Global Down-regulation of Gene Expression Induced by Mouse Mammary Tumor Virus (MMTV) in Normal Mammary Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. MMTV-Expressing Stable Cell Line
2.2. RNA Extraction, mRNA Sequencing, and Gene Expression Validation Using Real-Time Quantitative PCR (RT-qPCR)
2.3. RNAseq Data Pre-Processing
2.4. Identification of DEGs
2.5. Functional Enrichment of Gene Ontology (GO) and Pathway Analysis
2.6. Gene Sets/Pathways Enrichment Analysis
2.7. Construction of the Gene–Pathway Network, Protein–Protein Interaction (PPI) Network, and Hub Gene Network
2.8. Functional Analysis of Hub Genes with Current Data
2.9. Prediction of miRNAs
3. Results
3.1. Identification of DEGs in MMTV Infected Mammary Epithelial Cells
3.2. Gene Ontology (GO) Analysis of the DEGs
3.3. Gene Enrichment Analysis for the DEGs Associated with Different Pathways
3.4. Determination of the Interaction among Core Genes and Biological Pathways Involved upon MMTV Expression
3.5. Identification of Hub Genes
3.6. Identification of Central Pathway Dysregulated after MMTV Expression
3.7. Prediction of mRNA-miRNA Interaction
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Duesberg, P.H.; Blair, P.B. Isolation of the nucleic acid of mouse mammary tumor virus (MTV). Proc. Natl. Acad. Sci. USA 1966, 55, 1490–1497. [Google Scholar] [CrossRef] [PubMed]
- Cardiff, R.D.; Kenney, N. Mouse mammary tumor biology: A short history. Adv. Cancer Res. 2007, 98, 53–116. [Google Scholar] [PubMed]
- Nandni, S.; McGrath, C.M. Mammary Neoplasia in Mice. Adv. Cancer Res. 1973, 17, 353–414. [Google Scholar]
- Ross, S.R. MMTV infectious cycle and the contribution of virus-encoded proteins to transformation of mammary tissue. J. Mammary Gland. Biol. Neoplasia 2008, 13, 299–307. [Google Scholar] [CrossRef]
- Beutner, U.; Kraus, E.; Kitamura, D.; Rajewsky, K.; Huber, B.T. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J. Exp. Med. 1994, 179, 1457–1466. [Google Scholar] [CrossRef]
- Held, W.; Shakhov, A.N.; Izui, S.; Waanders, G.A.; Scarpellino, L.; MacDonald, H.R.; Acha-Orbea, H. Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus. J. Exp. Med. 1993, 177, 359–366. [Google Scholar] [CrossRef]
- Ross, S.R.; Schofield, J.J.; Farr, C.J.; Bucan, M. Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc. Natl. Acad. Sci. USA 2002, 99, 12386–12390. [Google Scholar] [CrossRef]
- Williams, C.; Helguero, L.; Edvardsson, K.; Haldosen, L.A.; Gustafsson, J.A. Gene expression in murine mammary epithelial stem cell-like cells shows similarities to human breast cancer gene expression. Breast Cancer Res. 2009, 11, R26. [Google Scholar] [CrossRef]
- Hook, L.M.; Agafonova, Y.; Ross, S.R.; Turner, S.J.; Golovkina, T.V. Genetics of mouse mammary tumor virus-induced mammary tumors: Linkage of tumor induction to the gag gene. J. Virol. 2000, 74, 8876–8883. [Google Scholar] [CrossRef]
- Faschinger, A.; Rouault, F.; Sollner, J.; Lukas, A.; Salmons, B.; Gunzburg, W.H.; Indik, S. Mouse mammary tumor virus integration site selection in human and mouse genomes. J. Virol. 2008, 82, 1360–1367. [Google Scholar] [CrossRef]
- Kozak, C.; Peters, G.; Pauley, R.; Morris, V.; Michalides, R.; Dudley, J.; Green, M.; Davisson, M.; Prakash, O.; Vaidya, A.; et al. A standardized nomenclature for endogenous mouse mammary tumor viruses. J. Virol. 1987, 61, 1651–1654. [Google Scholar] [CrossRef]
- Michalides, R.; van Deemter, L.; Nuss, R.R.; van Nie, R. Identification of the Mtv-2 gene responsible for the early appearance of mammary tumors in the GR mouse by nucleic acid hybridization. Proc. Natl. Acad. Sci. USA 1978, 75, 2368–2372. [Google Scholar] [CrossRef]
- Ross, S.R. Mouse mammary tumor virus molecular biology and oncogenesis. Viruses 2010, 2, 2000–2012. [Google Scholar] [CrossRef] [PubMed]
- Salmons, B.; Gunzburg, W.H. Current perspectives in the biology of mouse mammary tumour virus. Virus Res. 1987, 8, 81–102. [Google Scholar] [CrossRef]
- Callahan, R.; Smith, G.H. MMTV-induced mammary tumorigenesis: Gene discovery, progression to malignancy and cellular pathways. Oncogene 2000, 19, 992–1001. [Google Scholar] [CrossRef]
- Brandt-Carlson, C.; Butel, J.S.; Wheeler, D. Phylogenetic and structural analyses of MMTV LTR ORF sequences of exogenous and endogenous origins. Virology 1993, 193, 171–185. [Google Scholar] [CrossRef]
- Janeway, C.A., Jr. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 1989, 54 Pt 1, 1–13. [Google Scholar] [CrossRef]
- Kopp, E.B.; Medzhitov, R. The Toll-receptor family and control of innate immunity. Curr. Opin. Immunol. 1999, 11, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Bhat, N.; Fitzgerald, K.A. Recognition of cytosolic DNA by cGAS and other STING-dependent sensors. Eur. J. Immunol. 2014, 44, 634–640. [Google Scholar] [CrossRef] [PubMed]
- Moran, E.A.; Ross, S.R. Insights into Sensing of Murine Retroviruses. Viruses 2020, 12, 836. [Google Scholar] [CrossRef] [PubMed]
- Tu, S.; Zhong, D.; Xie, W.; Huang, W.; Jiang, Y.; Li, Y. Role of Toll-Like Receptor Signaling in the Pathogenesis of Graft-versus-Host Diseases. Int. J. Mol. Sci. 2016, 17, 1288. [Google Scholar] [CrossRef]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef]
- Salas-Briceno, K.; Zhao, W.; Ross, S.R. Mouse APOBEC3 Restriction of Retroviruses. Viruses 2020, 12, 1217. [Google Scholar] [CrossRef]
- MacMillan, A.L.; Kohli, R.M.; Ross, S.R. APOBEC3 inhibition of mouse mammary tumor virus infection: The role of cytidine deamination versus inhibition of reverse transcription. J. Virol. 2013, 87, 4808–4817. [Google Scholar] [CrossRef]
- Dudley, J.P.; Golovkina, T.V.; Ross, S.R. Lessons Learned from Mouse Mammary Tumor Virus in Animal Models. ILAR J. 2016, 57, 12–23. [Google Scholar] [CrossRef]
- Jude, B.A.; Pobezinskaya, Y.; Bishop, J.; Parke, S.; Medzhitov, R.M.; Chervonsky, A.V.; Golovkina, T.V. Subversion of the innate immune system by a retrovirus. Nat. Immunol. 2003, 4, 573–578. [Google Scholar] [CrossRef]
- Kane, M.; Case, L.K.; Kopaskie, K.; Kozlova, A.; MacDearmid, C.; Chervonsky, A.V.; Golovkina, T.V. Successful transmission of a retrovirus depends on the commensal microbiota. Science 2011, 334, 245–249. [Google Scholar] [CrossRef]
- Gonzalez, R.; Elena, S.F. The Interplay between the Host Microbiome and Pathogenic Viral Infections. mBio 2021, 12, e0249621. [Google Scholar] [CrossRef]
- Everett, H.; McFadden, G. Apoptosis: An innate immune response to virus infection. Trends Microbiol. 1999, 7, 160–165. [Google Scholar] [CrossRef]
- Henderson, S.; Huen, D.; Rowe, M.; Dawson, C.; Johnson, G.; Rickinson, A. Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death. Proc. Natl. Acad. Sci. USA 1993, 90, 8479–8483. [Google Scholar] [CrossRef]
- Barber, G.N. Host defense, viruses and apoptosis. Cell Death Differ. 2001, 8, 113–126. [Google Scholar] [CrossRef] [PubMed]
- Bishop, J.M. Enemies within: The genesis of retrovirus oncogenes. Cell 1981, 23, 5–6. [Google Scholar] [CrossRef]
- Rosenberg, N.; Jolicoeur, P. Retroviral Pathogenesis. In Retroviruses; Coffin, J.M., Hughes, S.H., Varmus, H.E., Eds.; Cold Spring Harbor: Hempstead, NY, USA, 1997. [Google Scholar]
- Katz, E.; Lareef, M.H.; Rassa, J.C.; Grande, S.M.; King, L.B.; Russo, J.; Ross, S.R.; Monroe, J.G. MMTV Env encodes an ITAM responsible for transformation of mammary epithelial cells in three-dimensional culture. J. Exp. Med. 2005, 201, 431–439. [Google Scholar] [CrossRef] [PubMed]
- Ross, S.R.; Schmidt, J.W.; Katz, E.; Cappelli, L.; Hultine, S.; Gimotty, P.; Monroe, J.G. An immunoreceptor tyrosine activation motif in the mouse mammary tumor virus envelope protein plays a role in virus-induced mammary tumors. J. Virol. 2006, 80, 9000–9008. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, W.; Khader, T.A.; Panicker, N.G.; Akhlaq, S.; Baby, J.; Gull, B.; Mustafa, F. MMTV-like Env sequences from human breast cancer patients cannot yet be considered as a separate species. Hamdan Med. J. 2022, 15, 155–163. [Google Scholar]
- Bevilacqua, G. The Viral Origin of Human Breast Cancer: From the Mouse Mammary Tumor Virus (MMTV) to the Human Betaretrovirus (HBRV). Viruses 2022, 14, 1704. [Google Scholar] [CrossRef]
- Hochman, J.; Braitbard, O. Life after Cleavage: The Story of a beta-Retroviral (MMTV) Signal Peptide-From Murine Lymphoma to Human Breast Cancer. Viruses 2022, 14, 2435. [Google Scholar] [CrossRef]
- Lawson, J.S.; Glenn, W.K. Mouse Mammary Tumour Virus (MMTV) in Human Breast Cancer-The Value of Bradford Hill Criteria. Viruses 2022, 14, 721. [Google Scholar] [CrossRef]
- Parisi, F.; Freer, G.; Mazzanti, C.M.; Pistello, M.; Poli, A. Mouse Mammary Tumor Virus (MMTV) and MMTV-like Viruses: An In-depth Look at a Controversial Issue. Viruses 2022, 14, 977. [Google Scholar] [CrossRef]
- Indik, S.; Gunzburg, W.H.; Kulich, P.; Salmons, B.; Rouault, F. Rapid spread of mouse mammary tumor virus in cultured human breast cells. Retrovirology 2007, 4, 73. [Google Scholar] [CrossRef]
- Indik, S.; Gunzburg, W.H.; Salmons, B.; Rouault, F. Mouse mammary tumor virus infects human cells. Cancer Res. 2005, 65, 6651–6659. [Google Scholar] [CrossRef]
- Akhlaq, S.; Panicker, N.G.; Philip, P.S.; Ali, L.M.; Dudley, J.P.; Rizvi, T.A.; Mustafa, F. A cis-Acting Element Downstream of the Mouse Mammary Tumor Virus Major Splice Donor Critical for RNA Elongation and Stability. J. Mol. Biol. 2018, 430, 4307–4324. [Google Scholar] [CrossRef]
- Singh, G.B.; Byun, H.; Ali, A.F.; Medina, F.; Wylie, D.; Shivram, H.; Nash, A.K.; Lozano, M.M.; Dudley, J.P. A Protein Antagonist of Activation-Induced Cytidine Deaminase Encoded by a Complex Mouse Retrovirus. mBio 2019, 10, e01678-19. [Google Scholar] [CrossRef] [PubMed]
- Mertz, J.A.; Lozano, M.M.; Dudley, J.P. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element. Retrovirology 2009, 6, 10. [Google Scholar] [CrossRef]
- Ball, R.K.; Friis, R.R.; Schoenenberger, C.A.; Doppler, W.; Groner, B. Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 1988, 7, 2089–2095. [Google Scholar] [CrossRef]
- Humphreys, R.C.; Rosen, J.M. Stably transfected HC11 cells provide an in vitro and in vivo model system for studying Wnt gene function. Cell Growth Differ. 1997, 8, 839–849. [Google Scholar] [PubMed]
- Cotrim, C.Z.; Fabris, V.; Doria, M.L.; Lindberg, K.; Gustafsson, J.A.; Amado, F.; Lanari, C.; Helguero, L.A. Estrogen receptor beta growth-inhibitory effects are repressed through activation of MAPK and PI3K signalling in mammary epithelial and breast cancer cells. Oncogene 2013, 32, 2390–2402. [Google Scholar] [CrossRef]
- Sam, M.R.; Elliott, B.E.; Mueller, C.R. A novel activating role of SRC and STAT3 on HGF transcription in human breast cancer cells. Mol. Cancer 2007, 6, 69. [Google Scholar] [CrossRef]
- Fini, M.A.; Orchard-Webb, D.; Kosmider, B.; Amon, J.D.; Kelland, R.; Shibao, G.; Wright, R.M. Migratory activity of human breast cancer cells is modulated by differential expression of xanthine oxidoreductase. J. Cell Biochem. 2008, 105, 1008–1026. [Google Scholar] [CrossRef]
- Raafat, A.; Zoltan-Jones, A.; Strizzi, L.; Bargo, S.; Kimura, K.; Salomon, D.; Callahan, R. Kit and PDGFR-alpha activities are necessary for Notch4/Int3-induced tumorigenesis. Oncogene 2007, 26, 662–672. [Google Scholar] [CrossRef] [PubMed]
- Smart, C.E.; Askarian Amiri, M.E.; Wronski, A.; Dinger, M.E.; Crawford, J.; Ovchinnikov, D.A.; Vargas, A.C.; Reid, L.; Simpson, P.T.; Song, S.; et al. Expression and function of the protein tyrosine phosphatase receptor J (PTPRJ) in normal mammary epithelial cells and breast tumors. PLoS ONE 2012, 7, e40742. [Google Scholar] [CrossRef] [PubMed]
- Schmucker, H.; Blanding, W.M.; Mook, J.M.; Wade, J.F.; Park, J.P.; Kwist, K.; Shah, H.; Booth, B.W. Amphiregulin regulates proliferation and migration of HER2-positive breast cancer cells. Cell Oncol. 2018, 41, 159–168. [Google Scholar] [CrossRef]
- Drabsch, Y.; Robert, R.G.; Gonda, T.J. MYB suppresses differentiation and apoptosis of human breast cancer cells. Breast Cancer Res. 2010, 12, R55. [Google Scholar] [CrossRef] [PubMed]
- Brandt, R.; Wong, A.M.; Hynes, N.E. Mammary glands reconstituted with Neu/ErbB2 transformed HC11 cells provide a novel orthotopic tumor model for testing anti-cancer agents. Oncogene 2001, 20, 5459–5465. [Google Scholar] [CrossRef]
- Larsen, P.; Ahmed, M. Evaluation of Biological Activities and Medicinal Properties of Honey Drops and Honey Lozenges. Nutrients 2022, 14, 4738. [Google Scholar] [CrossRef]
- Josan, C.; Podinic, T.; Pfaff, N.; Raha, S. Effect of Delta-9-tetrahydrocannabinol and cannabidiol on milk proteins and lipid levels in HC11 cells. PLoS ONE 2022, 17, e0272819. [Google Scholar] [CrossRef] [PubMed]
- Shackleford, G.M.; Varmus, H.E. Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc. Natl. Acad. Sci. USA 1988, 85, 9655–9659. [Google Scholar] [CrossRef]
- Ahmad, W.; Gull, B.; Baby, J.; Mustafa, F. A Comprehensive Analysis of Northern versus Liquid Hybridization Assays for mRNAs, Small RNAs, and miRNAs Using a Non-Radiolabeled Approach. Curr. Issues Mol. Biol. 2021, 43, 457–484. [Google Scholar] [CrossRef]
- Kincaid, R.P.; Panicker, N.G.; Lozano, M.M.; Sullivan, C.S.; Dudley, J.P.; Mustafa, F. MMTV does not encode viral microRNAs but alters the levels of cancer-associated host microR.RNAs. Virology 2018, 513, 180–187. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, Y.; Shi, C.; Huang, Z.; Zhang, Y.; Li, S.; Li, Y.; Ye, J.; Yu, C.; Li, Z.; et al. SOAPnuke: A MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data. Gigascience 2018, 7, gix120. [Google Scholar] [CrossRef]
- Wingett, S.W.; Andrews, S. FastQ Screen: A tool for multi-genome mapping and quality control. F1000Res 2018, 7, 1338. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Saeed, A.I.; Sharov, V.; White, J.; Li, J.; Liang, W.; Bhagabati, N.; Braisted, J.; Klapa, M.; Currier, T.; Thiagarajan, M.; et al. TM4: A free, open-source system for microarray data management and analysis. Biotechniques 2003, 34, 374–378. [Google Scholar] [CrossRef]
- Huang da, W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Kanehisa, M.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44, D457–D462. [Google Scholar] [CrossRef]
- Griss, J.; Viteri, G.; Sidiropoulos, K.; Nguyen, V.; Fabregat, A.; Hermjakob, H. ReactomeGSA—Efficient Multi-Omics Comparative Pathway Analysis. Mol. Cell Proteom. 2020, 19, 2115–2125. [Google Scholar] [CrossRef] [PubMed]
- Martens, M.; Ammar, A.; Riutta, A.; Waagmeester, A.; Slenter, D.N.; Hanspers, K.; Miller, R.A.; Digles, D.; Lopes, E.N.; Ehrhart, F.; et al. WikiPathways: Connecting communities. Nucleic Acids Res. 2021, 49, D613–D621. [Google Scholar] [CrossRef]
- Stelzer, G.; Rosen, N.; Plaschkes, I.; Zimmerman, S.; Twik, M.; Fishilevich, S.; Stein, T.I.; Nudel, R.; Lieder, I.; Mazor, Y.; et al. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr. Protoc. Bioinform. 2016, 54, 1.30.1–1.30.33. [Google Scholar] [CrossRef]
- Smith, J.R.; Hayman, G.T.; Wang, S.J.; Laulederkind, S.J.F.; Hoffman, M.J.; Kaldunski, M.L.; Tutaj, M.; Thota, J.; Nalabolu, H.S.; Ellanki, S.L.R.; et al. The Year of the Rat: The Rat Genome Database at 20: A multi-species knowledgebase and analysis platform. Nucleic Acids Res. 2020, 48, D731–D742. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- Chin, C.H.; Chen, S.H.; Wu, H.H.; Ho, C.W.; Ko, M.T.; Lin, C.Y. cytoHubba: Identifying hub objects and sub-networks from complex interactome. BMC Syst. Biol. 2014, 8 (Suppl. S4), S11. [Google Scholar] [CrossRef]
- Bader, G.D.; Hogue, C.W. An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinform. 2003, 4, 2. [Google Scholar] [CrossRef]
- Mattingly, C.J.; Rosenstein, M.C.; Davis, A.P.; Colby, G.T.; Forrest, J.N., Jr.; Boyer, J.L. The comparative toxicogenomics database: A cross-species resource for building chemical-gene interaction networks. Toxicol. Sci. 2006, 92, 587–595. [Google Scholar] [CrossRef]
- Dzuris, J.L.; Zhu, W.; Kapkov, D.; Golovkina, T.V.; Ross, S.R. Expression of mouse mammary tumor virus envelope protein does not prevent superinfection in vivo or in vitro. Virology 1999, 263, 418–426. [Google Scholar] [CrossRef]
- Coenye, T. Do results obtained with RNA-sequencing require independent verification? Biofilm 2021, 3, 100043. [Google Scholar] [CrossRef] [PubMed]
- Fang, Z.; Cui, X. Design and validation issues in RNA-seq experiments. Brief. Bioinform. 2011, 12, 280–287. [Google Scholar] [CrossRef]
- Blainey, P.; Krzywinski, M.; Altman, N. Points of significance: Replication. Nat. Methods 2014, 11, 879–880. [Google Scholar] [CrossRef]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef]
- Ghanbarian, H.; Yildiz, M.T.; Tutar, Y. MicroRNA Targeting. Methods Mol. Biol. 2022, 2257, 105–130. [Google Scholar]
- Jena, M.K.; Jaswal, S.; Kumar, S.; Mohanty, A.K. Molecular mechanism of mammary gland involution: An update. Dev. Biol. 2019, 445, 145–155. [Google Scholar] [CrossRef]
- Herschkowitz, J.I.; Simin, K.; Weigman, V.J.; Mikaelian, I.; Usary, J.; Hu, Z.; Rasmussen, K.E.; Jones, L.P.; Assefnia, S.; Chandrasekharan, S.; et al. Identification of conserved gene expression features between murine mammary carcinoma models and human breast tumors. Genome Biol. 2007, 8, R76. [Google Scholar] [CrossRef]
- Cai, Y.; Nogales-Cadenas, R.; Zhang, Q.; Lin, J.R.; Zhang, W.; O’Brien, K.; Montagna, C.; Zhang, Z.D. Transcriptomic dynamics of breast cancer progression in the MMTV-PyMT mouse model. BMC Genomics 2017, 18, 185. [Google Scholar] [CrossRef]
- Lin, E.Y.; Jones, J.G.; Li, P.; Zhu, L.; Whitney, K.D.; Muller, W.J.; Pollard, J.W. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases. Am. J. Pathol. 2003, 163, 2113–2126. [Google Scholar] [CrossRef]
- Swanson, I.; Jude, B.A.; Zhang, A.R.; Pucker, A.; Smith, Z.E.; Golovkina, T.V. Sequences within the gag gene of mouse mammary tumor virus needed for mammary gland cell transformation. J. Virol. 2006, 80, 3215–3224. [Google Scholar] [CrossRef]
- Thrasyvoulou, S.; Vartholomatos, G.; Markopoulos, G.; Noutsopoulos, D.; Mantziou, S.; Gkartziou, F.; Papageorgis, P.; Charchanti, A.; Kouklis, P.; Constantinou, A.I.; et al. VL30 retrotransposition is associated with induced EMT, CSC generation and tumorigenesis in HC11 mouse mammary stem-like epithelial cells. Oncol. Rep. 2020, 44, 126–138. [Google Scholar] [CrossRef]
- Li, Y.; Hively, W.P.; Varmus, H.E. Use of MMTV-Wnt-1 transgenic mice for studying the genetic basis of breast cancer. Oncogene 2000, 19, 1002–1009. [Google Scholar] [CrossRef]
- Roarty, K.; Rosen, J.M. Wnt and mammary stem cells: Hormones cannot fly wingless. Curr. Opin. Pharmacol. 2010, 10, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Pfefferle, A.D.; Herschkowitz, J.I.; Usary, J.; Harrell, J.C.; Spike, B.T.; Adams, J.R.; Torres-Arzayus, M.I.; Brown, M.; Egan, S.E.; Wahl, G.M.; et al. Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts. Genome Biol. 2013, 14, R125. [Google Scholar] [CrossRef] [PubMed]
- Pfefferle, A.D.; Darr, D.B.; Calhoun, B.C.; Mott, K.R.; Rosen, J.M.; Perou, C.M. The MMTV-Wnt1 murine model produces two phenotypically distinct subtypes of mammary tumors with unique therapeutic responses to an EGFR inhibitor. Dis. Model. Mech. 2019, 12, dmm037192. [Google Scholar] [CrossRef] [PubMed]
- Rousset, R.; Mack, J.A.; Wharton, K.A., Jr.; Axelrod, J.D.; Cadigan, K.M.; Fish, M.P.; Nusse, R.; Scott, M.P. Naked cuticle targets dishevelled to antagonize Wnt signal transduction. Genes Dev. 2001, 15, 658–671. [Google Scholar] [CrossRef]
- Masuda, H.; Zhang, D.; Bartholomeusz, C.; Doihara, H.; Hortobagyi, G.N.; Ueno, N.T. Role of epidermal growth factor receptor in breast cancer. Breast Cancer Res. Treat. 2012, 136, 331–345. [Google Scholar] [CrossRef]
- Chaplin, D.D. Overview of the immune response. J. Allergy Clin. Immunol. 2010, 125 (Suppl. S2), S3–S23. [Google Scholar] [CrossRef]
- Finlay, B.B.; McFadden, G. Anti-immunology: Evasion of the host immune system by bacterial and viral pathogens. Cell 2006, 124, 767–782. [Google Scholar] [CrossRef]
- Castaneda, C.A.; Cortes-Funes, H.; Gomez, H.L.; Ciruelos, E.M. The phosphatidyl inositol 3-kinase/AKT signaling pathway in breast cancer. Cancer Metastasis Rev. 2010, 29, 751–759. [Google Scholar] [CrossRef]
- Jozefiak, A.; Larska, M.; Pomorska-Mol, M.; Ruszkowski, J.J. The IGF-1 Signaling Pathway in Viral Infections. Viruses 2021, 13, 1488. [Google Scholar] [CrossRef]
- Martini, M.; De Santis, M.C.; Braccini, L.; Gulluni, F.; Hirsch, E. PI3K/AKT signaling pathway and cancer: An updated review. Ann. Med. 2014, 46, 372–383. [Google Scholar] [CrossRef]
- Lee, J.J.; Loh, K.; Yap, Y.S. PI3K/Akt/mTOR inhibitors in breast cancer. Cancer Biol. Med. 2015, 12, 342–354. [Google Scholar]
- Chen, C.Y.; Chen, J.; He, L.; Stiles, B.L. PTEN: Tumor Suppressor and Metabolic Regulator. Front. Endocrinol. 2018, 9, 338. [Google Scholar] [CrossRef]
- Semba, S.; Itoh, N.; Ito, M.; Youssef, E.M.; Harada, M.; Moriya, T.; Kimura, W.; Yamakawa, M. Down-regulation of PIK3CG, a catalytic subunit of phosphatidylinositol 3-OH kinase, by CpG hypermethylation in human colorectal carcinoma. Clin. Cancer Res. 2002, 8, 3824–3831. [Google Scholar]
- Vazquez, A.; Bond, E.E.; Levine, A.J.; Bond, G.L. The genetics of the p53 pathway, apoptosis and cancer therapy. Nat. Rev. Drug Discov. 2008, 7, 979–987. [Google Scholar] [CrossRef]
- Debatin, K.M. Apoptosis pathways in cancer and cancer therapy. Cancer Immunol. Immunother. 2004, 53, 153–159. [Google Scholar] [CrossRef]
- Lobry, C.; Oh, P.; Mansour, M.R.; Look, A.T.; Aifantis, I. Notch signaling: Switching an oncogene to a tumor suppressor. Blood 2014, 123, 2451–2459. [Google Scholar] [CrossRef]
- Wajant, H. The role of TNF in cancer. Results Probl. Cell Differ. 2009, 49, 1–15. [Google Scholar]
- Jorgovanovic, D.; Song, M.; Wang, L.; Zhang, Y. Roles of IFN-gamma in tumor progression and regression: A review. Biomark. Res. 2020, 8, 49. [Google Scholar] [CrossRef]
- Xia, L.; Tan, S.; Zhou, Y.; Lin, J.; Wang, H.; Oyang, L.; Tian, Y.; Liu, L.; Su, M.; Wang, H.; et al. Role of the NFkappaB-signaling pathway in cancer. Onco Targets 2018, 11, 2063–2073. [Google Scholar] [CrossRef]
- Girardi, E.; Lopez, P.; Pfeffer, S. On the Importance of Host MicroRNAs During Viral Infection. Front. Genet. 2018, 9, 439. [Google Scholar] [CrossRef]
S. No. | Gene | Sequence | Forward (F)/ Reverse (R) | Stock Concentration | Working Concentration |
---|---|---|---|---|---|
1 | Brca1 | GGGGAAAAGGTAGGTCCAAAC | F | 10 μM | 100 nM |
CTGCTTCAGCATTTGACTCGT | R | 10 μM | 100 nM | ||
2 | Brca2 | TCTTTCTCCGAGTATCAGGAAGT | F | 10 μM | 300 nM |
GCAGAAGTGTCAGTGAGAGTG | R | 10 μM | 300 nM | ||
3 | Hipk3 | ATGGCCTCACAAGTCTTGGTC | F | 10 μM | 300 nM |
GCACTACCTTTCGTGGAAGGAT | R | 10 μM | 300 nM | ||
4 | Pten | TGGATTCGACTTAGACTTGACCT | F | 10 μM | 50 nM |
GCGGTGTCATAATGTCTCTCAG | R | 10 μM | 50 nM | ||
5 | Rbl2 | CTGTGCTCCTTACACGACGG | F | 10 μM | 300 nM |
GCGGCTAACACGTATTCTTCA | R | 10 μM | 300 nM | ||
6 | Sqstm | AGGATGGGGACTTGGTTGC | F | 10 μM | 300 nM |
TCACAGATCACATTGGGGTGC | R | 10 μM | 300 nM | ||
7 | Stat3 | CACCTTGGATTGAGAGTCAAGAC | F | 10 μM | 300 nM |
AGGAATCGGCTATATTGCTGGT | R | 10 μM | 300 nM | ||
8 | Zeb1 | CGCCATGAGAAGAACGAGGAC | F | 10 μM | 300 nM |
CTGTGAATCCGTAAGTGCTCTTT | R | 10 μM | 300 nM | ||
9 | Zeb2 | AAACGTGGTGAACTATGACAACG | F | 10 μM | 300 nM |
CTTGCAGAATCTCGCCACTG | R | 10 μM | 300 nM | ||
10 | Zfpm2 | GAGCCCGAAAATCTGAGCTG | F | 10 μM | 50 nM |
GCCGACTCTGAATCTTCCTTTCT | R | 10 μM | 50 nM | ||
11 | β- Actin | TGTTACCAACTGGGACGACA | F | 10 μM | 300 nM |
CTGGGTCATCTTTTCACGGT | R | 10 μM | 300 nM |
Gene Sets | Size | ES | NES | NOM p-Value | FDR q-Value | FWER p-Value |
---|---|---|---|---|---|---|
Gene sets enriched in MMTV phenotype. | ||||||
TNF | 110 | 0.34 | 1.37 | 0.222 | 0.215 | 0.170 |
Autophagy | 137 | 0.24 | 1.37 | 0.000 | 0.159 | 0.170 |
Type II interferon | 65 | 0.54 | 1.37 | 0.233 | 0.133 | 0.170 |
P53 | 70 | 0.23 | 1.25 | 0.000 | 0.169 | 0.451 |
Notch | 57 | 0.24 | 1.23 | 0.240 | 0.164 | 0.570 |
Apoptosis | 142 | 0.22 | 1.21 | 0.000 | 0.169 | 0.650 |
Cell cycle | 121 | 0.23 | 1.13 | 0.245 | 0.284 | 0.950 |
NFƙB | 97 | 0.31 | 1.08 | 0.422 | 0.325 | 0.950 |
ErBb | 85 | 0.20 | 0.94 | 0.442 | 0.525 | 0.950 |
Gene sets enriched in CTRL phenotype. | ||||||
WNT | 140 | −0.35 | −1.83 | 0.000 | 0.030 | 0.000 |
Hedgehog | 79 | −0.38 | −1.76 | 0.000 | 0.053 | 0.070 |
Focal adhesion | 195 | −0.37 | −1.63 | 0.000 | 0.045 | 0.100 |
Rap1 | 205 | −0.35 | −1.59 | 0.000 | 0.067 | 0.140 |
Metabolism | 130 | −0.66 | −1.58 | 0.000 | 0.068 | 0.140 |
PI3−AKT−mTOR | 395 | −0.29 | −1.56 | 0.000 | 0.080 | 0.140 |
Prolactin | 76 | −0.38 | −1.54 | 0.000 | 0.076 | 0.140 |
EGFR | 38 | −0.69 | −1.52 | 0.000 | 0.072 | 0.140 |
PI3−AKT | 310 | −0.30 | −1.52 | 0.000 | 0.069 | 0.140 |
Hippo | 148 | −0.27 | −1.51 | 0.000 | 0.073 | 0.140 |
Ras | 221 | −0.30 | −1.49 | 0.000 | 0.070 | 0.140 |
Inflammation | 46 | −0.37 | −1.49 | 0.000 | 0.071 | 0.140 |
Glutathione | 46 | −0.55 | −1.45 | 0.000 | 0.075 | 0.180 |
VEGF | 74 | −0.36 | −1.43 | 0.000 | 0.073 | 0.180 |
cAMP | 190 | −0.33 | −1.39 | 0.000 | 0.086 | 0.350 |
Immune response | 95 | −0.47 | −1.39 | 0.000 | 0.083 | 0.350 |
Estrogen | 119 | −0.34 | −1.38 | 0.000 | 0.079 | 0.350 |
Calcium | 219 | −0.34 | −1.32 | 0.000 | 0.097 | 0.450 |
AMPK | 88 | −0.22 | −1.30 | 0.054 | 0.104 | 0.480 |
PPAR | 70 | −0.34 | −1.27 | 0.000 | 0.107 | 0.480 |
mTOR | 140 | −0.19 | −1.25 | 0.000 | 0.115 | 0.520 |
Chemokine | 166 | −0.24 | −1.22 | 0.364 | 0.154 | 0.670 |
HIF−1 | 68 | −0.19 | −1.20 | 0.239 | 0.169 | 0.670 |
MAPK | 300 | −0.22 | −1.20 | 0.000 | 0.164 | 0.670 |
FoXo | 93 | −0.23 | −1.19 | 0.255 | 0.165 | 0.710 |
Insulin | 130 | −0.22 | −1.07 | 0.352 | 0.339 | 0.930 |
TGFB | 102 | −0.23 | −1.06 | 0.412 | 0.372 | 1.000 |
JAK−STAT | 147 | −0.26 | −1.03 | 0.352 | 0.429 | 1.000 |
Cytokines | 201 | −0.25 | −1.01 | 0.528 | 0.430 | 1.000 |
Sr. No | Pathway | Enriched (Core) Genes |
---|---|---|
MMTV Group | ||
1 | TNF | Ccl2, Mmp3, Cxcl10, Icam1, Tnfrsf1b, Cxcl1, Fas, Tnfaip3, Ccl20, Vegfc, Creb5, Jag1, Lif, Traf5, Vcam1, Pgam5, Nod2, Ptgs2, Atf4, Il1b, Traf3, Tab1, Cxcl2, Csf1, Mlkl, NFƙBia, Pik3cb, Traf2, Ccl5, Cebpb, Rela |
2 | Autophagy | Prkaa2, Rragd, Rab39b, Smcr8, Uvrag, Bcl2, Ern1, Atg14, Sqstm1, Eif2s1, Irs1, Rptor, Atg2b, Ctsd, Dapk3, Igf1r, Deptor, Atg12, Pik3cb, Ppp2cb, Prkaa1, Irs2, Mapk10, Rragc, Nras, C9orf72, Akt1s1, Mapk8, Rraga |
3 | Type II interferon | Gvin1, Ccl2, Nlrc5, Gm4070, Pglyrp2, Ifit1bl2, Gbp6, Cxcl10, Gbp10, Ifit1, Ifi44, Ifit3b, Icam1, Gbp9, Ifit3, Isg15, Oas1a, Rsad2, Ifi211, Cgas, Cxcl9, Usp18, Gbp4, Gm4951, Stat2, Havcr2, Ifit2, Il1b |
CTRL Group | ||
1 | WNT | Porcn, Fzd2, Lef1, Camk2a, Nfatc1, Wif1, Wnt1, Wnt11, Tcf7l1, Sfrp5, Rac3, Plcb4, Wnt10a, Ctnnbip1, Wnt6, Fzd4, Camk2b, Vangl2, Sfrp1, Prickle2, Ccnd1, Plcb1, Nfatc4, Wnt4, Nfatc2, Wnt10b, Nkd2, Sfrp2, Wnt5b |
2 | Hedgehog | Evc, Arrb1, Bmp4, Stk36, Wnt1, Wnt11, Cdon, Hhip, Wnt10a, Gli1, Wnt6, Boc, Hhatl, Hhat, Gas1, Ccnd1, Gli2, Wnt4, Bmp6, Wnt10b, Wnt5b |
3 | Focal adhesion | Flnc, Pip5k1c, Col6a2, Itgb1, Chad, Col6a1, Actg1, Erbb2, Pak1, Thbs2, Lamc3, Itga1, Itgb6, Mylk2, Vegfd, ln2, Pik3r3, Myl9, Mylpf, Lamc1, Lamc2, Col9a3, Mylk4, Pik3cd, Itgb3, Itga6, Col4a5, Rac3, Col9a2, Tnn, Col9a1, Cav2, Itga2, Pdgfra, Ibsp, Pdgfc, Pdgfb, Vtn, Cav1, Tnc, Pdgfrb, Ccnd1, Col4a4, Itga10, Lama3, Col1a2, Lama2, Col1a1, Col6a3, Igf1, Pdgfd, Mylk |
4 | Rap1 | Efna3, Pard6g, Vegfa, Pfn2, Plcb3, Magi1, Tek, Adcy1, Plcg1, Itgb1, Efna4, Actg1, Mapk12, Dock4, Vegfd, Tln2, Lpar1, Fgfr2, Pik3r3, Itgb2, Afdn, Ralgds, P2ry1, Fgfr3, Adcy8, Lat, Lpar5, Itgal Cnr1, Pik3cd, Map2k6, Itgb3, Tiam1, Angpt1, Rac3, Plcb4, Adora2b, Rgs14, Fyb, Pdgfra, Pdgfc, Adcy5, Pdgfb, Kitl, Pdgfrb, Lpar4, Rapgef4, Plcb1, Sipa1l2, Calm4, Rapgef3, Rasgrp3, Igf1, Calml3, Itgam, Pdgfd, Grin1 |
5 | Metabolism | Sult4a1, Btn1a1, Adam8, Selenbp1, Cyp46a1, Pygl, Slc13a4, Dcxr, Bcat1, Vim, Ggt1,Gper1, Igf2, Dpep1, Ndufa4l2, Cbr2, Pde5a, Ggt5, Gsta4,Nos1, Pdzd2, Slc38a3, Aox1, Gpd1, Galnt18, Psapl1, Sardh, Mgat5b, Ak5, Gucy1b2, Aldh1a7, Gbgt1, Gcnt3, B3gnt8, Cyp2b19, Cyp2s1, Ptgs1, Acss1, Pltp, Inpp5d, Sgpp2, Carns1, Gsta3, Fhit, Ces2g, Alas2, Ptges, Sord, Fn3k, Mgst2, Dgki, Mest, Ces2f, Pde7b, Acsbg1, Aldh1l1, Col8a1, Atp12a, Pde9a, Cyp2d11, Hao2, Chst5, Ggt6, Colgalt2, Aldoc, Rorc, Ces2e, Them5, Cyp2d34, Lipk, Arg1, Mgll, Galnt6, Alox12, Xpnpep2, Tmlhe, Alox5ap, Aldh3b2, Gxylt2, Rassf9, Acsm3, Acot11, Cyp2w1, Ddc, Slc9a4 |
6 | PI3-AKT-mTOR | Lamc3, Itga1, Ulk3, Itgb6, Ntf5, Myb, Vegfd, Hsp90b1, Prr5, Fgfr2, Pik3r3, Fzd2, Rxra, Cab39l, Erbb3, Creb3l2, Fgfr3, Ppp2r3a, Wnt1, Lamc1, Nr4a1, Wnt11, Lamc2, Ghr, Pkn3, Col9a3, Pik3cd, Gnb4, Gng11, Itgb3, Itga6, Bcl2l11, Col4a5, Angpt1, Cdkn1a, Col9a2, Tnn, Sgk2, Wnt10a, Col9a1, Itga2, Pdgfra, Ibsp, Wnt6, Gng7, Pdgfc, Pdgfb, Fzd4, Eif4e1b, Vtn, Prlr, Gngt2, Igf2, Syk, Tnc, Ppp2r2c, Pdgfrb, Ccnd1, Col4a4, Itga10, Chrm1, Lama3, Col1a2, Lama2, Creb3l3, Creb3l4, Wnt4, Pik3cg, Grb10, Col1a1, Pik3ap1, Wnt10b, Col6a3, Igf1, Pdgfd |
7 | Prolactin | Socs1, Mapk12, Thrsp, Pik3r3, Socs3, Socs2, Pik3cd, Btn1a1, Slc30a2, Pip, Prlr, Ccnd1, Cish, Cyp17a1, Elf5, Slc16a7, Slc16a4 |
8 | EGFR | Cav2, Reps2, Pdgfc, Prlr, Cav1, Ddit4l, Nrarp, Rps6ka5, Ceacam1, Gucy1b2, Il16, Inpp5d, Pik3cg, Grb10, Rasgrp3, Kprp, Mcf2l, Pigr, Ogn, Gprc6a, Cbs, Vipr1 |
9 | Hippo | Birc2, Prkcz, Crb2, Fzd1, Pard6g, Wnt7b, Llgl2, Serpine1, Actg1, Tgfb1, Smad3, Tgfbr2, Gdf5, Bmp4, Fzd2, Itgb2 Lef1, Tgfb2, Wnt1, Tead3, Wnt11, Tcf7l1, Dlg2, Ctnna3, Wnt10a, Wnt6, Fzd4, Ppp2r2c, Ccnd1, Gli2, Wnt4, Bmp6, Wnt10b, Nkd2, Dlg4, Wnt5b |
10 | Ras | Plcg2, Calml4, Efna5, Pik3r2, Gngt1, Fasl, Ralbp1, Fgf21, Rasgrp4, Ntrk1, Pla2g2f, Efna3, Vegfa, Foxo4, Tek, Gng2, Plcg1, Pld1, Efna4, Rasal2, Gm5741, Pak1, Ntf5, Vegfd, Fgfr2, Pik3r3, Afdn, Ralgds, Fgfr3, Lat, Pik3cd, Gnb4, Rgl2, Gng11, Tiam1, Pla1a, Angpt1, Rac3, Gab2, Pdgfra, Rasa4, Gng7, Pdgfc, Pdgfb, Pla2g2c, Gngt2, Igf2, Kitl, Pdgfrb, Calm4, Pla2g3, Rasal1, Pla2g4e, Rasgrp3, Igf1, Calml3, Pdgfd, Grin1, Rasgrp1 |
11 | Inflammation | Il5, Lamc1, Lamc2, Fam13a, Ltb4r1, Vtn, Gcnt1, Col1a2, Col1a1, C1qtnf3, Ptprz1, Alox5ap, Col3a1 |
12 | Glutathione | Gstt2, Gsta1, Gstm4, Gstm5, Gstk1, Gsto2, Mgst1, Idh2, Gstt1, Mgst3, Idh1, Gsta2, Gstm2, Ggt1, Ggt5, Gsta4, Gstm1, Gsta3, Anpep, Mgst2, Ggt6 |
13 | VEGF | Mapk13, Ppp3cc, Akt3, Kdr, Pla2g6, Plcg2, Nos3, Pik3r2, Pla2g2f, Vegfa, Plcg1, Mapkapk3, Mapk12, Sphk1, Pik3r3, Nfatc1, Pik3cd, Rac3, Pla2g2c, Nfatc4, Pla2g3, Nfatc2, Pik3cg, Pla2g4e |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmad, W.; Panicker, N.G.; Akhlaq, S.; Gull, B.; Baby, J.; Khader, T.A.; Rizvi, T.A.; Mustafa, F. Global Down-regulation of Gene Expression Induced by Mouse Mammary Tumor Virus (MMTV) in Normal Mammary Epithelial Cells. Viruses 2023, 15, 1110. https://doi.org/10.3390/v15051110
Ahmad W, Panicker NG, Akhlaq S, Gull B, Baby J, Khader TA, Rizvi TA, Mustafa F. Global Down-regulation of Gene Expression Induced by Mouse Mammary Tumor Virus (MMTV) in Normal Mammary Epithelial Cells. Viruses. 2023; 15(5):1110. https://doi.org/10.3390/v15051110
Chicago/Turabian StyleAhmad, Waqar, Neena G. Panicker, Shaima Akhlaq, Bushra Gull, Jasmin Baby, Thanumol A. Khader, Tahir A. Rizvi, and Farah Mustafa. 2023. "Global Down-regulation of Gene Expression Induced by Mouse Mammary Tumor Virus (MMTV) in Normal Mammary Epithelial Cells" Viruses 15, no. 5: 1110. https://doi.org/10.3390/v15051110
APA StyleAhmad, W., Panicker, N. G., Akhlaq, S., Gull, B., Baby, J., Khader, T. A., Rizvi, T. A., & Mustafa, F. (2023). Global Down-regulation of Gene Expression Induced by Mouse Mammary Tumor Virus (MMTV) in Normal Mammary Epithelial Cells. Viruses, 15(5), 1110. https://doi.org/10.3390/v15051110