Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Cell Culture
2.3. Cell Proliferation Measurements
2.4. Immunofluorescence Detection of Proliferative Cell Nuclear Antigen (PCNA)
2.5. Cell Cycle Progression Analysis
2.6. Detection of Apoptotic Cells
2.7. Mitochondrial Membrane Potential (MMP) Assay
2.8. Reactive Oxygen Species (ROS) Assay
2.9. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.10. Cytosolic Calcium Ion Concentration Assay
2.11. Mitochondrial Matrix Calcium Ion Concentration Assay
2.12. Western Blotting
2.13. Statistical Analysis
3. Results
3.1. Fraxetin Suppresses the Proliferation of Huh7 and Hep3B Cells
3.2. Fraxetin Induces Cell Cycle Arrest and Apoptosis in Huh7 and Hep3B Cells
3.3. Fraxetin Induces a Loss of Mitochondrial Membrane Potential and Increases ROS Production in Huh7 and Hep3B Cells
3.4. Fraxetin Downregulated the Oxidative Stress-Related Genes in Human HCC Cells
3.5. Fraxetin Disrupts the Calcium Homeostasis in the Cytoplasmic and Mitochondrial Matrix of HCC Cells
3.6. Fraxetin Regulates the Proliferation of HCC Cells via the MAPK and PI3K Pathways
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Ikeda, M.; Morizane, C.; Ueno, M.; Okusaka, T.; Ishii, H.; Furuse, J. Chemotherapy for hepatocellular carcinoma: Current status and future perspectives. Jpn. J. Clin. Oncol. 2018, 48, 103–114. [Google Scholar] [CrossRef] [PubMed]
- Kudo, M. Targeted and immune therapies for hepatocellular carcinoma: Predictions for 2019 and beyond. World J. Gastroenterol. 2019, 25, 789–807. [Google Scholar] [CrossRef]
- Malla, R.R.; Kumari, S.; Kgk, D.; Momin, S.; Nagaraju, G.P. Nanotheranostics: Their role in hepatocellular carcinoma. Crit. Rev. Oncol. Hematol. 2020, 151, 102968. [Google Scholar] [CrossRef] [PubMed]
- Sohn, E.-H.; Koo, H.J.; Hang, D.T.T.; Jang, S.-A.; Namkoong, S.; Lim, J.D.; Kang, S.C. Protective effects of ellagic acid on ethanol-induced toxicity in hepatic HepG2 cells. Mol. Cell. Toxicol. 2013, 9, 249–256. [Google Scholar] [CrossRef]
- Wang, J.; Lu, M.L.; Dai, H.L.; Zhang, S.P.; Wang, H.X.; Wei, N. Esculetin, a coumarin derivative, exerts in vitro and in vivo antiproliferative activity against hepatocellular carcinoma by initiating a mitochondrial-dependent apoptosis pathway. Braz. J. Med. Biol. Res. 2015, 48, 245–253. [Google Scholar] [CrossRef] [PubMed]
- Emami, S.; Dadashpour, S. Current developments of coumarin-based anticancer agents in medicinal chemistry. Eur. J. Med. Chem. 2015, 102, 611–630. [Google Scholar] [CrossRef]
- Xia, Y.L.; Liang, S.C.; Zhu, L.L.; Ge, G.B.; He, G.Y.; Ning, J.; Lv, X.; Ma, X.C.; Yang, L.; Yang, S.L. Identification and characterization of human UDP-glucuronosyltransferases responsible for the glucuronidation of fraxetin. Drug Metab. Pharmacokinet. 2014, 29, 135–140. [Google Scholar] [CrossRef]
- Chen, X.; Ying, X.; Zhang, W.; Chen, Y.; Shi, C.; Hou, Y.; Zhang, Y. The hepatoprotective effect of fraxetin on carbon tetrachloride induced hepatic fibrosis by antioxidative activities in rats. Int. Immunopharmacol. 2013, 17, 543–547. [Google Scholar] [CrossRef]
- Kaneko, T.; Tahara, S.; Takabayashi, F. Inhibitory effect of natural coumarin compounds, esculetin and esculin, on oxidative DNA damage and formation of aberrant crypt foci and tumors induced by 1,2-dimethylhydrazine in rat colons. Biol. Pharm. Bull. 2007, 30, 2052–2057. [Google Scholar] [CrossRef]
- Liu, G.; Liu, Z.; Yan, Y.; Wang, H. Effect of fraxetin on proliferation and apoptosis in breast cancer cells. Oncol. Lett. 2017, 14, 7374–7378. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Wang, R.; Li, S.; Wang, Y.; Song, F.; Gu, Y.; Yuan, Y. Anti-fibrotic effects of Fraxetin on carbon tetrachloride-induced liver fibrosis by targeting NF-kappaB/IkappaBalpha, MAPKs and Bcl-2/Bax pathways. Pharmacol. Rep. 2019, 71, 409–416. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Lee, J.Y.; Lim, W.; You, S.; Song, G. Butylated hydroxyanisole exerts neurotoxic effects by promoting cytosolic calcium accumulation and endoplasmic reticulum stress in astrocytes. J. Agric. Food Chem. 2019, 67, 9618–9629. [Google Scholar] [CrossRef] [PubMed]
- Ham, J.; Kim, J.; Bazer, F.W.; Lim, W.; Song, G. Silibinin-induced endoplasmic reticulum stress and mitochondrial dysfunction suppress growth of endometriotic lesions. J. Cell. Physiol. 2019, 234, 4327–4341. [Google Scholar] [CrossRef] [PubMed]
- Ham, J.; You, S.; Lim, W.; Song, G. Bifenthrin impairs the functions of Leydig and Sertoli cells in mice via mitochondrion-endoplasmic reticulum dysregulation. Environ. Pollut. 2020, 266, 115174. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, L.; Deng, Y.; Zhao, P.; Deng, W.; Zhang, J.; Luo, J.; Li, R. Fraxetin suppresses proliferation of non-small-cell lung cancer cells via preventing activation of signal transducer and activator of transcription 3. Tohoku J. Exp. Med. 2019, 248, 3–12. [Google Scholar] [CrossRef]
- Wang, H.; Liu, Z.; Li, X.; Zhao, R.; Pu, Y.; Wu, H.; Guan, W. Shikonin causes apoptosis by disrupting intracellular calcium homeostasis and mitochondrial function in human hepatoma cells. Exp. Ther. Med. 2018, 15, 1484–1492. [Google Scholar] [CrossRef]
- Tosatto, A.; Sommaggio, R.; Kummerow, C.; Bentham, R.B.; Blacker, T.S.; Berecz, T.; Duchen, M.R.; Rosato, A.; Bogeski, I.; Szabadkai, G.; et al. The mitochondrial calcium uniporter regulates breast cancer progression via HIF-1alpha. EMBO Mol. Med. 2016, 8, 569–585. [Google Scholar] [CrossRef]
- Zhou, L.J.; Mo, Y.B.; Bu, X.; Wang, J.J.; Bai, J.; Zhang, J.W.; Cheng, A.B.; Ma, J.H.; Wang, Y.W.; Xie, Y.X. Erinacine facilitates the opening of the mitochondrial permeability transition pore through the inhibition of the PI3K/ Akt/GSK-3beta signaling pathway in human hepatocellular carcinoma. Cell. Physiol. Biochem. 2018, 50, 851–867. [Google Scholar] [CrossRef]
- Rouleau, L.; Antony, A.N.; Bisetto, S.; Newberg, A.; Doria, C.; Levine, M.; Monti, D.A.; Hoek, J.B. Synergistic effects of ascorbate and sorafenib in hepatocellular carcinoma: New insights into ascorbate cytotoxicity. Free Radic. Biol. Med. 2016, 95, 308–322. [Google Scholar] [CrossRef]
- Varghese, E.; Samuel, S.M.; Sadiq, Z.; Kubatka, P.; Liskova, A.; Benacka, J.; Pazinka, P.; Kruzliak, P.; Busselberg, D. Anti-cancer agents in proliferation and cell death: The calcium connection. Int. J. Mol. Sci. 2019, 20, 17. [Google Scholar] [CrossRef] [PubMed]
- Smaili, S.S.; Hsu, Y.T.; Carvalho, A.C.; Rosenstock, T.R.; Sharpe, J.C.; Youle, R.J. Mitochondria, calcium and pro-apoptotic proteins as mediators in cell death signaling. Braz. J. Med. Biol. Res. 2003, 36, 183–190. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, E.J.; Rutter, G.A. Mitochondrial calcium as a key regulator of mitochondrial ATP production in mammalian cells. Biochim. Biophys. Acta 2009, 1787, 1324–1333. [Google Scholar] [CrossRef] [PubMed]
- McConkey, D.J.; Orrenius, S. The role of calcium in the regulation of apoptosis. Biochem. Biophys. Res. Commun. 1997, 239, 357–366. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.D.; Kim, K.-Y.; Park, K.I.; Kim, S.-H.; Park, S.-G.; Yu, S.-N.; Kim, Y.-W.; Kim, D.S.; Chung, K.T.; Ahn, S.-C. Dual role of reactive oxygen species in autophagy and apoptosis induced by compound PN in prostate cancer cells. Mol. Cell. Toxicol. 2020, 17, 41–50. [Google Scholar] [CrossRef]
- Parks, R.J.; Murphy, E.; Liu, J.C. Mitochondrial permeability transition pore and calcium handling. Methods Mol. Biol. 2018, 1782, 187–196. [Google Scholar] [CrossRef]
- Andreyev, A.; Tamrakar, P.; Rosenthal, R.E.; Fiskum, G. Calcium uptake and cytochrome c release from normal and ischemic brain mitochondria. Neurochem. Int. 2018, 117, 15–22. [Google Scholar] [CrossRef]
- Jiang, X.M.; Zheng, D.L.; Lin, J.Y. Effects of nitric oxide on mitochondrial permeability transition and cytochrome C of human hepatocellular carcinoma cell lines. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 2004, 26, 519–523. [Google Scholar]
- Xu, H.; Zhang, J.; Wang, Q.; Li, Y.; Zhang, B. Fraxetin inhibits the proliferation of RL95-2 cells through regulation of metabolism. Int. J. Clin. Exp. Pathol. 2020, 13, 1500–1505. [Google Scholar]
- Guo, L.; Tan, K.; Wang, H.; Zhang, X. Pterostilbene inhibits hepatocellular carcinoma through p53/SOD2/ROS-mediated mitochondrial apoptosis. Oncol. Rep. 2016, 36, 3233–3240. [Google Scholar] [CrossRef]
- Brown, Z.J.; Fu, Q.; Ma, C.; Kruhlak, M.; Zhang, H.; Luo, J.; Heinrich, B.; Yu, S.J.; Zhang, Q.; Wilson, A.; et al. Carnitine palmitoyltransferase gene upregulation by linoleic acid induces CD4(+) T cell apoptosis promoting HCC development. Cell Death Dis. 2018, 9, 620. [Google Scholar] [CrossRef] [PubMed]
- Qu, Q.; Zeng, F.; Liu, X.; Wang, Q.J.; Deng, F. Fatty acid oxidation and carnitine palmitoyltransferase I: Emerging therapeutic targets in cancer. Cell Death Dis. 2016, 7, e2226. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.N.; Zeng, Z.L.; Lu, J.; Wang, Y.; Liu, Z.X.; He, M.M.; Zhao, Q.; Wang, Z.X.; Li, T.; Lu, Y.X.; et al. CPT1A-mediated fatty acid oxidation promotes colorectal cancer cell metastasis by inhibiting anoikis. Oncogene 2018, 37, 6025–6040. [Google Scholar] [CrossRef] [PubMed]
- Tempka, D.; Tokarz, P.; Chmielewska, K.; Kluska, M.; Pietrzak, J.; Rygielska, Z.; Virag, L.; Robaszkiewicz, A. Downregulation of PARP1 transcription by CDK4/6 inhibitors sensitizes human lung cancer cells to anticancer drug-induced death by impairing OGG1-dependent base excision repair. Redox Biol. 2018, 15, 316–326. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.; Zhong, M.; Yin, H.; Chen, Y.; Cao, Q.; Wang, C.; Ling, C. Emodin induces hepatocellular carcinoma cell apoptosis through MAPK and PI3K/AKT signaling pathways in vitro and in vivo. Oncol. Rep. 2016, 36, 961–967. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Lu, W.; Chen, M.; Gao, W.; Zhang, C.; Guo, B.; Yang, J. Combined effect of recombinant human adenovirus p53 and curcumin in the treatment of liver cancer. Exp. Ther. Med. 2020, 20, 18. [Google Scholar] [CrossRef]
- Huynh, H.; Soo, K.C.; Chow, P.K.; Tran, E. Targeted inhibition of the extracellular signal-regulated kinase kinase pathway with AZD6244 (ARRY-142886) in the treatment of hepatocellular carcinoma. Mol. Cancer Ther. 2007, 6, 138–146. [Google Scholar] [CrossRef]
- Tewari, D.; Patni, P.; Bishayee, A.; Sah, A.N.; Bishayee, A. Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. Semin. Cancer Biol. 2019. [Google Scholar] [CrossRef]
- Villanueva, A.; Chiang, D.Y.; Newell, P.; Peix, J.; Thung, S.; Alsinet, C.; Tovar, V.; Roayaie, S.; Minguez, B.; Sole, M.; et al. Pivotal role of mTOR signaling in hepatocellular carcinoma. Gastroenterology 2008, 135, 1972–1983. [Google Scholar] [CrossRef]
- Calvisi, D.F.; Wang, C.; Ho, C.; Ladu, S.; Lee, S.A.; Mattu, S.; Destefanis, G.; Delogu, S.; Zimmermann, A.; Ericsson, J.; et al. Increased lipogenesis, induced by AKT-mTORC1-RPS6 signaling, promotes development of human hepatocellular carcinoma. Gastroenterology 2011, 140, 1071–1083. [Google Scholar] [CrossRef]
- Keiser, M.J.; Roth, B.L.; Armbruster, B.N.; Ernsberger, P.; Irwin, J.J.; Shoichet, B.K. Relating protein pharmacology by ligand chemistry. Nat. Biotechnol. 2007, 25, 197–206. [Google Scholar] [CrossRef] [PubMed]
- Dai, H.Y.; Hong, C.C.; Liang, S.C.; Yan, M.D.; Lai, G.M.; Cheng, A.L.; Chuang, S.E. Carbonic anhydrase III promotes transformation and invasion capability in hepatoma cells through FAK signaling pathway. Mol. Carcinog. 2008, 47, 956–963. [Google Scholar] [CrossRef] [PubMed]
- Pastorekova, S.; Gillies, R.J. The role of carbonic anhydrase IX in cancer development: Links to hypoxia, acidosis, and beyond. Cancer Metastasis Rev. 2019, 38, 65–77. [Google Scholar] [CrossRef] [PubMed]
- Vaeteewoottacharn, K.; Kariya, R.; Dana, P.; Fujikawa, S.; Matsuda, K.; Ohkuma, K.; Kudo, E.; Kraiklang, R.; Wongkham, C.; Wongkham, S.; et al. Inhibition of carbonic anhydrase potentiates bevacizumab treatment in cholangiocarcinoma. Tumour Biol. 2016, 37, 9023–9035. [Google Scholar] [CrossRef] [PubMed]
Gene | Genebank No. | Froward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|---|
GAPDH | NM_001289745.3 | GGCTCTCCAGAACATCATCC | TTTCTAGACGGCAGGTCAGG |
SOD2 | NM_000636.4 | GACAAACCTCAGCCCTAACG | AACCTGAGCCTTGGACACC |
CAT | NM_001752.4 | GGTTCAGCTGACACAGTTCG | CCAACGAGATCCCAGTTACC |
CPT1A | NM_001031847.3 | GATCCACGATTCCACTCTGC | GCTTGCTGTCTCTCATGTGC |
OGG1 | NM_001354649.2 | CTCCACTGCACTGTGTACCG | TGAGCCAGGGTAACATCTAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, J.; Ham, J.; Hong, T.; Song, G.; Lim, W. Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B. Pharmaceutics 2021, 13, 112. https://doi.org/10.3390/pharmaceutics13010112
Song J, Ham J, Hong T, Song G, Lim W. Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B. Pharmaceutics. 2021; 13(1):112. https://doi.org/10.3390/pharmaceutics13010112
Chicago/Turabian StyleSong, Jisoo, Jiyeon Ham, Taeyeon Hong, Gwonhwa Song, and Whasun Lim. 2021. "Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B" Pharmaceutics 13, no. 1: 112. https://doi.org/10.3390/pharmaceutics13010112
APA StyleSong, J., Ham, J., Hong, T., Song, G., & Lim, W. (2021). Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B. Pharmaceutics, 13(1), 112. https://doi.org/10.3390/pharmaceutics13010112