Detection, Characterization and Sequencing of BTV Serotypes Circulating in Cuba in 2022
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sampling Frame
2.3. Molecular Analysis
2.3.1. Nucleic Acid Sample Preparation
2.3.2. BTV Group-Specific Real-Time RT-PCR
2.4. Virus Isolation
2.4.1. On KC Cells
2.4.2. On Embryonated Chicken Eggs
2.4.3. On BSR Cells
2.5. BTV Serotyping Using Subgroup-Specific RT-PCR and Sanger Sequencing
2.6. Virus Neutralization Test
2.7. Minion Sequencing
2.7.1. RNA Extraction and Validation
2.7.2. cDNA Synthesis and Amplification Using the SISPA Approach
2.7.3. Sequencing Using Oxford Nanopore Technology
2.8. Sequences Data Analysis
2.8.1. Sequencing Data Analysis
2.8.2. Phylogenetic Analyses
3. Results
3.1. Pan-BTV Real-Time RT-PCR Analyses
3.2. Viral Isolation
3.3. Serotype Determination
3.4. Full Genome Sequencing
3.5. Phylogenetic Analysis of S2 (VP2) and S6 (VP5) of the Cuban BTV Strains
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- International Committee on Taxonomy of Viruses. Available online: https://ictv.global/report/chapter/sedoreoviridae/sedoreoviridae/orbivirus (accessed on 8 November 2022).
- Walton, T.E. The history of bluetongue and a current global overview. Vet. Ital. 2004, 40, 31–38. [Google Scholar] [PubMed]
- WOAH-Listed Diseases. Available online: https://www.woah.org/en/what-we-do/animal-health-and-welfare/animal-diseases/ (accessed on 6 August 2021).
- Acevedo, A.M.; Hinojosa, Y.; Relova, D.; Perera, C.L. Bluetongue virus: A known virus, a current threat. Rev. Salud Anim. 2016, 38, 52–59. [Google Scholar]
- Zientara, S.; Sanchez-Vizcaino, J.M. Control of bluetongue in Europe. Vet. Microbiol. 2013, 165, 33–37. [Google Scholar] [CrossRef] [PubMed]
- Mertens, P.P.; Brown, F.; Sangar, D.V. Assignment of the genome segments of bluetongue virus type 1 to the proteins which they encode. Virology 1984, 135, 207–217. [Google Scholar] [CrossRef]
- Mohd Jaafar, F.; Attoui, H.; Bahar, M.W.; Siebold, C.; Sutton, G.; Mertens, P.P.; De Micco, P.; Stuart, D.I.; Grimes, J.M.; De Lamballerie, X. The structure and function of the outer coat protein VP9 of Banna virus. Structure 2005, 13, 17–28. [Google Scholar] [CrossRef]
- Roy, P. Bluetongue Virus Proteins And Particles And Their Role In Virus Entry, Assembly, And Release. Adv. Virus Res. 2005, 64, 69–123. [Google Scholar]
- Bumbarov, V.; Golender, N.; Erster, O.; Khinich, Y. Detection and isolation of Bluetongue virus from commercial vaccine batches. Vaccine 2016, 34, 3317–3323. [Google Scholar] [CrossRef]
- Jenckel, M.; Breard, E.; Schulz, C.; Sailleau, C.; Viarouge, C.; Hoffmann, B.; Hoper, D.; Beer, M.; Zientara, S. Complete coding genome sequence of putative novel bluetongue virus serotype 27. Genome Announc. 2015, 3, 10–1128. [Google Scholar] [CrossRef]
- Maan, S.; Maan, N.S.; Belaganahalli, M.N.; Rao, P.P.; Singh, K.P.; Hemadri, D.; Putty, K.; Kumar, A.; Batra, K.; Krishnajyothi, Y.; et al. Full-Genome Sequencing as a Basis for Molecular Epidemiology Studies of Bluetongue Virus in India. PLoS ONE 2015, 10, e0131257. [Google Scholar] [CrossRef]
- Ries, C.; Vogtlin, A.; Hussy, D.; Jandt, T.; Gobet, H.; Hilbe, M.; Burgener, C.; Schweizer, L.; Hafliger-Speiser, S.; Beer, M.; et al. Putative Novel Atypical BTV Serotype ‘36’ Identified in Small Ruminants in Switzerland. Viruses 2021, 13, 721. [Google Scholar] [CrossRef]
- Sun, E.C.; Huang, L.P.; Xu, Q.Y.; Wang, H.X.; Xue, X.M.; Lu, P.; Li, W.J.; Liu, W.; Bu, Z.G.; Wu, D.L. Emergence of a Novel Bluetongue Virus Serotype, China 2014. Transbound. Emerg. Dis. 2016, 63, 585–589. [Google Scholar] [CrossRef] [PubMed]
- Maclachlan, N.J.; Wilson, W.C.; Crossley, B.M.; Mayo, C.E.; Jasperson, D.C.; Breitmeyer, R.E.; Whiteford, A.M. Novel serotype of bluetongue virus, Western North America. Emerg. Infect. Dis. 2013, 19, 665–666. [Google Scholar] [CrossRef]
- Maclachlan, N.J.; Guthrie, A.J. Re-emergence of bluetongue, African horse sickness, and other orbivirus diseases. Vet. Res. 2010, 41, 35. [Google Scholar] [CrossRef] [PubMed]
- Mayo, C.; McDermott, E.; Kopanke, J.; Stenglein, M.; Lee, J.; Mathiason, C.; Carpenter, M.; Reed, K.; Perkins, T.A. Ecological Dynamics Impacting Bluetongue Virus Transmission in North America. Front. Vet. Sci. 2020, 7, 186. [Google Scholar] [CrossRef] [PubMed]
- Rivera, N.A.; Varga, C.; Ruder, M.G.; Dorak, S.J.; Roca, A.L.; Novakofski, J.E.; Mateus-Pinilla, N.E. Bluetongue and Epizootic Hemorrhagic Disease in the United States of America at the Wildlife-Livestock Interface. Pathogens 2021, 10, 915. [Google Scholar] [CrossRef] [PubMed]
- Lager, I.A. Bluetongue virus in South America: Overview of viruses, vectors, surveillance and unique features. Vet. Ital. 2004, 40, 89–93. [Google Scholar] [PubMed]
- MacLachlan, N.J.; Zientara, S.; Stallknecht, D.E.; Boone, J.D.; Goekjian, V.H.; Sailleau, C.; Balasuriya, U.B. Phylogenetic comparison of the S10 genes of recent isolates of bluetongue virus from the United States and French Martinique Island. Virus Res. 2007, 129, 236–240. [Google Scholar] [CrossRef] [PubMed]
- Homan, E.J.; Taylor, W.P.; de Ruiz, H.L.; Yuill, T.M. Bluetongue virus and epizootic haemorrhagic disease of deer virus serotypes in northern Colombian cattle. J. Hyg. 1985, 95, 165–172. [Google Scholar] [CrossRef]
- Viarouge, C.; Lancelot, R.; Rives, G.; Breard, E.; Miller, M.; Baudrimont, X.; Doceul, V.; Vitour, D.; Zientara, S.; Sailleau, C. Identification of bluetongue virus and epizootic hemorrhagic disease virus serotypes in French Guiana in 2011 and 2012. Vet. Microbiol. 2014, 174, 78–85. [Google Scholar] [CrossRef]
- Legisa, D.M.; Gonzalez, F.N.; Dus Santos, M.J. Bluetongue virus in South America, Central America and the Caribbean. Virus Res. 2014, 182, 87–94. [Google Scholar] [CrossRef]
- Martínez, N.; Alfonso, A.; Barrera, M. Primer reporte de bovinos seroreactores al virus de la lengua azul en Cuba. Rev. Salud Anim. 2011, 33, 131–133. [Google Scholar]
- Wechsler, S.J.; McHolland, L.E.; Tabachnick, W.J. Cell lines from Culicoides variipennis (Diptera: Ceratopogonidae) support replication of bluetongue virus. J. Invertebr. Pathol. 1989, 54, 385–393. [Google Scholar] [CrossRef] [PubMed]
- Clavijo, A.; Heckert, R.A.; Dulac, G.C.; Afshar, A. Isolation and identification of bluetongue virus. J. Virol. Methods 2000, 87, 13–23. [Google Scholar] [CrossRef]
- Maan, N.S.; Maan, S.; Belaganahalli, M.N.; Ostlund, E.N.; Johnson, D.J.; Nomikou, K.; Mertens, P.P. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2. PLoS ONE 2012, 7, e32601. [Google Scholar] [CrossRef] [PubMed]
- WOAH. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2021; WOAH: Paris, France, 2021. [Google Scholar]
- Chrzastek, K.; Lee, D.H.; Smith, D.; Sharma, P.; Suarez, D.L.; Pantin-Jackwood, M.; Kapczynski, D.R. Use of Sequence-Independent, Single-Primer-Amplification (SISPA) for rapid detection, identification, and characterization of avian RNA viruses. Virology 2017, 509, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Djikeng, A.; Halpin, R.; Kuzmickas, R.; Depasse, J.; Feldblyum, J.; Sengamalay, N.; Afonso, C.; Zhang, X.; Anderson, N.G.; Ghedin, E.; et al. Viral genome sequencing by random priming methods. BMC Genom. 2008, 9, 5. [Google Scholar] [CrossRef] [PubMed]
- Peserico, A.; Marcacci, M.; Malatesta, D.; Di Domenico, M.; Pratelli, A.; Mangone, I.; D’Alterio, N.; Pizzurro, F.; Cirone, F.; Zaccaria, G.; et al. Diagnosis and characterization of canine distemper virus through sequencing by MinION nanopore technology. Sci. Rep. 2019, 9, 1714. [Google Scholar] [CrossRef]
- Sghaier, S.; Sailleau, C.; Marcacci, M.; Thabet, S.; Curini, V.; Ben Hassine, T.; Teodori, L.; Portanti, O.; Hammami, S.; Jurisic, L.; et al. Epizootic Haemorrhagic Disease Virus Serotype 8 in Tunisia, 2021. Viruses 2023, 15, 16. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [PubMed]
- Maan, S.; Maan, N.S.; Nomikou, K.; Veronesi, E.; Bachanek-Bankowska, K.; Belaganahalli, M.N.; Attoui, H.; Mertens, P.P. Complete genome characterisation of a novel 26th bluetongue virus serotype from Kuwait. PLoS ONE 2011, 6, e26147. [Google Scholar] [CrossRef] [PubMed]
- Maan, S.; Maan, N.S.; Samuel, A.R.; Rao, S.; Attoui, H.; Mertens, P.P.C. Analysis and phylogenetic comparisons of full-length VP2 genes of the 24 bluetongue virus serotypes. J. Gen. Virol. 2007, 88 Pt 2, 621–630. [Google Scholar] [CrossRef] [PubMed]
- Garcia, A. Insectos hematófagos de Cuba. Poeyana Inst. Zool. Acad. Cienc. Cuba. 1976, 154, 1–15. [Google Scholar]
- McDonald, S.M.; Nelson, M.I.; Turner, P.E.; Patton, J.T. Reassortment in segmented RNA viruses: Mechanisms and outcomes. Nat. Rev. Microbiol. 2016, 14, 448–460. [Google Scholar] [CrossRef]
- Mintiens, K.; Meroc, E.; Mellor, P.S.; Staubach, C.; Gerbier, G.; Elbers, A.R.; Hendrickx, G.; De Clercq, K. Possible routes of introduction of bluetongue virus serotype 8 into the epicentre of the 2006 epidemic in north-western Europe. Prev. Vet. Med. 2008, 87, 131–144. [Google Scholar] [CrossRef]
- Aguilar-Vega, C.; Fernandez-Carrion, E.; Sanchez-Vizcaino, J.M. The possible route of introduction of bluetongue virus serotype 3 into Sicily by windborne transportation of infected Culicoides spp. Transbound. Emerg. Dis. 2019, 66, 1665–1673. [Google Scholar] [CrossRef]
- Reynolds, D.R.; Chapman, J.W.; Harrington, R. The migration of insect vectors of plant and animal viruses. Adv. Virus Res. 2006, 67, 453–517. [Google Scholar]
- Sellers, R.F.; Maarouf, A.R. Possible introduction of epizootic hemorrhagic disease of deer virus (serotype 2) and bluetongue virus (serotype 11) into British Columbia in 1987 and 1988 by infected Culicoides carried on the wind. Can. J. Vet. Res. 1991, 55, 367–370. [Google Scholar]
- Bishop, A.L.; Spohr, L.J.; Barchia, I.M. Effects of altitude, distance and waves of movement on the dispersal in Australia of the arbovirus vector, Culicoides brevitarsis Kieffer (Diptera: Ceratopogonidae). Prev. Vet. Med. 2004, 65, 135–145. [Google Scholar] [CrossRef] [PubMed]
- Hendrickx, G.; Gilbert, M.; Staubach, C.; Elbers, A.; Mintiens, K.; Gerbier, G.; Ducheyne, E. A wind density model to quantify the airborne spread of Culicoides species during north-western Europe bluetongue epidemic, 2006. Prev. Vet. Med. 2008, 87, 162–181. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequences 5′-3′ | Reference |
---|---|---|
FR26RV-N (50 µM) | GCCGGAGCTCTGCAGATATCNNNNNNN | [29] |
FR-BT_F (10 µM) | GCCGGAGCTCTGCAGATATCGTTAAAN | [30,31] |
FR-BT_R (10 µM) | GCCGGAGCTCTGCAGATATCGTAAGTN | [30,31] |
FR20RV (40 µM) | GCCGGAGCTCTGCAGATATC | [29] |
Province | Municipality | Identified BTV Serotype (Isolate Number) |
---|---|---|
Mayabeque | San José de las Lajas | 2 (1), 10 (1), 12 (1), 13 (1), 18 (1), 19 (1), 22 (1) |
Catalina de Guïnes | 10 (1), 12 (1), 18 (1) | |
Jaruco | 1 (1), 3 (1), 17 (2), 18 (1), 24 (1) | |
Havana | Guanabacoa | 1 (1), 6/22 (1) |
Cuban Strain | Accession Number (S1–10) |
---|---|
BTV1-23.01 (3124) | OR611726–OR611735 |
BTV1-23.02 (3190) | OR611736–OR611745 |
BTV2-23.01 (3111) | OR611746–OR611755 |
BTV3-23.01 (3180) | OR611756–OR611765 |
BTV10-23.01 (3088) | OR611766–OR611775 |
BTV10-23.02 (3037) | OR611776–OR611785 |
BTV12-23.01 (3062) | OR611786–OR611795 |
BTV12-23.2 (3090) | OR611796–OR611805 |
BTV13-23.1 (3097) | OR611806–OR611815 |
BTV17-23.01 (3158) | OR611816–OR611825 |
BTV17-23.02 (3178) | OR611826–OR611835 |
BTV18-23.01 (3079) | OR611836–OR611845 |
BTV18-23.02 (3110) | OR611846–OR611855 |
BTV18-23.03 (3155) | OR611856–OR611865 |
BTV19-23.01 (3100) | OR611866–OR611875 |
BTV22-23.01 (3089) | OR611876–OR611885 |
BTV24-23.01 (3134) | OR611886–OR611895 |
Cuban Strain | Seg. | AN | Length (bp) | Closest Homology | Closest Homology AN | Id % | Origin | Date |
---|---|---|---|---|---|---|---|---|
BTV1-(3124) | 2 | OR611727 | 2940 | BTV 1 USA/FL 10-044273 segment 2 | KX164020 | 98.0 | USA | 2010 |
6 | OR611731 | 1635 | BTV 1 USA/FL 10-044273 segment 6 | KX164024 | 98.4 | USA | 2010 | |
BTV1-(3190) | 2 | OR611737 | 2940 | BTV 1 USA/FL 10-044273 segment 2 | KX164020 | 98.0 | USA | 2010 |
6 | OR611741 | 1635 | BTV 1 USA/FL 10-044273 segment 6 | KX164024 | 98.4 | USA | 2010 | |
BTV2-(3111) | 2 | OR611747 | 2943 | BTV 2 USA VP2 gene | KF986495 | 98.0 | USA | 2006 |
6 | OR611751 | 1635 | BTV 2 FL99 13406-2 VP5 protein gene | AY855279 | 97.7 | USA | 1999 | |
BTV3-(3180) | 2 | OR611757 | 2935 | BTV 3 USA/FL 138555-30 L2 VP2 gene, | KY092160 | 97.7 | USA | 2001 |
6 | OR611761 | 1637 | BTV 3 USA2001/FL 138555-30 M6 VP5 gene | KY092047 | 92.6 | USA | 2001 | |
BTV10-(3088) | 2 | OR611767 | 2926 | BTV 10 (3937) VP2 gene | OP150186 | 94.9 | GUY | 2011 |
6 | OR611771 | 1638 | BTV 10 (3937) segment 6 | OP150190 | 97.0 | GUY | 2011 | |
BTV10-(3037) | 2 | OR611777 | 2926 | BTV 10 (3937) VP2 gene | OP150186 | 95.7 | GUY | 2011 |
6 | OR611781 | 1638 | BTV 10 (4138) segment 6 | OP185809 | 96.9 | GUY | 2011 | |
BTV12-(3062) | 2 | OR611787 | 2904 | BTV 12 USA/LA 12-046093 segment 2 | KX164090 | 97.3 | USA | 2012 |
6 | OR611791 | 1645 | BTV 12 USA/LA 12-046093 segment 6 | KX164094 | 97.9 | USA | 2012 | |
BTV12-(3090) | 2 | OR611797 | 2904 | BTV 12 USA/LA 12-046093 segment 2 | KX164090 | 97.3 | USA | 2012 |
6 | OR611801 | 1645 | BTV 12 USA/LA 12-046093 segment 6 | KX164094 | 97.8 | USA | 2012 | |
BTV13-(3097) | 2 | OR611807 | 2935 | BTV 13 FL99 22364-8 VP2 protein gene | AY855268 | 94.6 | USA | 1999 |
6 | OR611811 | 1637 | BTV 13 FL99 22364-8 VP5 protein gene | AY855280 | 94.6 | USA | 1999 | |
BTV17-(3158) | 2 | OR611817 | 2923 | BTV 17 FL99 12475 VP2 protein gene | AY855269 | 96.0 | USA | 1999 |
6 | OR611821 | 1638 | BTV 17 FL99 12475 VP5 protein gene | AY855281 | 96.4 | USA | 1999 | |
BTV17-(3178) | 2 | OR611827 | 2923 | BTV 17 FL99 12475 VP2 protein gene | AY855269 | 95.9 | USA | 1999 |
6 | OR611831 | 1638 | BTV 17 FL99 12475 VP5 protein gene | AY855281 | 96.6 | USA | 1999 | |
BTV18-(3079) | 2 | OR611837 | 2927 | BTV 18 USA/FL 15-008010 segment 2 | KX164120 | 97.7 | USA | 2014 |
6 | OR611841 | 1637 | BTV 18 USA/FL 15-008010 segment 6 | KX164124 | 97.7 | USA | 2014 | |
BTV18-(3110) | 2 | OR611847 | 2927 | BTV 18 USA/FL 15-008010 segment 2 | KX164120 | 97.9 | USA | 2014 |
6 | OR611851 | 1637 | BTV 18 USA/FL 15-008010 segment 6 | KX164124 | 97.5 | USA | 2014 | |
BTV18-(3155) | 2 | OR611857 | 2927 | BTV 18 USA/FL 15-008010 segment 2 | KX164120 | 98.0 | USA | 2014 |
6 | OR611861 | 1637 | BTV 18 USA/FL 15-008010 segment 6 | KX164124 | 97.4 | USA | 2014 | |
BTV19-(3100) | 2 | OR611867 | 2938 | BTV 19 USA/FL 280559-3 segment 2 | KX164130 | 98.1 | USA | 2003 |
6 | OR611871 | 1637 | BTV 19 USA/FL 280559-3 segment 6 | KX164134 | 98.3 | USA | 2003 | |
BTV22-(3089) | 2 | OR611877 | 2907 | BTV 22 USA/FL 402286 segment 2 | KX164140 | 97.0 | USA | 2005 |
6 | OR611881 | 1645 | BTV 22 USA/FL 402286 segment 6 | KX164144 | 97.6 | USA | 2005 | |
BTV24-(3134) | 2 | OR611887 | 2923 | BTV 24 USA/FL 520518 segment 2 | KX164150 | 96.4 | USA | 2007 |
6 | OR611891 | 1638 | BTV 17 FL99 12475 VP5 protein (S5) gene | AY855281 | 96.2 | USA | 1999 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Acevedo, A.M.; Postic, L.; Curiel, M.; Gondard, M.; Bréard, E.; Zientara, S.; Vorimore, F.; Tran, M.-L.; Turpaud, M.; Savini, G.; et al. Detection, Characterization and Sequencing of BTV Serotypes Circulating in Cuba in 2022. Viruses 2024, 16, 164. https://doi.org/10.3390/v16010164
Acevedo AM, Postic L, Curiel M, Gondard M, Bréard E, Zientara S, Vorimore F, Tran M-L, Turpaud M, Savini G, et al. Detection, Characterization and Sequencing of BTV Serotypes Circulating in Cuba in 2022. Viruses. 2024; 16(1):164. https://doi.org/10.3390/v16010164
Chicago/Turabian StyleAcevedo, Ana María, Lydie Postic, Maray Curiel, Mathilde Gondard, Emmanuel Bréard, Stéphan Zientara, Fabien Vorimore, Mai-Lan Tran, Mathilde Turpaud, Giovanni Savini, and et al. 2024. "Detection, Characterization and Sequencing of BTV Serotypes Circulating in Cuba in 2022" Viruses 16, no. 1: 164. https://doi.org/10.3390/v16010164
APA StyleAcevedo, A. M., Postic, L., Curiel, M., Gondard, M., Bréard, E., Zientara, S., Vorimore, F., Tran, M.-L., Turpaud, M., Savini, G., Lorusso, A., Marcacci, M., Vitour, D., Dujardin, P., Perera, C. L., Díaz, C., Obret, Y., & Sailleau, C. (2024). Detection, Characterization and Sequencing of BTV Serotypes Circulating in Cuba in 2022. Viruses, 16(1), 164. https://doi.org/10.3390/v16010164