Applying Modified VP53A Recombinant Protein as an Anti-White Spot Syndrome Virus Biological Agent in Litopenaeus vannamei Farming
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. Recombinant Protein Preparation
2.3. Preparation of Test Diets
2.4. Pathogen Detection
2.5. Haemolymph Collection, RNA Extraction, and First-Strand cDNA Synthesis
2.6. Gene Expression by Quantitative Real-Time PCR Analysis
2.7. DNA Extraction and High-Throughput Amplicon Sequencing
2.8. Microbiota Analysis
3. Results
3.1. Preparation of VP53A Derived Recombinant Protein, Inno A1
3.2. Administration of Inno A1-Containing Feed Increases Shrimp Production and Survival Rates
3.3. Inno A1 Can Induce the Expression of Immune-Related Genes in Shrimp
3.4. Effects of Inno A1 Dietary Supplementation on the Intestinal Microbiome of Shrimp
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bostock, J.; McAndrew, B.; Richards, R.; Jauncey, K.; Telfer, T.; Lorenzen, K.; Little, D.C.; Ross, L.G.; Handisyde, N.; Gatward, I.; et al. Aquaculture: Global status and trends. Philos. Trans. R. Soc. B Biol. Sci. 2010, 365, 2897–2912. [Google Scholar] [CrossRef] [PubMed]
- Flegel, T.W. Historic emergence, impact and current status of shrimp pathogens in Asia. J. Invertebr. Pathol. 2012, 110, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Seibert, C.H.; Pinto, A.R. Challenges in shrimp aquaculture due to viral diseases: Distribution and biology of the five major penaeid viruses and interventions to avoid viral incidence and dispersion. Braz. J. Microbiol. 2012, 43, 857–864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wongteerasupaya, C.; Vickers, J.E.; Sriurairatana, S.; Nash, G.L.; Akarajamorn, A.; Boonsaeng, V.; Panyim, S.; Tassanakajon, A.; Withyachumnarnkul, B.; Flegel, T.W. A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Org. 1995, 21, 69–77. [Google Scholar] [CrossRef] [Green Version]
- Chou, H.; Huang, C.; Wang, C.; Chiang, H.; Lo, C.-F. Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Dis. Aquat. Org. 1995, 23, 165–173. [Google Scholar] [CrossRef]
- Lo, C.-F.; Ho, C.; Chen, C.; Liu, K.; Chiu, Y.; Yeh, P.; Peng, S.; Hsu, H.; Liu, H.; Chang, C.; et al. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Org. 1997, 30, 53–72. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Lo, C.-F.; Leu, J.; Chou, C.; Yeh, P.; Chou, H.; Tung, M.; Chang, C.; Su, M.; Kou, G. Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon. Dis. Aquat. Org. 1995, 23, 239–242. [Google Scholar] [CrossRef] [Green Version]
- Huang, Z.-J.; Kang, S.-T.; Leu, J.-H.; Chen, L.-L. Endocytic pathway is indicated for white spot syndrome virus (WSSV) entry in shrimp. Fish Shellfish Immunol. 2013, 35, 707–715. [Google Scholar] [CrossRef]
- Chang, Y.-S.; Liu, W.-J.; Lee, C.-C.; Chou, T.-L.; Lee, Y.-T.; Wu, T.-S.; Huang, J.-Y.; Huang, W.-T.; Lee, T.-L.; Kou, G.-H.; et al. A 3D Model of the Membrane Protein Complex Formed by the White Spot Syndrome Virus Structural Proteins. PLoS ONE 2010, 5, e10718. [Google Scholar] [CrossRef] [Green Version]
- Tsai, J.M.; Wang, H.C.; Leu, J.H.; Hsiao, H.H.; Wang, A.H.; Kou, G.H.; Lo, C.F. Genomic and proteomic analysis of thirty-nine structural proteins of shrimp white spot syndrome virus. J. Virol. 2004, 78, 11360–11370. [Google Scholar] [CrossRef] [Green Version]
- Tsai, J.-M.; Wang, H.-C.; Leu, J.-H.; Wang, A.H.-J.; Zhuang, Y.; Walker, P.J.; Kou, G.-H.; Lo, C.-F. Identification of the Nucleocapsid, Tegument, and Envelope Proteins of the Shrimp White Spot Syndrome Virus Virion. J. Virol. 2006, 80, 3021–3029. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, X.; Yang, F. White spot syndrome virus VP24 interacts with VP28 and is involved in virus infection. J. Gen. Virol. 2006, 87, 1903–1908. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Huang, C.; Tang, X.; Zhuang, Y.; Hew, C.L. Identification of structural proteins from shrimp white spot syndrome virus (WSSV) by 2DE-MS. Proteins 2004, 55, 229–235. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Lu, L.; Wu, W.; Lo, C.-F.; Huang, W. White spot syndrome virus envelope protein VP53A interacts with Penaeus monodon chitin-binding protein (PmCBP). Dis. Aquat. Org. 2007, 74, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Huang, P.-Y.; Leu, J.-H.; Chen, L.-L. A newly identified protein complex that mediates white spot syndrome virus infection via chitin-binding protein. J. Gen. Virol. 2014, 95, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.-Y.; Hsu, T.-C.; Huang, P.-Y.; Kang, S.-T.; Lo, C.-F.; Huang, W.-P.; Chen, L.-L. Penaeus monodon chitin-binding protein (PmCBP) is involved in white spot syndrome virus (WSSV) infection. Fish Shellfish Immunol. 2009, 27, 460–465. [Google Scholar] [CrossRef]
- Liu, S.; Tobias, R.; McClure, S.; Styba, G.; Shi, Q.; Jackowski, G. Removal of endotoxin from recombinant protein preparations. Clin. Biochem. 1997, 30, 455–463. [Google Scholar] [CrossRef]
- Reichelt, P.; Schwarz, C.; Donzeau, M. Single step protocol to purify recombinant proteins with low endotoxin contents. Protein Expr. Purif. 2005, 46, 483–488. [Google Scholar] [CrossRef]
- Wang, K.H.-C.; Tseng, C.-W.; Lin, H.-Y.; Chen, I.-T.; Chen, Y.-H.; Chen, Y.-M.; Chen, T.-Y.; Yang, H.-L. RNAi knock-down of the Litopenaeus vannamei Toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev. Comp. Immunol. 2010, 34, 49–58. [Google Scholar] [CrossRef]
- Leu, J.-H.; Chen, Y.-C.; Chen, L.-L.; Chen, K.-Y.; Huang, H.-T.; Ho, J.-M.; Lo, C.-F. Litopenaeus vannamei inhibitor of apoptosis protein 1 (LvIAP1) is essential for shrimp survival. Dev. Comp. Immunol. 2012, 38, 78–87. [Google Scholar] [CrossRef]
- Chiang, Y.-A.; Hung, H.-Y.; Lee, C.-W.; Huang, Y.-T.; Wang, H.-C. Shrimp Dscam and its cytoplasmic tail splicing activator serine/arginine (SR)-rich protein B52 were both induced after white spot syndrome virus challenge. Fish Shellfish Immunol. 2013, 34, 209–219. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [Green Version]
- Gloor, G.B.; Macklaim, J.M.; Pawlowsky-Glahn, V.; Egozcue, J.J. Microbiome Datasets Are Compositional: And This Is Not Optional. Front. Microbiol. 2017, 8, 2224. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, A.D.; Reid, J.N.; Macklaim, J.M.; McMurrough, T.A.; Edgell, D.R.; Gloor, G.B. Unifying the analysis of high-throughput sequencing datasets: Characterizing RNA-seq, 16S rRNA gene sequencing and selective growth experiments by compositional data analysis. Microbiome 2014, 2, 1–13. [Google Scholar] [CrossRef] [Green Version]
- McMurdie, P.J.; Holmes, S. Phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.J.; Chen, L.L. WSSV envelope protein VP51B links structural protein complexes and may mediate virus infection. J. Fish Dis. 2016, 40, 571–581. [Google Scholar] [CrossRef]
- Amparyup, P.; Charoensapsri, W.; Tassanakajon, A. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol. 2013, 34, 990–1001. [Google Scholar] [CrossRef]
- Meister, M. Blood cells of Drosophila: Cell lineages and role in host defence. Curr. Opin. Immunol. 2003, 16, 10–15. [Google Scholar] [CrossRef]
- Soderhall, K.; Aspan, A.; Duvic, B. The proPO-system and associated proteins; role in cellular communication in arthropods. Res. Immunol. 1990, 141, 896–907. [Google Scholar] [CrossRef]
- Bahar, A.A.; Ren, D. Antimicrobial peptides. Pharmaceuticals 2013, 6, 1543–1575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.-Y.; Chen, P.-C.; Weng, F.C.-H.; Shaw, G.T.-W.; Wang, D. Habitat and indigenous gut microbes contribute to the plasticity of gut microbiome in oriental river prawn during rapid environmental change. PLoS ONE 2017, 12, e0181427. [Google Scholar] [CrossRef]
- Cornejo-Granados, F.; Lopez-Zavala, A.A.; Gallardo-Becerra, L.; Mendoza-Vargas, A.; Sánchez, F.; Vichido, R.; Brieba, L.G.; Viana, M.T.; Sotelo-Mundo, R.R.; Ochoa-Leyva, A. Microbiome of Pacific Whiteleg shrimp reveals differential bacterial community composition between Wild, Aquacultured and AHPND/EMS outbreak conditions. Sci. Rep. 2017, 7, 11783. [Google Scholar] [CrossRef] [Green Version]
- Fan, J.; Chen, L.; Mai, G.; Zhang, H.; Yang, J.; Deng, D.; Ma, Y. Dynamics of the gut microbiota in developmental stages of Litopenaeus vannamei reveal its association with body weight. Sci. Rep. 2019, 9, 734. [Google Scholar] [CrossRef]
- Md Zoqratt, M.Z.H.; Eng, W.W.H.; Thai, B.T.; Austin, C.M.; Gan, H.M. Microbiome analysis of Pacific white shrimp gut and rearing water from Malaysia and Vietnam: Implications for aquaculture research and management. PeerJ 2018, 6, e5826. [Google Scholar] [CrossRef] [PubMed]
- Zeng, S.; Huang, Z.; Hou, D.; Liu, J.; Weng, S.; He, J. Composition, diversity and function of intestinal microbiota in pacific white shrimp (Litopenaeus vannamei) at different culture stages. PeerJ 2017, 5, e3986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Z.; Li, X.; Wang, L.; Shao, Z. Changes in the intestinal bacterial community during the growth of white shrimp, Litopenaeus vannamei. Aquac. Res. 2014, 47, 1737–1746. [Google Scholar] [CrossRef]
- Holt, C.C.; Bass, D.; Stentiford, G.D.; van der Giezen, M. Understanding the role of the shrimp gut microbiome in health and disease. J. Invertebr. Pathol. 2020, 186, 107387. [Google Scholar] [CrossRef]
- Chen, W.-Y.; Ng, T.H.; Wu, J.-H.; Chen, J.-W.; Wang, H.-C. Microbiome Dynamics in a Shrimp Grow-out Pond with Possible Outbreak of Acute Hepatopancreatic Necrosis Disease. Sci. Rep. 2017, 7, 9395. [Google Scholar] [CrossRef]
Target Gene | Primer | Sequence (5′-3′) | Usage |
---|---|---|---|
Prophenoloxidase (proPO) | proPO-F | GAGATCGCAAGGGAGAACTG | qPCR |
proPO-R | CGTCAGTGAAGTCGAGACCA | ||
Transglutaminase (TGase) | TGase-F | CCTCAGGATCTCCTTCACCA | qPCR |
TGase-R | TTGGGAAAACCTTCATTTCG | ||
Clotting protein (CP) | CP-F | TCTTTGCGCAGTTGGTGATC | qPCR |
CP-R | TGAGGTGACCGAGTGCAAAA | ||
Anti-LPS factor (ALF) | ALF-F | CTGTGGAGGAACGAGGAGAC | qPCR |
ALF-R | CCACCGCTTAGCATCTTGTT | ||
Crustin | Crustin-F | GAGGGTCAAGCCTACTGCTG | qPCR |
Crustin-R | ACTTATCGAGGCCAGCACAC | ||
Lysozyme | Lyz-F1 | GTGGCTTACAACAGCAAGTG | qPCR |
Lyz-R1 | CTAGAACGGGAAGACAGAGTTG | ||
Penaiedin2 | PEN2-F | TCGTGGTCTGCCTGGTCTT | qPCR |
PEN2-R | CAGGTCTGAACGGTGGTCTTC | ||
Penaiedin3 | PEN3-F | CACCCTTCGTGAGACCTTTG | qPCR |
PEN3-R | AATATCCCTTTCCCACGTGAC | ||
Penaiedin4 | PEN4-F | GCCCGTTACCCAAACCATC | qPCR |
PEN4-R | CCGTATCTGAAGCAGCAAAGTC | ||
Superoxidase dismutase (SOD) | SOD-F | ATCCACCACACAAAGCATCA | qPCR |
SOD-R | AGCTCTCGTCAATGGCTTGT | ||
Glutathione peroxidase (GPx) | GPx-F | TTTTTCCGTGCAAAAAGGAC | qPCR |
GPx-R | TAATACGCGATGCCCCTAAC | ||
Toll receptor (Toll) | Toll-F1 | TGCTGTTGAGCATCAGTGAATA | qPCR |
Toll-R1 | AGAACCGCAAACAGGAGAAG | ||
Elongation factor 1-α (EF1-α) | EF1α-F | GGAGATGCACCACGAAGCTC | qPCR |
EF1α-R | TTGGGTCCGGCTTCCAGTTC | ||
Dscam | Ds-Real-4573F | ACAAGCCAAGGCACCAGACT | qPCR |
Ds-Real-4635R | GTTGCCTGTTGGGCTCACTT | ||
16S V3-V4 | 16s-F | TCGTCGGCAGCGTCAGATGTGTATAAGAGSCAG | high-throughput amplicon sequencing |
16s-R | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA |
Group | Specimen | WSSV | V. parahaemolyticus | EHP | ||
---|---|---|---|---|---|---|
AHPND | Non-AHPND | |||||
Before | B group | shrimp | 2/14 | 4/14 | 2/14 | 13/14 |
After | shrimp | 0/10 | 0/10 | 1/10 | 9/10 | |
C group | pool water * | 0/1 | 0/1 | 0/1 | 0/1 | |
Sediment * | 0/1 | 0/1 | 0/1 | 0/1 | ||
shrimp | 0/15 | 0/15 | 0/15 | 14/15 | ||
P group | pool water * | 0/1 | 0/1 | 0/1 | 0/1 | |
Sediment * | 0/1 | 0/1 | 0/1 | 0/1 |
C Group | P Group | |
---|---|---|
Total weight harvest (g) | 275 | 11,664 |
Total shrimps harvest (calculated by average weight) | 43 | 1111 |
Survival rate (%) | 2.15% | 55.54% |
Sample average weight (g) | 6.4 ± 3.1 | 10.5 ± 3.2 |
Average length (cm) | 9.5 ± 1.6 | 11.8 ± 1.2 |
Phylum | Classification | #ASV | Maximum Fold Changes |
---|---|---|---|
P > C | |||
Bacteroidetes | Bacteroidia, Flavobacteriaceae | 8 | 1302.7 |
Proteobacteria | Alphaproteobacteria, Rhodobacteraceae | 20 | 980.9 |
Alphaproteobacteria, Rhizobiaceae | 2 | 187.6 | |
Gammaproteobacteria, Gammaproteobacteria Incertae Sedis | 6 | 867.2 | |
Gammaproteobacteria, Alteromonadales | 2 | 718.5 | |
Gammaproteobacteria, Chromatiales | 3 | 359.3 | |
Gammaproteobacteria, Cellvibrionales | 2 | 123.1 | |
Gammaproteobacteria, Steroidobacterales | 2 | 116.2 | |
Gammaproteobacteria, Others | 4 | 96.5 | |
Deltaproteobacteria, Oligoflexales | 2 | 231.7 | |
Firmicutes | Erysipelotrichia, Erysipelotrichaceae | 1 | 269.5 |
Actinobacteria | Acidimicrobiia, Ilumatobacteraceae | 3 | 158.0 |
Patescibacteria | 3 | 118.4 | |
Planctomycetes | Planctomycetacia, Pirellulaceae | 1 | 68.2 |
C > P | |||
Proteobacteria | Gammaproteobacteria, Gammaproteobacteria Incertae Sedis | 1 | 914.7 |
Gammaproteobacteria, Alteromonadales | 3 | 217.6 | |
Gammaproteobacteria, Vibrionales | 2 | 166.5 | |
Gammaproteobacteria, Chromatiales | 2 | 129.1 | |
Gammaproteobacteria, Steroidobacterales | 2 | 114.4 | |
Gammaproteobacteria, Others | 3 | 109.7 | |
Alphaproteobacteria, Rickettsiales | 2 | 310.3 | |
Alphaproteobacteria, Others | 2 | 81.5 | |
Alphaproteobacteria, Rhodobacteraceae | 1 | 79.0 | |
Deltaproteobacteria, Bdellovibrionales | 3 | 236.2 | |
Patescibacteria | 6 | 647.7 | |
Bacteroidetes | Bacteroidia, Marinilabiliaceae | 2 | 565.7 |
Bacteroidia, Cyclobacteriaceae | 1 | 65.7 | |
Dadabacteria | 1 | 310.3 | |
Chloroflexi | 1 | 75.6 | |
Planctomycetes | 1 | 36.2 | |
Firmicutes | Clostridia, Defluviitaleaceae | 1 | 30.3 |
Chlamydiae | 1 | 28.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, J.C.-K.; Huang, H.-T.; Lin, H.-J.; Chou, H.-Y.; Huang, P.-Y.; Prachumwat, A.; Chen, L.-L. Applying Modified VP53A Recombinant Protein as an Anti-White Spot Syndrome Virus Biological Agent in Litopenaeus vannamei Farming. Viruses 2022, 14, 1353. https://doi.org/10.3390/v14071353
Hsu JC-K, Huang H-T, Lin H-J, Chou H-Y, Huang P-Y, Prachumwat A, Chen L-L. Applying Modified VP53A Recombinant Protein as an Anti-White Spot Syndrome Virus Biological Agent in Litopenaeus vannamei Farming. Viruses. 2022; 14(7):1353. https://doi.org/10.3390/v14071353
Chicago/Turabian StyleHsu, Jeff Chia-Kai, Huai-Ting Huang, Han-Jia Lin, Hsin-Yiu Chou, Po-Yu Huang, Anuphap Prachumwat, and Li-Li Chen. 2022. "Applying Modified VP53A Recombinant Protein as an Anti-White Spot Syndrome Virus Biological Agent in Litopenaeus vannamei Farming" Viruses 14, no. 7: 1353. https://doi.org/10.3390/v14071353
APA StyleHsu, J. C.-K., Huang, H.-T., Lin, H.-J., Chou, H.-Y., Huang, P.-Y., Prachumwat, A., & Chen, L.-L. (2022). Applying Modified VP53A Recombinant Protein as an Anti-White Spot Syndrome Virus Biological Agent in Litopenaeus vannamei Farming. Viruses, 14(7), 1353. https://doi.org/10.3390/v14071353