early maturity |
16. | Aloomba | 203.28 | Accession | Australia | Tolerant | Unknown |
17. | TVu2428 | 182.31 | Accession | Nigeria | Susceptible | Unknown |
# | Cultivar | Status | Drought Response | Phenotype Data |
---|---|---|---|---|
1. | Mississippi Silver | Comm. cv, susceptible | Susceptible | [4] |
2. | California Blackeye #5 | Comm. cv, tolerant | Tolerant | [4] |
3. | TVu11987 | Accession, promising tolerant | Tolerant | This study and [18] |
4. | Lobia-I-Sefade | Accession, promising tolerant | Tolerant | This study and [18] |
5. | K929 | Accession, susceptible | Susceptible | This study and [18] |
6. | Aloomba | Accession, promising tolerant | Tolerant | [17] |
7. | TVu2428 | Accession, susceptible | Susceptible | [17] |
# | Type | Primer | Sequence (5′-3′) | Size (bp) |
---|---|---|---|---|
1. | Photosynthesis | PSII | FOR—CCTCCAGTAGATATTGATGGTATTCGTG REV—GGAACCATGCATAGCACTGAATAGG | 460 |
2. | Abscisic acid biosynthesis | NCED1 | FOR—TCCCTTCAAACACTCCACTTC REV—AGTTCCCGGCGATTTGG | 290 |
3. | Stress and signal transduction | RLKP | FOR—GTTAGAAAGGCACAAACACAGA REV—ACGGAGAAAGTGAAGATG TTTGG | 700 |
4. | Protein ubiquitination | SKP1 | FOR—ATTGCGAAAGGGGAAAATGATAG REV—CTCAGCCTCTTCCTCCTCTGTA | 500 |
5. | LEA protein | ERD14 | FOR—GAAGCCTCAGGAAGAGGTGA REV—TCCTCCTCTGTCTTGGAGTGG | 470 |
6. | Housekeeping | VuYLS8 | FOR—CTGGTGGACATAACGGAGGT REV—GTTGTTTCCAGTGCCGAGAT | 125 |
Trait | Condition | Description | Time (Days) | DF | SS | MS | F | Source | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Cultivar (Cul) | Treatment (Trt) | Time (Tm) | Cul × Trt | Cul × Tm | Cul × Tm × Trt | ||||||||
Chlorophyll content | Control | Unifoliate leaf | 7 | 16 | 1,355,927 | 84,745 | 31.95 | *** | - | *** | - | NS | - |
14 | 16 | 1,624,113 | 101,507 | 37.21 | *** | - | - | ||||||
Trifoliate leaf | 7 | 16 | 747,929 | 46,746 | 21.71 | *** | - | *** | - | NS | - | ||
14 | 16 | 761,926 | 47,620 | 26.48 | *** | - | - | ||||||
21 | 16 | 853,054 | 53,316 | 35.07 | *** | - | - | ||||||
28 | 16 | 964,042 | 60,253 | 35.19 | *** | - | - | ||||||
Chlorophyll content | Stress | Unifoliate leaf | 7 | 16 | 2,345,703 | 146,606 | 48.94 | *** | ** | *** | *** | *** | *** |
14 | 16 | 1,657,461 | 103,591 | 28.03 | *** | *** | *** | ||||||
Trifoliate leaf | 7 | 16 | 1,186,063 | 74,129 | 19.23 | *** | *** | *** | *** | *** | ** | ||
14 | 16 | 1,857,810 | 116,113 | 19.50 | *** | *** | *** | ||||||
21 | 16 | 1,685,645 | 105,353 | 20.02 | *** | *** | *** | ||||||
28 | 16 | 1,421,351 | 88,834 | 22.78 | *** | *** | *** | ||||||
Plant greenness | Stress | Whole plant | 33 | 16 | 138.806 | 8.6753 | 32.75 | *** | - | - | - | - | - |
Recovery | Stress | Whole plant | 41 | 16 | 15,010.9 | 938.18 | 16.96 | *** | - | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ritte, I.P.; Egnin, M.; Bernard, G.C.; Mortley, D.; Idehen, O.; Okoma, M.P.; Bonsi, C. Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. Int. J. Plant Biol. 2025, 16, 25. https://doi.org/10.3390/ijpb16010025
Ritte IP, Egnin M, Bernard GC, Mortley D, Idehen O, Okoma MP, Bonsi C. Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. International Journal of Plant Biology. 2025; 16(1):25. https://doi.org/10.3390/ijpb16010025
Chicago/Turabian StyleRitte, Inocent Paulin, Marceline Egnin, Gregory Christopher Bernard, Desmond Mortley, Osagie Idehen, Michelle Pamelas Okoma, and Conrad Bonsi. 2025. "Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars" International Journal of Plant Biology 16, no. 1: 25. https://doi.org/10.3390/ijpb16010025
APA StyleRitte, I. P., Egnin, M., Bernard, G. C., Mortley, D., Idehen, O., Okoma, M. P., & Bonsi, C. (2025). Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. International Journal of Plant Biology, 16(1), 25. https://doi.org/10.3390/ijpb16010025