Next Article in Journal
Evaluation of Adaptive Responses of Juglans neotropica Diels Progenies Based on Dasometric Traits
Previous Article in Journal
Regional Variability in Growth and Leaf Functional Traits of Mitragyna speciosa in Thailand
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars

by
Inocent Paulin Ritte
1,*,
Marceline Egnin
1,
Gregory Christopher Bernard
1,
Desmond Mortley
2,
Osagie Idehen
1,
Michelle Pamelas Okoma
1 and
Conrad Bonsi
1,2
1
Plant Biotechnology and Genomics Research Laboratory, College of Agriculture, Environment, and Nutrition Sciences, Tuskegee University, Tuskegee, AL 36088, USA
2
George Washington Carver Agricultural Experiment Station, College of Agriculture, Environment, and Nutrition Sciences Tuskegee University, Tuskegee, AL 36088, USA
*
Author to whom correspondence should be addressed.
Int. J. Plant Biol. 2025, 16(1), 25; https://doi.org/10.3390/ijpb16010025
Submission received: 17 December 2024 / Revised: 3 February 2025 / Accepted: 17 February 2025 / Published: 21 February 2025
(This article belongs to the Section Plant Response to Stresses)

Abstract

Drought poses a significant challenge to cowpea growth and productivity, necessitating the development of drought-tolerant cultivars through detailed morpho-physiological and molecular analyses. This study evaluated drought stress responses in cowpea cultivars using polypropylene plastic boxes under greenhouse conditions. RT-qPCR was conducted to assess the relative expression of five photosynthetic and abiotic stress-related genes in a subset of seven contrasting cultivars at 7-, 14-, and 28-days post-treatment initiation (DPTI) and 24 h post-rewatering. Drought-stressed plants showed progressive wilting and a declining chlorophyll content, with plant greenness scores ranging from 2.2 (TVu11987) to 4.7 (TVu2428). California Blackeye (72.2%) and TVu11987 (69.4%) had the highest recovery rates, indicating greater drought tolerance, while TVu2428 had the lowest (2.8%). Gene expression analyses revealed significant drought-induced variation across cultivars and time points. Transcript levels were notably higher in drought-tolerant cultivars, particularly at 14 DPTI and 24 h post-rewatering, aligning with the morpho-physiological screening results. However, gene expression declined as the drought severity increased. These results suggest that California Blackeye, TVu11987, Lobia-I-Sefade, K929, and Aloomba were more drought tolerant compared to Mississippi Silver and TVu2428. Future research using transcriptomic profiling could unravel the complex molecular mechanisms of drought responses in cowpeas, providing valuable insights for breeding genotypes with improved resiliency to drought.

1. Introduction

Drought tolerance, a complex trait in plants, is the ability by which plants employ various mechanisms to sustain growth and adapt to water-deficit conditions. Understanding these mechanisms is essential for identifying superior traits that can be introgressed into breeding programs to develop more resilient crops [1,2]. As sessile organisms, plants are exposed to abiotic stresses, such as drought, that disrupt plant water metabolism and trigger significant morpho-physiological and molecular changes, which can adversely affect plant growth, development, and productivity [3,4,5].
Plants respond to environmental stresses by modifying the expression of numerous genes with specialized functions, enabling adaptive responses to mitigate stress and enhance survival in challenging conditions [6,7]. This regulation of gene expression allows plants to fine-tune physiological and biochemical processes, such as stomatal closure to minimize water loss through transpiration, reduced cell expansion and photosynthesis, as well as effects on crop respiration rates [8,9,10,11]. While the mechanisms of drought stress tolerance are not well understood, modern molecular biology technologies have advanced knowledge of the genetic basis of some of these mechanisms [12]. Although different plant species and genotypes may adopt distinct drought adaptation strategies, specific stress response mechanisms are commonly shared across species [2]. Understanding these mechanisms is crucial for improving drought tolerance in crops.
Cowpea (Vigna unguiculata L. Walp), widely known as black-eyed pea or southern field pea, is a valuable leguminous crop in tropical and subtropical regions that is cultivated both for its economic importance and as a rich protein source [13,14]. Cowpea has demonstrated notable resilience to drought compared to other legumes, making it suitable for semiarid regions with annual rainfall as low as 300 mm [15]. Although cowpea tolerates drought, studies indicate that severe soil moisture stress during early vegetative growth can significantly compromise morphological and physiological traits, negatively affecting yield [16,17,18]. Conversely, numerous studies focused on drought stress at the early vegetative growth stage have generated valuable insights, significantly contributing to efforts aimed to improving drought tolerance in cowpea [19,20,21,22].
The wooden box screening method is most reliable approach for phenotyping cowpeas at early vegetative growth stage [21]. Since its introduction, this method has been refined and applied extensively in numerous studies [17,19,20,22]. However, these studies have overlooked molecular aspects, particularly the differential expression of drought-responsive genes under progressive drought stress during the early vegetative growth stage. Understanding gene expression in response to water-deficit stress provides valuable insights into the genetic variations and mechanisms that allow cowpeas to adapt and respond to drought conditions. This can be achieved by comparing transcript expression levels under different drought conditions and identifying specific genes activated by drought stress [6]. Various genomic and genetic methods have been devised to identify the genes, pathways, and biological processes involved in regulating drought stress responses in cowpeas and other crops [23,24,25].
Iuchi et al. [24] investigated cowpea’s response to drought by characterizing cDNA clones related to jasmonic acid, lipid signaling, and abscisic acid (ABA) pathways, identifying key drought-responsive genes within these pathways. Among these was the candidate gene, 9-cis-epoxycarotenoid dioxygenase-1 (NCED1), involved in ABA biosynthesis [26]. ABA plays a vital role in the plant drought response by modulating stomatal closure to prevent water loss and activating various signaling pathways [27,28]. Additional genes such as SKP1 (S-phase kinase-associated protein 1), a crucial component of the ubiquitin-proteasome system, and dehydrin (ERD14) have been characterized in mungbean (Vigna radiata) and maize (Zea mays) for their specific roles in abiotic stress tolerance [23,25]. Similarly, Hermans et al. [29] highlighted the role of leucine-rich repeat receptor-like kinases (RLKs) in the regulation of the root system architecture in response to various environmental stresses, including heat, salt, and drought, by preventing sodium ion overaccumulation. Exploring drought tolerance strategies in cowpeas by comparing transcriptional differences in candidate genes between drought-tolerant and -sensitive cultivars will enhance our understanding of the genetic basis of drought tolerance. This knowledge is essential for effectively utilizing genomic and genetic resources toward the selection and improvement of cowpea’s drought tolerance.
We utilized Sterilite polypropylene plastic boxes as a modified alternative to the wooden box methodology [21] to evaluate the morpho-physiological changes in seventeen cowpea cultivars under drought stress at the seedling stage. Additionally, expression analyses of five candidate genes were conducted in a subset of seven cultivars, representing drought-tolerant and drought-sensitive responses after progressive drought stress and subsequent recovery following rewatering. This approach offers valuable insights for future research on the molecular mechanisms underlying drought tolerance in cowpea. Furthermore, the findings highlight potential candidate genes for further characterization and deployment, contributing essential information for advancing the development of drought-tolerant cowpea genotypes.

2. Materials and Methods

2.1. Plant Materials and Drought Stress Experiment

This study evaluated seventeen cowpea cultivars (listed in Table 1) at Tuskegee University’s George Washington Carver Agricultural Experiment Station (GWCAES) in the Carver Phyto Research Unit greenhouse (CPU) from April to July 2021. Cultivars were planted in Sterilite polypropylene boxes (Sterilite Corporation, Townsend, MA; dimensions: 88.6 cm × 42.2 cm × 15.6 cm), each filled with 10 kg of horticulture potting soil (SUNGRO: #52 2.8 CUFT 42/PLT; Sun Gro Horticulture, Agawam, MA, USA). Before planting, each box was watered with 9 L of tap water and left for two days to bring the soil to field capacity (FC). The experiment was arranged into three complete blocks, each serving as a replicate. The design was as follows: each block consisted of four aligned boxes divided into two whole plots (two boxes per plot) representing two treatments, “no watering” and “well-watered.” The growing conditions within each plot were identical, allowing the two boxes in each plot to be considered as one whole plot that was further divided into two sub-plots. Each sub-plot consisted of two boxes, with 17 cultivars assigned using a completely randomized design. To ensure an equal number of cultivars per box, when the second box contained more than eight cultivars, the cultivar TVu11987 was included to bring the total to nine. Within each box, nine rows were spaced 8.5 cm apart, with six planting holes per row. Each hole was spaced 5 cm apart and 2.5 cm deep. Following germination, each row was uniformly watered with 200 mL of tap water every three days until the first trifoliate leaf partially expanded, which occurred 12 days after sowing. Plants were thinned to six vigorously growing and uniform plants per row, and drought stress was induced by withholding water in the drought treatment boxes for 33 days, during which some cultivars exhibited visible signs of mortality. Meanwhile, the control boxes received 200 mL of tap water per row every one to two days throughout the experiment.

2.2. Data Collection

Data were recorded weekly, starting seven days after initiating the water-stress treatment and continuing at weekly intervals. Assessments included measurements of the chlorophyll content in unifoliate and trifoliate leaves, plant greenness, and the recovery rate post-watering. The chlorophyll content was measured in (μmolm−2) using a chlorophyll concentration meter, Model MC-100 (Apogee Instruments, Logan, UT, USA). For unifoliate leaves, the chlorophyll content was recorded at two points (day 7 and day 14 of the stress period) since over 50% of the cultivars had abscised their unifoliate leaves by day 14. Trifoliate leaf chlorophyll measurements continued until day twenty-eight of the stress period. Three readings were taken from each leaflet of both unifoliate and trifoliate leaves, with the average of these readings recorded as the final value. Thirty-three days after the initiation of stress, plant greenness was assessed on a modified scale of 1 to 5, adopted from Ravelombola et al. [17], as shown in Figure 1.
After 33 days of drought treatment, watering was resumed by applying 9 L of tap water to each box to bring the soil back to field capacity. Subsequently, boxes were watered as needed with 200 mL of tap water per row to maintain the soil at field capacity. Seven days after rewatering, recovery rates were assessed by counting the number of plants the recovered from drought stress in each row, with the results expressed as percentages. Data from the two experiments were averaged and used for statistical analysis.

2.3. Collection of Leaf Samples for Molecular Analyses

Leaves were collected from seven representative cowpea cultivars identified as either tolerant or susceptible based on their phenotypic response to drought (Table 2). Leaf tissues were sampled at four time points (Figure 2) with three biological replicates per cultivar under both control and drought stress conditions during the repeated experiment. For each replicate, leaf samples were pooled from two randomly selected plants out of six per row. A 300 mg sample was weighed into a 2 mL sterile microcentrifuge tube for each replicate, then flash-frozen in liquid nitrogen, and stored at −80 °C until required for RNA isolation.

2.4. Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from 300 mg of leaf tissue from each of the seven selected cowpea cultivars grown under both drought-treated and control conditions using the Promega SV Total RNA Isolation Kit (Promega, Madison, WI, USA) following the manufacturer’s protocol, with slight modifications. Briefly, the lysis buffer was prepared with the addition of polyvinyl pyrrolidone (PVP, 2% w/v, average molecular weight 10,000), sodium ascorbate (1% v/v), sodium metabisulfite (1% w/v), and β-mercaptoethanol (10 µL per 1 mL buffer). This mixture was gently mixed, cooled on ice, and used for total RNA isolation. The RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and RNA quality was verified on 0.8% agarose gels. For cDNA synthesis, first-strand cDNA was synthesized from 1 µg of RNA using the Promega Access RT-PCR System (Promega, Madison, WI, USA) with an Oligo(dT)18 primer, as per the manufacturer’s instructions. Each 50 µL reaction included 10 µL of AMV/TFL 5X reaction buffer, 100 pMol of oligo(dT)18, 1.4 µL of 10 mM dNTP mix, 2 µL of 25 mM magnesium sulfate, 1.2 µL of AMV reverse transcriptase enzyme, and 13.4 µL of RNase-free water. The reaction mixture was briefly centrifuged and incubated in a Bio-Rad T100 Touch thermal cycler with the following conditions: 37 °C for 5 min, 48 °C for 45 min, and 94 °C for 2 min. Samples were stored at −20 °C until further analysis of the relative expression of target genes.

2.5. Quantitative Real-Time PCR Analysis

Five target genes, photosystem II (PSII), 9-cis-epoxycarotenoid dioxygenase-1 (NCED1), stress response/antifungal protein tyrosine kinases (RLKs), S-phase kinase-associated protein 1 (SKP1), and early responsive to dehydration 14 protein (ERD14), and a reference gene, V. unguiculata yellow-leaf-specific gene 8 (YLS8), were selected for expression analyses. Gene-specific primer pairs for each target and the reference gene were designed using the PrimerQuest™ Tool (Integrated DNA Technologies (IDT), Inc., Coralville, IA, USA) available at (https://www.idtdna.com/PrimerQuest, accessed 21 October 2021) based on sequences obtained from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/, accessed on 12 July 2021). Primer sequences are provided in Table 3. The PCR reaction was set up for 40 cycles using PowerTrack SYBR Green PCR MasterMix (Applied Biosystems, Waltham, MA, USA) for signal detection. Each reaction mixture contained 0.4 µM of each primer, 3 µL of the cDNA template, and 6.2 µL of nuclease-free water, with a final volume of 20 µL. The following thermal cycling conditions were used for all amplifications: initial polymerase activation at 95 °C for 2 min, denaturation at 95 °C for 30 s, annealing at gene-specific temperatures (54–59 °C) for 1 min, and extension at 60 °C for 1 min. After 40 cycles, melting curves were assessed for amplicon specificity on the QuantStudio5 Real-Time PCR system using a thermal melting profile of 95 °C for 15 s with a gradual temperature increase from 60 to 95 °C. Expression analyses were conducted in three biological replicates, and relative expression levels were calculated using the 2−∆∆CT method [30]. Relative fold expression was determined by comparing Ct values from the experimental (target) and control genes.

2.6. Statistical Analyses

2.6.1. Greenhouse Data Analysis

A two-factor analysis of variance (ANOVA) was conducted to test for significant differences (p ≤ 0.05) among the cowpea cultivars’ responses to water-deficit stress based on the evaluated traits. Fisher’s unprotected least significant difference (LSD) test was then applied to separate the differences among the means. All statistical analyses were performed using Stata Statistical Software (StataCorp. (2021), Stata: Release 17 LLC, College Station, TX, USA). For cultivar TVu11987, one entry per replicate was measured and included in the data analysis, while the repeated entry was left as a border.

2.6.2. Gene Expression Data Analysis

Cycle threshold data were uploaded into Microsoft Excel to calculate relative expression fold change values using the 2−∆∆Ct method. These relative transcript accumulation values for each target gene were then used to create bar graphs, with error bars representing the standard errors of 3 replicates. Analysis of variance (ANOVA) was conducted with GenStat software version 16.1 at p ≤ 0.05. Tukey’s test was used to compare the means of differentially expressed genes within or between cultivars subjected to drought treatment.

3. Results and Discussion

Numerous studies have reported that drought stress can significantly affect various growth stages in many plant species, including cowpea, leading to reduced yields or even complete losses [18,31,32]. The use of drought-resilient crop varieties stands out as a highly effective and cost-efficient strategy for mitigating the adverse effects of drought stress on agricultural production [33,34].

3.1. Analysis of Variance (ANOVA) of Morpho-Physiological Data

The analysis of variance results (Table 4) revealed significant differences among cultivars in the unifoliate and trifoliate chlorophyll contents, plant greenness, and recovery rate after rewatering. These indicate notable diversity among the cultivars, with some showing greater resilience to drought than others. The effect of time on the chlorophyll contents in unifoliate and trifoliate leaves was also significant, both under control and drought-stressed conditions. Moreover, the interaction between the cultivar (Cul) and time (Tm), as well as the three-way interaction among the cultivar (Cul), time (Tm), and treatment (Trt), was significant under drought stress, highlighting the varied responses of cultivars over time under water-deficit conditions.

3.2. Impacts of Drought Stress on the Leaf Chlorophyll Content and Overall Plant Performance

Leaves, as the primary photosynthetic organs, serve as indicators of a plant’s adaptability to drought stress [35]. Leaves wilted (Figure 3), with the severity intensifying as drought stress progressed. Seven days after the onset of drought treatment, initial stress responses were observed, such as the dropping of unifoliate leaves, followed by the trifoliate leaves. By day 14, chlorosis in unifoliate leaves was visible, while trifoliate leaves retained their green color with a display of dropping morphology. Under drought conditions, the unifoliate leaf chlorophyll content decreased progressively with increased drought stress compared to well-watered controls. However, on day 14, the trifoliate leaf chlorophyll content increased significantly (p < 0.05) in several cultivars, including Mississippi Silver, Top Pick Cream, California Blackeye #5, Black Crowder, TVu11987, TVnu113, White Acre, and Aloomba, before declining in these and the remaining cultivars thereafter (Table S2).
The general plant morphology was impacted by drought stress, resulting in the suppression of growth and development. In most cultivars, unifoliate leaves abscised from the plants by 21 DPTI, a characteristic feature consistent with type 2 drought tolerance in cowpeas reported by Mai-Kodomi et al. [36] in which trifoliate leaves grow slowly, while the unifoliate leaves senesce early and drop, preserving greenness at the growing tip. The second drought tolerance mechanism in cowpeas is known as “type 1”, whereby plants respond to drought by ceasing growth and conserve moisture in all plant tissues followed by gradual desiccation. During the 21 DPTI period, trifoliate leaf chlorosis became pronounced, with significant differences observed between control and drought-stressed plants. Trifoliate leaves also exhibited severe curling and necrosis, which intensified as drought stress increased, particularly in Top Pick Cream, Mississippi Silver, UCR242 and TVu2428. In contrast, California Blackeye #5, Tvu11987, Lobia-I-Sefade, and Aloomba displayed a slower progression of chlorosis and necrosis on the trifoliate leaves. The variability in the drought responses of unifoliate and trifoliate leaves relates to the two primary drought tolerance mechanisms in cowpeas controlled by a single dominant gene, with distinct genetic control for each type [22,37]. By 28 DPTI, the trifoliate leaf chlorophyll content ranged from 101.1 μmolm−2 in UCR242 to 268.1 μmolm−2 in TVu11987, with a treatment mean of 149.9 μmolm−2. Under well-watered conditions, the trifoliate chlorophyll content ranged from 277.3 to 506.6 μmolm−2 in TVnu113 and TVu11987, respectively, with a treatment mean of 413.2 μmolm−2. At 28 DPTI, the chlorophyll level in control plants exceeded that in drought-stressed plants, with Aloomba and TVu11987 showing the smallest change rates (46.6% and 47.1% respectively), indicating higher tolerance to the drought-induced damage of photosynthetic components. Conversely, TVu2428, with change rate of 77%, was more sensitive to drought (Table S2). Other reports corroborate that drought stress reduces the chlorophyll content due to a compromised photosynthetic apparatus and lowered photosynthesis [18,38,39]. Drought-tolerant genotypes like TVu11987 and California Blackeye #5 demonstrate greater photosynthetic resilience and less growth inhibition under drought conditions [13,35].
Significant variations in plant greenness were observed at 33 DPTI. The lowest plant greenness scores were recorded for cultivars TVu11987 (2.2) and California Blackeye #5 (2.3), indicating delayed trifoliate leaf senescence and suggesting greater resilience to drought stress. Aloomba, with a score of 2.8, was similarly rated as drought-tolerant. In contrast, TVu2428 had the highest greenness score (4.7), indicating sensitivity to drought stress (Table S2). These findings align with the results of Dadson et al. [4] and Ravelombola et al. [17]. The treatment mean for the plant greenness score was 3.5; therefore, cultivars scoring below this mean were classified as drought-tolerant. Previous studies have reported a significant correlation between a sustained higher relative chlorophyll content and stay green phenotype in cowpea [40]. The stay green phenotype, characterized by prolonged leaf greenness under drought conditions, indicates reduced chlorophyll degradation. This trait enables drought-tolerant cultivars to maintain their photosynthetic capacity for extended periods, thereby enhancing dry matter production [40,41].
After 33 DPTI, drought-stressed plants were rewatered to field capacity, and recovery was assessed seven days later by counting the number of plants that recovered from stress, expressed as a percentage (Table S2). The highest recovery rates were observed in California Blackeye #5 (72.2%) and TVu11987 (69.4%), suggesting that these cultivars possess better drought tolerance mechanisms that aid in recovery following prolonged drought exposure. Moderately tolerant cultivars included Top Pick Brown Crowder (41.7%), Pinkeye Purple Hull (47,2%), Black Crowder (41.7%), Lobia-I-Sefade (52.8%), K929 (38.9%), and Aloomba (55.6%). In contrast, cultivars with the lowest recovery rates, indicating higher sensitivity to drought, were Mississippi Silver (22.2%), Top Pick Cream (22.2%), Big Boy (33.3%), Lady (36.1%), TVu7362 (36.1%), UCR242 (22.2%), TVnu113 (25%), White Acre (33.3%), and TVu2428 (2.8%). These results align with Nkoana et al. [20], who identified recovery as a reliable criterion for selecting drought-tolerant cowpea genotypes following extended drought stress and rewatering.

3.3. Effect of Drought Stress on the Expression Levels of Selected Drought-Responsive Genes

In response to a soil water deficit, plants initiate the coordinated expression of numerous genes as part of their cellular-level adaptation mechanisms [42]. These responses reflect both cell damage and adaptive processes, which together drive metabolic and structural changes that support function under a low water potential [8,43]. Genes that alter their expression in response to drought may play a direct role in these adaptive pathways. A comparative gene expression analysis, particularly between drought-tolerant and -sensitive cowpea cultivars, offers valuable insights into the molecular mechanisms governing the drought response. This study analyzed seven cowpea cultivars with distinct drought-response phenotypes (Table 2) to examine the transcriptional responses of five drought-related candidate genes across different time points using teal-time qPCR. The candidate genes evaluated included photosystem II light-harvesting protein (PSII), S-phase kinase-associated protein 1 (SKP1), 9-cis-epoxycarotenoid dioxygenase-1 (NCED1), leucine-rich repeat receptor-like kinases (RLKs), and a dehydrin (ERD14). The reference gene YLS8 mitosis protein (Yls8) was used for normalization. These genes have been linked to the drought response in cowpeas and other crops [23,24,29,42,44].
There were significant differences among cowpea cultivars in the expression of the five candidate genes under both drought and recovery conditions. Cultivars classified as drought-tolerant (Table 2) exhibited distinct expression trends of key drought-responsive genes under stress and recovery conditions, contrasting with those identified as susceptible. This classification aligns with the gene expression profiles presented in Figure 4, offering a valuable basis to interpret the observed molecular patterns. By correlating phenotypic traits with molecular mechanisms, this approach highlights the relationship between tolerance classifications and the underlying genetic drivers of drought resilience. The observed variability in results across treatments reflects the dynamic and complex nature of drought stress responses in cowpeas [45]. These variations may arise from several factors, including differences in the severity and duration of stress, cultivar-specific genetic traits, and the physiological state of the plants at the time of sampling [46]. Additionally, it highlights the need for further research using advanced tools to unravel the intricate regulatory networks governing drought adaptation.
Among the biological processes affected by abiotic stresses, photosynthesis-related processes are the most sensitive to water deficit and subsequent recovery [47]. Photosynthetic parameters, including the chlorophyll content, are essential indicators of drought tolerance, as they reflect the plant’s photosynthetic capacity under stress [48]. The results showed increased expression of the PSII gene in California Blackeye #5 and Lobia-I-Sefade at 7 DPTI. However, as drought stress intensified, PSII transcript levels decreased across all cultivars, particularly by 28 DPTI, suggesting a reduction in photosynthetic activity. Upon rewatering, PSII activity was restored to varying degrees in each cultivar (Figure 4a). The surge in PSII gene expression during the initial 24 h recovery period suggests that plants were resuming photosynthesis. After seven days of recovery, California Blackeye #5 and TVu11987 showed the highest percentage of recovered plants (Table S2), indicating greater drought tolerance. This suggests that these cultivars temporarily halted photosynthetic activity in response to water-deficit stress, allowing them to resume normal functions under optimal conditions, which contributed to the observed recovery. These findings align with those of Zhang et al. [49], who observed the downregulation of PSII-related genes under severe drought stress and upregulation during recovery in maize seedlings. Although the post-recovery chlorophyll concentration was not assessed, the chlorophyll content declined as drought stress increased (Table S2), in parallel with the decrease in PSII transcript levels across cultivars (Figure 4a). The recovery of photosynthetic activity was evidenced by new leaf growth in recovered plants, particularly in California Blackeye #5 and TVu11987, which resembled control plants (Figure 3).
Drought stress significantly altered the expression of S-phase kinase-associated protein 1 (SKP1) across all time points. SKP1 encodes the SKP1 protein, an essential component of the SCF (SKP1-RBX1-CUL1-F-box protein) E3 ubiquitin ligase complex, which facilitates interactions between cullin and F-box proteins. SCF complexes regulate multiple phytohormone signaling pathways, including those for abscisic acid (ABA), auxin, jasmonic acid, brassinosteroids, gibberellins, and ethylene in various plant species [50]. In this study, SKP1 transcript accumulation increased significantly in Aloomba at 7 DPTI (Figure 4b). In other cultivars, its expression increased by 14 DPTI, with the highest transcript accumulation observed in California Blackeye #5, followed by TVu11987, Aloomba, K929, TVu2428, and Lobia-I-Sefade. An increasing trend of SKP1 expression was observed in California Blackeye #5 at both at 28 DPTI and recovery, while drought-sensitive cultivars such as Mississippi Silver and TVu2428 showed lower expression levels. SKP1 has been previously characterized in Vigna radiata as responsive to drought conditions [23]. These results indicate an increased SKP1 expression in cowpeas under drought conditions, with the highest expression noted in the drought-tolerant cultivar California Blackeye #5 at 28 DPTI. A significant increase was also observed in the promising tolerant cultivar TVu11987 at 14 DPTI and recovery. The increased SKP1 expression in these cultivars underscores the importance of this regulatory protein and suggests a strong association with the phenotypic traits that underpin drought tolerance in California Blackeye #5 and TVu11987.
Abscisic acid (ABA) a crucial plant hormone associated with drought tolerance that mediates early stress responses, such as stomatal closure, to reduce water loss through transpiration and inhibit photosynthesis [51,52]. The enzyme 9-cis epoxycarotenoid dioxygenase 1 is involved in ABA biosynthesis [51]. At 7 DPTI, our study found that NCED1 expression did not increase significantly in most cultivars; however, Lobia demonstrated markedly lower expression compared to other cultivars. This suggests that drought stress at this stage may not have been severe enough to elicit a pronounced ABA-mediated response (Figure 4c). At 14 DPTI, however, NCED1 transcript accumulation increased significantly in the promising drought-tolerant cultivar TVu11987, followed by California Blackeye #5, TVu2428, Aloomba, K929, and Lobia-I-Sefade. Conversely, Mississippi Silver recorded the lowest NCED1 expression, highlighting differences in ABA pathway activation among cultivars. By 28 DPTI, NCED1 expression had decreased across all cultivars, with Mississippi Silver displaying the lowest gene expression level. This reduction suggests a potential adaptation or adjustment in response to prolonged drought stress. After rewatering, California Blackeye #5 exhibited a 63.3-fold increase in NCED1 expression, followed by increases in TVu11987 (23.8-fold), K929 (4.8-fold), Lobia-I-Sefade (2.5-fold), and Aloomba (1.5-fold). In contrast, the drought-sensitive cultivars Mississippi Silver and TVu2428 showed minimal increases in NCED1 expression, at 0.3- and 0.7-fold, respectively. This differential response suggests that drought-tolerant cultivars may rely more on ABA-mediated signaling during recovery. Increased NCED1 expression may boost endogenous ABA levels, aiding in physiological recovery, which could include enhancing hydraulic conductivity and antioxidant activity, and promoting root cell elongation to facilitate recovery from a water deficit [53,54]. In addition, a recently published study by Xiong et al. [55] highlights ABA’s role in shaping root growth angles in crops like rice and maize, enabling access to deeper subsoil water during drought. This suggests that ABA-mediated signaling contributes not only to water conservation but also to enhanced water acquisition, supporting recovery. In drought-tolerant cultivars, these complementary roles may explain their reliance on ABA during stress and recovery phases.
The expression of leucine-rich repeat receptor-like kinases (RLKs) was significantly influenced by drought stress across the tested cowpea cultivars. RLK, a large gene family with over 600 members in plants, plays crucial roles in developmental processes, signaling cascades, and disease resistance [56]. At 7 DPTI, the highest RLK expression was recorded in cultivar TVu2428 (2.2-fold), followed by Aloomba (1.7-fold), TVu11987 (1.2-fold), and Mississippi Silver (1.0-fold), while its expression decreased in California Blackeye #5 (0.7-fold), Lobia-I-Sefade (0.3-fold), and K929 (0.8-fold). By 14 DPTI, RLK expression increased in all cultivars, with the most significant transcript accumulation observed in drought-tolerant California Blackeye #5, showing an 11.6-fold increase relative to its control, followed by TVu11987 (8.4-fold), K929 (3.8-fold), TVu2428 (3.4-fold), Aloomba (2.8-fold), Lobia-I-Sefade (1.9-fold), and Mississippi Silver (1.3-fold). Under drought stress at 28 DPTI, RLK expression was repressed compared to control conditions. However, during recovery, RLK transcript levels rose in all drought-tolerant cultivars, while sensitive cultivars such as Mississippi Silver and TVu2428 showed minimal increases (Figure 4d). RLKs have been reported to respond to various abiotic stresses, including drought, cold, salt, calcium signaling, and antioxidant defenses [56,57]. Previous studies indicate that RLKs interact with abscisic acid (ABA) signaling pathways, with ABA inducing the expression of stress-related RLK genes, leading to adaptive physiological responses [58]. This study aligns with those findings, as the expression profile of NCED1, the essential gene in ABA biosynthesis, was similar to that of RLK in the examined cowpea cultivars under drought conditions. Consequently, RLK could serve as a potential marker gene for drought tolerance screening in cowpeas.
Early response to dehydration 14 (ERD14) is a member of the dehydrin gene family that is known to be induced by various environmental stressors, including drought [59]. In our study, at 7 DPTI, the ERD14 transcript was upregulated 3.3-fold in California Blackeye #5, while it was downregulated in the remaining cultivars. As drought stress increased, ERD14 expression decreased in California Blackeye #5. However, at 14, DPTI transcript levels increased to 3.7-fold in TVu11987, followed by Aloomba (3.2-fold), TVu2428 (1.7-fold), and Mississippi Silver (1.7-fold), whereas Lobia-I-Sefade displayed a decrease in transcript abundance at this time point. During the extended drought stress at 28 DPTI, ERD14 transcript levels surged 3.3-fold in Lobia-I-Sefade, while other cultivars exhibited downregulation (Figure 4e). Notably, at 24 h post-rewatering, the expression levels were reduced across all cultivars, indicating that the ERD14 expression pattern differed by genotype under varying drought stress levels. These findings suggest that ERD14 expression under drought stress is genotype-dependent and varies with the drought intensity. As the levels intensified, ERD14 transcripts accumulated, yet further stress escalation led to reduced expression, as did the recovery phase. This trend is consistent with observations in wheat, where similar responses to drought stress and recovery were reported [60,61].

4. Conclusions

This study investigated drought stress responses in cowpeas at both the phenotypic and molecular levels, providing groundwork for future breeding efforts in abiotic stress tolerance. Significant variations were detected among the cowpea cultivars in drought tolerance traits such as the chlorophyll content, plant greenness, and post-drought recovery. These variations underscore the potential of specific cultivars with enhanced drought tolerance traits for breeding programs. At the molecular level, the expression of five drought-responsive genes (PSII, NCED1, SKP1, RLK, and ERD14) varied significantly, with higher transcript accumulation observed in drought-tolerant cultivars. To better understand these differences, future research should exploit gene sequencing to investigate genetic polymorphisms within these genes. Identifying such variations can explain the observed gene expression differences and guide the development of molecular markers for targeted breeding. Our study suggests vital roles for these genes in drought tolerance mechanisms and highlights the need for further exploration of additional drought-responsive genes under controlled and field conditions. Notably, the peak expression of these genes occurred at 14 days post-treatment, suggesting that this is an optimal time point for future transcriptomic and metabolomic studies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijpb16010025/s1, Supplementary Table S1: Statistical significance from the Analysis of Variance (ANOVA) for drought treatments, cultivar, time, and their interactions on unifoliate and trifoliate leaf chlorophyll content, plant greenness, and recovery rate after rewatering in cowpea cultivars under progressive drought stress and control conditions; Supplementary Table S2: Variations among the seventeen cowpea cultivars for studied traits under control, drought stress, and recovery.

Author Contributions

Conceptualization, I.P.R., M.E., and C.B.; methodology, I.P.R., M.E., and D.M.; software, I.P.R., and M.P.O.; validation, M.E., and C.B.; formal analysis, I.P.R., and M.P.O.; investigation, I.P.R.; resources, C.B., and M.E.; data curation, I.P.R.; writing—original draft preparation, I.P.R.; writing—review and editing, G.C.B., D.M., O.I., M.P.O., C.B., and M.E.; visualization, I.P.R., and O.I.; supervision, C.B., M.E., and G.C.B.; project administration, M.E.; funding acquisition, C.B. All authors have read and agreed to the published version of the manuscript.

Funding

The authors thank the contribution of the College of Agriculture, Environment and Nutrition Sciences and George Washinton Carver Agricultural Experiment Station. This research was funded by USDA-NIFA, the Evans Allen program grant No. ALX-FVC-18, project accession no. 1017559 and grant number 2017-38821-26414-GE, Tuskegee University Plant Biotech and Genomics Research Laboratory. The APC was funded by Evans Allen program grant No. ALX-FVC-18, project accession no. 1017559.

Data Availability Statement

All the data are already presented in the main manuscript. If further information or explanation is required, contact the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Budak, H.; Kantar, M.; Kurtoglu, K.Y. Drought Tolerance in Modern and Wild Wheat. Sci. World J. 2013, 2013, 548246. [Google Scholar] [CrossRef] [PubMed]
  2. Pruthvi, V.; Rama, N.; Govind, G.; Nataraja, K.N. Expression analysis of drought stress specific genes in Peanut (Arachis hypogaea, L.). Physiol. Mol. Biol. Plants 2013, 19, 277–281. [Google Scholar] [CrossRef]
  3. Carvalho, M.; Castro, I.; Moutinho-Pereira, J.; Correia, C.; Egea-Cortines, M.; Matos, M.; Rosa, E.; Carnide, V.; Lino-Neto, T. “Evaluating stress responses in cowpea under drought stress. J. Plant Physiol. 2019, 241, 153001. [Google Scholar] [CrossRef]
  4. Dadson, R.B.; Hashem, F.M.; Javaid, I.; Joshi, J.; Allen, A.L.; Devine, T.E. Effect of Water Stress on the Yield of Cowpea (Vigna unguiculata L. Walp.) Genotypes in the Delmarva Region of the United States. J Agron. Crop Sci. 2005, 191, 210–217. [Google Scholar] [CrossRef]
  5. Liang, G.; Liu, J.; Zhang, J.; Guo, J. Effects of drought stress on photosynthetic and physiological parameters of tomato. J. Am. Soc. Hortic. Sci. 2020, 145, 12–17. [Google Scholar] [CrossRef]
  6. Ahmed, K.; Shabbir, G.; Ahmed, M.; Noor, S.; Mohi Ud Din, A.; Qamar, M.; Rehman, N. Expression profiling of TaARGOS homoeologous drought responsive genes in bread wheat. Sci. Rep. 2022, 12, 3595. [Google Scholar] [CrossRef]
  7. Fang, Y.; Xiong, L. General mechanisms of drought response and their application in drought resistance improvement in plants. Cell. Mol. Life Sci. 2015, 72, 673–689. [Google Scholar] [CrossRef]
  8. Melloul, M.; Iraqi, D.; El Alaoui, M.; Erba, G.; Alaoui, S.; Ibriz, M.; Elfahime, E. Identification of differentially expressed genes by cDNA-AFLP technique in response to drought stress in Triticum durum. Food Technol. Biotechnol. 2014, 52, 479–488. [Google Scholar] [CrossRef]
  9. Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional Regulatory Networks in Cellular Responses and Tolerance to Dehydration and Cold Stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef]
  10. Yang, S.; Vanderbeld, B.; Wan, J.; Huang, Y. Narrowing down the targets: Towards successful genetic engineering of drought-tolerant crops. Mol. Plant 2010, 3, 469–490. [Google Scholar] [CrossRef] [PubMed]
  11. Aggarwal, P.K. Global climate change and Indian horticulture. Indian J. Agric. Sci. 2008, 78, 911–919. [Google Scholar] [CrossRef]
  12. Liang, C.; Wang, W.; Wang, J.; Ma, J.; Li, C.; Zhou, F.; Zhang, S.; Yu, Y.; Zhang, L.; Li, W.; et al. Identification of differentially expressed genes in sunflower (Helianthus annuus) leaves and roots under drought stress by RNA sequencing. Bot. Stud. 2017, 58, 1–11. [Google Scholar] [CrossRef] [PubMed]
  13. Gnankambary, K.; Sawadogo, N.; Diéni, Z.; Batieno, T.B.J.; Tignegré, J.B.D.S.; Sawadogo, M.; Ouédraogo, T.J. Assessment of Cowpea (Vigna unguiculata (L.) Walp.) Mutant Lines for Drought Tolerance. Int. J. Agron. 2020, 2020, 8823498. [Google Scholar] [CrossRef]
  14. Transparency Market Research. Cowpeas Market|Global Industry Report. Available online: https://www.transparencymarketresearch.com/cowpeas-market.html (accessed on 13 September 2021).
  15. Boukar, O.; Belko, N.; Chamarthi, S.; Togola, A.; Batieno, J.; Owusu, E.; Haruna, M.; Diallo, S.; Umar, M.L.; Olufajo, O.; et al. Cowpea (Vigna unguiculata): Genetics, genomics and breeding. Plant Breed. 2018, 138, 415–424. [Google Scholar] [CrossRef]
  16. Olorunwa, O.J.; Shi, A.; Barickman, T.C. Varying drought stress induces morpho-physiological changes in cowpea (Vigna unguiculata (L.) genotypes inoculated with Bradyrhizobium japonicum. Plant Stress 2021, 2, 100033. [Google Scholar] [CrossRef]
  17. Ravelombola, W.; Shi, A.; Qin, J.; Weng, Y.; Bhattarai, G.; Zia, B.; Zhou, W.; Mou, B. Investigation on various aboveground traits to identify drought tolerance in cowpea seedlings. HortScience 2018, 53, 1757–1765. [Google Scholar] [CrossRef]
  18. Ritte, I.P.; Egnin, M.; Idehen, O.; Mortley, D.; Bernard, G.C.; Binagwa, P.H.; Brown, A.P.; Bonsi, C.K. Evaluation of Cowpea Morpho-physiological and Yield Responses to Vegetative and Pre-Anthesis Water-Deficit Stress Tolerance under Greenhouse Conditions. Eur. J. Appl. Sci. 2022, 10, 391–411. [Google Scholar] [CrossRef]
  19. Cui, Q.; Xiong, H.; Yufeng, Y.; Eaton, S.; Imamura, S.; Santamaria, J.; Ravelombola, W.; Mason, R.E.; Wood, L.; Mozzoni, L.A.; et al. Evaluation of drought tolerance in Arkansas Cowpea lines at seedling stage. HortScience 2020, 55, 1132–1143. [Google Scholar] [CrossRef]
  20. Nkoana, K.D.; Gerrano, A.S.; Gwata, E.T. Evaluation of diverse cowpea [Vigna unguiculata (L.) walp.] germplasm accessions for drought tolerance. Legume Res. 2019, 42, 168–172. [Google Scholar] [CrossRef]
  21. Singh, B.B.; Mai-Kodomi, Y.; Terao, T. A simple screening method for drought tolerance in cowpes. Indian J. Genet. 1999, 59, 211–220. [Google Scholar]
  22. Verbree, D.A.; Singh, B.B.; Payne, W.A. Genetics and Heritability of Shoot Drought Tolerance in Cowpea Seedlings. Crop Sci. 2015, 55, 146–153. [Google Scholar] [CrossRef]
  23. Bharadwaj, N.; Barthakur, S.; Biswas, A.D.; Kumar Das, M.; Kour, M.; Ramteke, A.; Gogoi, N. Transcript expression profiling in two contrasting cultivars and molecular cloning of a SKP-1 like gene, a component of SCF-ubiquitin proteasome system from mungbean Vigna radiate L. Sci. Rep. 2019, 9, 8103. [Google Scholar] [CrossRef] [PubMed]
  24. Iuchi, S.; Yamaguchi-Shinozaki, K.; Urao, T.; Terao, T.; Shinozaki, K. Novel drought-inducible genes in the highly drought-tolerant cowpea: Cloning of cDNAs and analysis of the expression of the corresponding genes. Plant Cell Physiol. 1996, 37, 1073–1082. [Google Scholar] [CrossRef]
  25. Liu, Y.; Wang, L.; Zhang, T.; Yang, X.; Li, D. Functional characterization of KS-Type dehydrin ZmDHN13 and its related conserved domains under oxidative stress. Sci. Rep. 2017, 7, 7361. [Google Scholar] [CrossRef] [PubMed]
  26. Iuchi, S.; Kobayashi, M.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol. 2000, 123, 553–562. [Google Scholar] [CrossRef] [PubMed]
  27. Ippolito, S.D.; Rey-Burusco, M.F.; Feingold, S.E.; Guevara, M.G. Role of proteases in the response of plants to drought. Plant Physiol. Biochem. 2021, 168, 1–9. [Google Scholar] [CrossRef]
  28. Urano, K.; Maruyama, K.; Ogata, Y.; Morishita, Y.; Takeda, M.; Sakurai, N.; Suzuki, H.; Saito, K.; Shibata, D.; Kobayashi, M.; et al. Characterization of the ABA-regulated global responses to dehydration in Arabidopsis by metabolomics. Plant J. 2009, 57, 1065–1078. [Google Scholar] [CrossRef] [PubMed]
  29. Hermans, C.; Porco, S.; Verbruggen, N.; Bush, D.R. Chitinase-like protein CTL1 plays a role in altering root system architecture in response to multiple environmental conditions. Plant Physiol. 2010, 152, 904–917. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  31. Fatokun, C.A.; Boukar, O.; Muranaka, S. Evaluation of cowpea (Vigna unguiculata (L.) Walp.) germplasm lines for tolerance to drought. Plant Genet. Resour. Characterisation Util. 2012, 10, 171–176. [Google Scholar] [CrossRef]
  32. Owusu, E.Y.; Amegbor, I.K.; Mohammed, H.; Kusi, F.; Atopkle, I.; Sie, E.K.; Ishahku, M.; Zakaria, M.; Iddrisu, S.; Kendey, H.A.; et al. Genotype × environment interactions of yield of cowpea (Vigna unguiculata (L.) Walp) inbred lines in the Guinea and Sudan Savanna ecologies of Ghana. J. Crop Sci. Biotechnol. 2020, 23, 453–460. [Google Scholar] [CrossRef]
  33. Jain, D.; Chattopadhyay, D. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance. BMC Plant Biol. 2010, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
  34. Polania, J.; Poschenrieder, C.; Rao, I.; Beebe, S. Root traits and their potential links to plant ideotypes to improve drought resistance in common bean. Theor. Exp. Plant Physiol. 2017, 29, 143–154. [Google Scholar] [CrossRef]
  35. Rong-hual, L.I.; Pei-pol, G.U.O.; Baumz, M.; Grand, S.; Ceccarelli, S. Evaluation of Chlorophyll Content and Fluorescence Parameters as Indicators of Drought Tolerance in Barley. Agric. Sci. China 2006, 5, 751–757. [Google Scholar] [CrossRef]
  36. Mai-Kodomi, Y.; Singh, B.B.; Terao, T.; Myers, O.; Yopp, J.H.; Gibson, P.J. Two mechanisms of drought tolerance in cowpea. Indian J. Genet. Plant Breed. 1999, 59, 309–316. [Google Scholar]
  37. Mai-Kodomi, Y.; Singh, B.B.; Terao, T.; Myers, O.; Yopp, J.H.; Gibson, P.J. Inheritance of drought tolerance in cowpea. Indian J. Genet. Plant Breed. 1999, 59, 317–323. [Google Scholar]
  38. Kuroda, M.; Ozawa, T.; Imagawa, H. Changes in chloroplast peroxidase activities in relation to chlorophyll loss in barley leaf segments. Physiol. Plant. 1990, 80, 555–560. [Google Scholar] [CrossRef]
  39. Xu, W.; Rosenow, D.T.; Nguyen, H.T. Short Communication Stay green trait in grain sorghum relationship between visual rating and leaf chlorophyll concentration. Plant Breed. 2000, 119, 365–367. [Google Scholar] [CrossRef]
  40. Nunes, C.; Moreira, R.; Pais, I.; Semedo, J.; Simões, F.; Veloso, M.M.; Scotti-Campos, P. Cowpea Physiological Responses to Terminal Drought—Comparison between Four Landraces and a Commercial Variety. Plants 2022, 11, 593. [Google Scholar] [CrossRef]
  41. Kamal, N.M.; Gorafi, Y.S.A.; Abdelrahman, M.; Abdellatef, E.; Tsujimoto, H. Stay-Green Trait: A Prospective Approach for Yield Potential, and Drought and Heat Stress Adaptation in Globally Important Cereals. Int. J. Mol. Sci. 2019, 20, 5837. [Google Scholar] [CrossRef]
  42. Guo, P.; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R.; Von Korff, M.; Varshney, R.K.; Graner, A.; Valkoun, J. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. J. Exp. Bot. 2009, 60, 3531–3544. [Google Scholar] [CrossRef] [PubMed]
  43. Ingram, J.; Bartels, D. The molecular basis of dehydration tolerance in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 377–403. [Google Scholar] [CrossRef] [PubMed]
  44. Sales, C.R.G.; Ribeiro, R.V.; Silveira, J.A.G.; Machado, E.C.; Martins, M.O.; Lagôa, A.M.M.A. Superoxide dismutase and ascorbate peroxidase improve the recovery of photosynthesis in sugarcane plants subjected to water deficit and low substrate temperature. Plant Physiol. Biochem. 2013, 73, 326–336. [Google Scholar] [CrossRef] [PubMed]
  45. Agbicodo, E.M.; Fatokun, C.A.; Muranaka, S.; Visser, R.G.F.; Van Der, C.G.L. Breeding drought tolerant cowpea: Constraints, accomplishments, and future prospects. Euphytica 2009, 167, 353–370. [Google Scholar] [CrossRef]
  46. De Vega, J.J.; Teshome, A.; Klaas, M.; Grant, J.; Finnan, J.; Barth, S. Physiological and transcriptional response to drought stress among bioenergy grass Miscanthus species. Biotechnol. Biofuels 2021, 14, 1–13. [Google Scholar] [CrossRef] [PubMed]
  47. Min, H.; Chen, C.; Wei, S.; Shang, X.; Sun, M.; Xia, R.; Liu, X.; Hao, D.; Chen, H.; Xie, Q. Identification of Drought Tolerant Mechanisms in Maize Seedlings Based on Transcriptome Analysis of Recombination Inbred Lines. Front. Plant Sci. 2016, 7, 1080. [Google Scholar] [CrossRef] [PubMed]
  48. Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef]
  49. Zhang, X.; Lei, L.; Lai, J.; Zhao, H.; Song, W. Effects of drought stress and water recovery on physiological responses and gene expression in maize seedlings. BMC Plant Biol. 2018, 18, 1–16. [Google Scholar] [CrossRef]
  50. Dreher, K.; Callis, J. Ubiquitin, hormones and biotic stress in plants. Ann. Bot. 2007, 99, 787–822. [Google Scholar] [CrossRef] [PubMed]
  51. Iuchi, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T.; Tabata, S.; Kakubari, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 2001, 27, 325–333. [Google Scholar] [CrossRef] [PubMed]
  52. Chen, K.; Li, G.-J.; Bressan, R.A.; Song, C.-P.; Zhu, J.-K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol. 2020, 62, 25–54. [Google Scholar] [CrossRef] [PubMed]
  53. Daszkowska-Golec, A. The Role of Abscisic Acid in Drought Stress: How ABA Helps Plants to Cope with Drought Stress. In Drought Stress Tolerance in Plants; Molecular and Genetic Perspective; Hossain, M.A., Wani, S.H., Bhattacharjee, S., Burritt, D.J., Tran, L.-S.P., Eds.; Springer: Cham, Switzerland, 2016; pp. 123–151. [Google Scholar] [CrossRef]
  54. Nawaz, M.; Wang, Z. Abscisic Acid and Glycine Betaine Mediated Tolerance Mechanisms under Drought Stress and Recovery in Axonopus compressus: A New Insight. Sci. Rep. 2020, 10, 6942. [Google Scholar] [CrossRef]
  55. Xiong, Y.; Song, X.; Mehra, P.; Yu, S.; Li, Q.; Tashenmaimaiti, D.; Bennett, M.; Kong, X.; Bhosale, R.; Huang, G. ABA-auxin cascade regulates crop root angle in response to drought. Curr. Biol. 2025, 35, 542–553. [Google Scholar] [CrossRef] [PubMed]
  56. Ye, Y.; Ding, Y.; Jiang, Q.; Wang, F.; Sun, J.; Zhu, C. The role of receptor-like protein kinases (RLKs) in abiotic stress response in plants. Plant Cell Rep. 2016, 36, 235–242. [Google Scholar] [CrossRef] [PubMed]
  57. Morris, E.R.; Walker, J.C. Receptor-like protein kinases: The keys to response. Curr. Opin. Plant Biol. 2003, 6, 339–342. [Google Scholar] [CrossRef]
  58. Kim, H.; Hwang, H.; Hong, J.W.; Lee, Y.N.; Ahn, I.P.; Yoon, I.S.; Yoo, S.D.; Lee, S.; Lee, S.C.; Kim, B.G. A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth. J. Exp. Bot. 2012, 63, 1013–1024. [Google Scholar] [CrossRef] [PubMed]
  59. Kovacs, D.; Kalmar, E.; Torok, Z.; Tompa, P. Chaperone activity of ERD10 and ERD14, two disordered stress-related plant proteins. Plant Physiol. 2008, 147, 381–390. [Google Scholar] [CrossRef] [PubMed]
  60. Eichenberger, S. Dehydrin Patterns in Wheat Leaves During Severe Drought and Recovery. Master’s Thesis, Faculty of Science, University of Bern, Bern, Switzerland, 2009. [Google Scholar]
  61. Zhang, H.M.; Zhang, L.S.; Liu, L.; Zhu, W.N.; Yang, W.B. Changes of dehydrin profiles induced by drought in winter wheat at different developmental stages. Biol. Plant. 2013, 57, 797–800. [Google Scholar] [CrossRef]
Figure 1. The plant greenness scale was used to assess drought tolerance in cowpeas at the early vegetative growth stage: (1) completely green plants—tolerant, (2) plants losing greenness and becoming chlorotic—moderately tolerant, (3) plants were chlorotic with signs of necrosis—moderately susceptible, (4) severe chlorosis and necrosis—susceptible, and (5) completely dead plants—highly susceptible.
Figure 1. The plant greenness scale was used to assess drought tolerance in cowpeas at the early vegetative growth stage: (1) completely green plants—tolerant, (2) plants losing greenness and becoming chlorotic—moderately tolerant, (3) plants were chlorotic with signs of necrosis—moderately susceptible, (4) severe chlorosis and necrosis—susceptible, and (5) completely dead plants—highly susceptible.
Ijpb 16 00025 g001
Figure 2. Overview of the box experimental design, drought stress treatment application, and timeline for leaf sample collection. Green-colored boxes represent well-watered conditions, while orange-colored boxes indicate drought-stressed conditions; DAS, days after sowing; DPTI, days post-treatment initiation; AR, after rewatering.
Figure 2. Overview of the box experimental design, drought stress treatment application, and timeline for leaf sample collection. Green-colored boxes represent well-watered conditions, while orange-colored boxes indicate drought-stressed conditions; DAS, days after sowing; DPTI, days post-treatment initiation; AR, after rewatering.
Ijpb 16 00025 g002
Figure 3. Comparative phenotypic responses to progressive water-deficit stress among cowpea cultivars during early vegetative growth and recovery after rewatering. Under drought-stress conditions, plants showed wilting, a decreased chlorophyll content, and in some cases, plant death. Seven days after rewatering, most susceptible cultivars exhibited plant mortality, while tolerant cultivars resumed growth (yellow and red arrows indicate susceptible and tolerant cultivars, respectively).
Figure 3. Comparative phenotypic responses to progressive water-deficit stress among cowpea cultivars during early vegetative growth and recovery after rewatering. Under drought-stress conditions, plants showed wilting, a decreased chlorophyll content, and in some cases, plant death. Seven days after rewatering, most susceptible cultivars exhibited plant mortality, while tolerant cultivars resumed growth (yellow and red arrows indicate susceptible and tolerant cultivars, respectively).
Ijpb 16 00025 g003
Figure 4. Transcript expression profiles of PSII (a), SKP1 (b), NCED1 (c), RLK (d), and ERD14 (e) in seven cowpea cultivars under drought and control conditions. Twelve days after sowing, plants were subjected to a progressive drought stress period of 33 days, followed by rewatering. Recovery samples were collected at 24 h post-rewatering. Cultivars are denoted as CBE#5, California Blackeye #5; MSS, Mississippi Silver; Tvu-87, TVu11987; ALMB, Aloomba; Lobia, Lobia-I-Sefade; K-29, K929; and Tvu28, TVu2428. Gene expression levels were normalized by setting the control treatment value to 1 for each gene at each sampling date within the same cultivar. Relative expression levels for drought-treated samples are presented as fold changes compared to the corresponding control. Different letters (a, b, c, d) obtained from Tukey’s mean comparison test indicate significant differences among cultivars within the same sampling date (p < 0.05).
Figure 4. Transcript expression profiles of PSII (a), SKP1 (b), NCED1 (c), RLK (d), and ERD14 (e) in seven cowpea cultivars under drought and control conditions. Twelve days after sowing, plants were subjected to a progressive drought stress period of 33 days, followed by rewatering. Recovery samples were collected at 24 h post-rewatering. Cultivars are denoted as CBE#5, California Blackeye #5; MSS, Mississippi Silver; Tvu-87, TVu11987; ALMB, Aloomba; Lobia, Lobia-I-Sefade; K-29, K929; and Tvu28, TVu2428. Gene expression levels were normalized by setting the control treatment value to 1 for each gene at each sampling date within the same cultivar. Relative expression levels for drought-treated samples are presented as fold changes compared to the corresponding control. Different letters (a, b, c, d) obtained from Tukey’s mean comparison test indicate significant differences among cultivars within the same sampling date (p < 0.05).
Ijpb 16 00025 g004aIjpb 16 00025 g004b
Table 1. List of seventeen cowpea cultivars evaluated for drought stress tolerance.
Table 1. List of seventeen cowpea cultivars evaluated for drought stress tolerance.
#Plant NameAv. 1 Seed Size (mg)StatusOriginDrought SensitivityOther Traits
1.Mississippi Silver163.33Comm. Var.United StatesSusceptibleFusarium wilt (R), Root-knot nematodes (R)
2.Top Pick Brown 186.67Comm. Var.United StatesTolerantDiseases (R)
3.Top Pick Cream133.33Comm. Var.United StatesSusceptibleUnknown
4.Big Boy340.00Comm. Var.United StatesTolerantUnknown
5.California Blackeye #5186.67Comm. Var.United StatesTolerantFusarium wilt (R), Nematodes (R)
6.Lady90.00Comm. Var.United StatesTolerantUnknown
7.Pinkeye Purple Hull BVR176.67Comm. Var.United StatesTolerantBlack-eye Cowpea Mosaic Virus (R)
8.Black Crowder196.67Comm. Var.United StatesTolerantUnknown
9.TVu7362120.00AccessionNigeriaPromising Unknown
10.TVu11987143.33AccessionSudanPromising Unknown
11.LOBIA-I-SEFADE243.33AccessionAfghanistanPromising Unknown
12.UCR 242160.00AccessionTanzaniaSusceptible Unknown
13.TVnu 11330.00AccessionTanzaniaSusceptible Unknown
14.K929146.67AccessionIraqSusceptibleUnknown
15.White Acre130.00Comm. Var.United StatesSusceptibleEarly maturity
16.Aloomba203.28AccessionAustraliaTolerantUnknown
17.TVu2428182.31AccessionNigeriaSusceptibleUnknown
Av, average; Comm var, commercial variety; R, resistant. Phenotype information was obtained from [4,16,17,18].
Table 2. Representative list of the seven cowpea cultivars selected for molecular screening.
Table 2. Representative list of the seven cowpea cultivars selected for molecular screening.
#CultivarStatusDrought ResponsePhenotype Data
1.Mississippi SilverComm. cv, susceptibleSusceptible[4]
2.California Blackeye #5Comm. cv, tolerantTolerant[4]
3.TVu11987Accession, promising tolerantTolerant This study and [18]
4.Lobia-I-SefadeAccession, promising tolerantTolerant This study and [18]
5.K929Accession, susceptibleSusceptible This study and [18]
6.AloombaAccession, promising tolerantTolerant[17]
7.TVu2428Accession, susceptibleSusceptible[17]
K = known; U = unknown; Comm. cv = commercial cultivar.
Table 3. Primer sequences of target and reference genes utilized for real-time qPCR.
Table 3. Primer sequences of target and reference genes utilized for real-time qPCR.
#TypePrimerSequence (5′-3′)Size (bp)
1.PhotosynthesisPSIIFOR—CCTCCAGTAGATATTGATGGTATTCGTG
REV—GGAACCATGCATAGCACTGAATAGG
460
2.Abscisic acid biosynthesisNCED1FOR—TCCCTTCAAACACTCCACTTC
REV—AGTTCCCGGCGATTTGG
290
3.Stress and signal transductionRLKPFOR—GTTAGAAAGGCACAAACACAGA
REV—ACGGAGAAAGTGAAGATG TTTGG
700
4.Protein ubiquitinationSKP1FOR—ATTGCGAAAGGGGAAAATGATAG
REV—CTCAGCCTCTTCCTCCTCTGTA
500
5.LEA proteinERD14FOR—GAAGCCTCAGGAAGAGGTGA
REV—TCCTCCTCTGTCTTGGAGTGG
470
6.HousekeepingVuYLS8FOR—CTGGTGGACATAACGGAGGT
REV—GTTGTTTCCAGTGCCGAGAT
125
Table 4. Statistical significance from the analysis of variance (ANOVA) of drought treatments, cultivar, time, and their associated interactions for four traits in cowpea cultivars under progressive drought stress and control conditions.
Table 4. Statistical significance from the analysis of variance (ANOVA) of drought treatments, cultivar, time, and their associated interactions for four traits in cowpea cultivars under progressive drought stress and control conditions.
TraitConditionDescriptionTime (Days)DFSSMSFSource
Cultivar (Cul)Treatment (Trt)Time (Tm)Cul × TrtCul × TmCul × Tm × Trt
Chlorophyll contentControlUnifoliate leaf7161,355,92784,74531.95***-***-NS-
14161,624,113101,50737.21***--
Trifoliate leaf716747,92946,74621.71***-***-NS-
1416761,92647,62026.48***--
2116853,05453,31635.07***--
2816964,04260,25335.19***--
Chlorophyll contentStressUnifoliate leaf7162,345,703146,60648.94*****************
14161,657,461103,59128.03*********
Trifoliate leaf7161,186,06374,12919.23*****************
14161,857,810116,11319.50*********
21161,685,645105,35320.02*********
28161,421,35188,83422.78*********
Plant greennessStressWhole plant3316138.8068.675332.75***-----
RecoveryStressWhole plant411615,010.9938.1816.96***-----
Significance levels are indicated by ***, ** and NS, representing p < 0.001, p < 0.01, and p > 0.05, respectively, DF, degrees of freedom. The summarized ANOVA for each trait and its associated interactions is presented in Supplementary Table S1, providing a comprehensive analysis of variance across the evaluated factors.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ritte, I.P.; Egnin, M.; Bernard, G.C.; Mortley, D.; Idehen, O.; Okoma, M.P.; Bonsi, C. Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. Int. J. Plant Biol. 2025, 16, 25. https://doi.org/10.3390/ijpb16010025

AMA Style

Ritte IP, Egnin M, Bernard GC, Mortley D, Idehen O, Okoma MP, Bonsi C. Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. International Journal of Plant Biology. 2025; 16(1):25. https://doi.org/10.3390/ijpb16010025

Chicago/Turabian Style

Ritte, Inocent Paulin, Marceline Egnin, Gregory Christopher Bernard, Desmond Mortley, Osagie Idehen, Michelle Pamelas Okoma, and Conrad Bonsi. 2025. "Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars" International Journal of Plant Biology 16, no. 1: 25. https://doi.org/10.3390/ijpb16010025

APA Style

Ritte, I. P., Egnin, M., Bernard, G. C., Mortley, D., Idehen, O., Okoma, M. P., & Bonsi, C. (2025). Morpho-Physiological and Molecular Responses to Seedling-Stage Drought Stress in Different Cowpea Cultivars. International Journal of Plant Biology, 16(1), 25. https://doi.org/10.3390/ijpb16010025

Article Metrics

Back to TopTop