Inhibition of the IFN-α JAK/STAT Pathway by MERS-CoV and SARS-CoV-1 Proteins in Human Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Transfection and Treatment
2.3. Immunoblotting
2.4. qRT-PCR
2.5. Immunofluorescence Assay
2.6. Statistical Analysis
3. Results
3.1. MERS-CoV-nsp2 and SARS-CoV-1-nsp14, but Not MERS-CoV-nsp5, Inhibit IFN-α-Induced pSTAT1-3 in A549 Cells
3.2. MERS-CoV-nsp2 and SARS-CoV-1-nsp14, but Not MERS-CoV-nsp5, Inhibit IFN-α-Induced pSTAT1-3 in BEAS-2B Cells
3.3. MERS-CoV-nsp2, SARS-CoV-1-nsp14 and MERS-CoV-nsp5 Have Little Effect upon the IFN-α JAK/STAT Pathway in HEK293T Cells
3.4. MERS-CoV-nsp2 and SARS-CoV-1-nsp14 Reduce IFN-α-Mediated MxA Induction in A549 Cells
3.5. MERS-CoV-nsp2, MERS-CoV-nsp5 and SARS-CoV-1-nsp14 Reduce IFN-α-Mediated MxA, ISG15 and PKR Induction in BEAS-2B Cells
3.6. MERS-CoV-nsp2, MERS-CoV-nsp5 and SARS-CoV-1-nsp14 Inhibit Nuclear Translocation of STAT1 in BEAS-2B Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Spaan, W.; Cavanagh, D.; Horzinek, M.C. Coronaviruses: Structure and genome expression. J. Gen. Virol. 1988, 69, 2939–2952. [Google Scholar] [CrossRef] [PubMed]
- Fehr, A.R.; Perlman, S. Coronaviruses: An overview of their replication and pathogenesis. Methods Mol. Biol. 2015, 1282, 1–23. [Google Scholar] [PubMed] [Green Version]
- Organisation, W.H. Severe Acute Respiratory Syndrome (SARS). Available online: https://www.who.int/csr/sars/en/ (accessed on 6 February 2022).
- Middle East Respiratory Syndrome Coronavirus (MERS-CoV). Available online: https://www.who.int/emergencies/mers-cov/en/ (accessed on 6 February 2022).
- Bermingham, A.; Chand, M.; Brown, C.; Aarons, E.; Tong, C.; Langrish, C.; Hoschler, K.; Brown, K.; Galiano, M.; Myers, R.; et al. Severe respiratory illness caused by a novel coronavirus, in a patient transferred to the United Kingdom from the Middle East, September 2012. Eurosurveillance 2012, 17, 20290. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Gargan, S.; Lu, Y.; Stevenson, N.J. An overview of current knowledge of deadly CoVs and their interface with innate immunity. Viruses 2021, 13, 560. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; McGoogan, J.M. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: Summary of a report of 72 314 cases from the Chinese Center for Disease Control and Prevention. JAMA 2020, 323, 1239–1242. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Shi, X.; Jiang, L.; Zhang, S.; Wang, D.; Tong, P.; Guo, D.; Fu, L.; Cui, Y.; Liu, X.; et al. Structure of MERS-CoV spike receptor-binding domain complexed with human receptor DPP4. Cell Res. 2013, 23, 986–993. [Google Scholar] [CrossRef] [Green Version]
- Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Liu, Q.; Du, L.; Jiang, S. Middle East respiratory syndrome coronavirus (MERS-CoV): Challenges in identifying its source and controlling its spread. Microbes Infect 2013, 15, 625–629. [Google Scholar] [CrossRef]
- Bowie, A.G.; Unterholzner, L. Viral evasion and subversion of pattern-recognition receptor signalling. Nat. Rev. Immunol. 2008, 8, 911–922. [Google Scholar] [CrossRef] [PubMed]
- Totura, L.A.; Whitmore, A.; Agnihothram, S.; Schäfer, A.; Katze, M.G.; Heise, M.T.; Baric, R.S. Toll-Like receptor 3 signaling via TRIF contributes to a protective innate immune response to severe acute respiratory syndrome coronavirus infection. mBio 2015, 6, e00638-15. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Li, W.; Gao, T.; Cui, Y.; Jin, Y.; Li, P.; Ma, Q.; Liu, X.; Cao, C. The severe acute respiratory syndrome coronavirus nucleocapsid inhibits type i interferon production by interfering with TRIM25-Mediated RIG-I ubiquitination. J. Virol. 2017, 91, e02143-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, Z.; Fang, L.; Yuan, S.; Zhao, L.; Wang, X.; Long, S.; Wang, M.; Wang, D.; Foda, M.F.; Xiao, S. The nucleocapsid proteins of mouse hepatitis virus and severe acute respiratory syndrome coronavirus share the same IFN-β antagonizing mechanism: Attenuation of PACT-mediated RIG-I/MDA5 activation. Oncotarget 2017, 8, 49655. [Google Scholar] [CrossRef] [PubMed]
- Siu, K.-L.; Yeung, M.L.; Kok, K.-H.; Yuen, K.-Y.; Kew, C.; Lui, P.-Y.; Chan, C.P.; Tse, H.; Woo, P.C.Y.; Jin, D.-Y. Middle east respiratory syndrome coronavirus 4a protein is a double-stranded RNA-Binding protein that suppresses PACT-Induced Activation of RIG-I and MDA5 in the innate antiviral response. J. Virol. 2014, 88, 4866–4876. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shirato, K.; Kizaki, T. SARS-CoV-2 spike protein S1 subunit induces pro-inflammatory responses via toll-like receptor 4 signaling in murine and human macrophages. Heliyon 2021, 7, e06187. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Kuang, M.; Li, J.; Zhu, L.; Jia, Z.; Guo, X.; Hu, Y.; Kong, J.; Yin, H.; Wang, X. SARS-CoV-2 spike protein interacts with and activates TLR41. Cell Res. 2021, 31, 818–820. [Google Scholar] [CrossRef]
- Cervantes-Barragan, L.; Züst, R.; Weber, F.; Spiegel, M.; Lang, K.S.; Akira, S.; Thiel, V.; Ludewig, B. Control of coronavirus infection through plasmacytoid dendritic-cell–derived type I interferon. Blood 2007, 109, 1131–1137. [Google Scholar] [CrossRef] [Green Version]
- Channappanavar, R.; Fehr, A.R.; Zheng, J.; Wohlford-Lenane, C.; Abrahante, J.E.; Mack, M.; Sompallae, R.; McCray, P.B.; Meyerholz, D.K.; Perlman, S. IFN-I response timing relative to virus replication determines MERS coronavirus infection outcomes. J. Clin. Investig. 2019, 129, 3625–3639. [Google Scholar] [CrossRef]
- Bortolotti, D.; Gentili, V.; Rizzo, S.; Schiuma, G.; Beltrami, S.; Strazzabosco, G.; Fernandez, M.; Caccuri, F.; Caruso, A.; Rizzo, R. TLR3 and TLR7 RNA sensor activation during SARS-CoV-2 infection. Microorganisms 2021, 9, 1820. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhang, L.; Geng, H.; Deng, Y.; Huang, B.; Guo, Y.; Zhao, Z.; Tan, W. The structural and accessory proteins M, ORF 4a, ORF 4b, and ORF 5 of Middle East respiratory syndrome coronavirus (MERS-CoV) are potent interferon antagonists. Protein Cell 2013, 4, 951–961. [Google Scholar] [CrossRef] [Green Version]
- Kopecky-Bromberg, S.A.; Martínez-Sobrido, L.; Frieman, M.; Baric, R.A.; Palese, P. Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as interferon antagonists. J. Virol. 2007, 81, 548–557. [Google Scholar] [CrossRef] [Green Version]
- Mielech, A.M.; Kilianski, A.; Baez-Santos, Y.M.; Mesecar, A.D.; Baker, S.C. MERS-CoV papain-like protease has deISGylating and deubiquitinating activities. Virology 2014, 450, 64–70. [Google Scholar] [CrossRef]
- Chen, X.; Yang, X.; Zheng, Y.; Yang, Y.; Xing, Y.; Chen, Z. SARS coronavirus papain-like protease inhibits the type I interferon signaling pathway through interaction with the STING-TRAF3-TBK1 complex. Protein Cell 2014, 5, 369–381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darnell, J.E., Jr.; Kerr, I.M.; Stark, G.R. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994, 264, 1415–1421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trinchieri, G. Type I interferon: Friend or foe? J. Exp. Med. 2010, 207, 2053–2063. [Google Scholar] [CrossRef]
- Au-Yeung, N.; Mandhana, R.; Horvath, C.M. Transcriptional regulation by STAT1 and STAT2 in the interferon JAK-STAT pathway. JAK-STAT 2013, 2, e23931. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mahony, R.; Gargan, S.; Roberts, K.L.; Bourke, N.; Keating, S.E.; Bowie, A.; O’Farrelly, C.; Stevenson, N.J. A novel anti-viral role for STAT3 in IFN-α signalling responses. Cell. Mol. Life Sci. 2017, 74, 1755–1764. [Google Scholar] [CrossRef] [PubMed]
- Schneider, W.M.; Chevillotte, M.D.; Rice, C.M. Interferon-Stimulated Genes: A complex web of host defenses. Annu. Rev. Immunol. 2014, 32, 513–545. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.-C.; Tang, Z.-Y.; Wang, L.; Qin, L.-X.; Ma, Z.-C.; Ye, Q.-H.; Zhang, B.-H.; Qian, Y.-B.; Wu, Z.-Q.; Fan, J.; et al. Postoperative interferon α treatment postponed recurrence and improved overall survival in patients after curative resection of HBV-related hepatocellular carcinoma: A randomized clinical trial. J. Cancer Res. Clin. Oncol. 2006, 132, 458–465. [Google Scholar] [CrossRef]
- Nguyen, M.H.; Wright, T.L. Therapeutic advances in the management of hepatitis B and hepatitis C. Curr. Opin. Infect. Dis. 2001, 14, 593–601. [Google Scholar] [CrossRef]
- Rockley, P.F.; Tyring, S.K. Interferons alpha, beta and gamma therapy of anogenital human papillomavirus infections. Pharmacol. Ther. 1995, 65, 265–287. [Google Scholar] [CrossRef]
- Krown, S.E.; Li, P.; Von Roenn, J.H.; Paredes, J.; Huang, J.; Testa, M.A. Efficacy of low-dose interferon with antiretroviral therapy in Kaposi’s sarcoma: A randomized phase II AIDS clinical trials group study. J. Interferon Cytokine Res. 2002, 22, 295–303. [Google Scholar] [CrossRef] [PubMed]
- Shalhoub, S.; Farahat, F.; Al-Jiffri, A.; Simhairi, R.; Shamma, O.; Siddiqi, N.; Mushtaq, A. IFN-α2a or IFN-β1a in combination with ribavirin to treat Middle East respiratory syndrome coronavirus pneumonia: A retrospective study. J. Antimicrob. Chemother. 2015, 70, 2129–2132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cinatl, J.; Morgenstern, B.; Bauer, G.; Chandra, P.; Rabenau, H.; Doerr, H.W. Treatment of SARS with human interferons. Lancet 2003, 362, 293–294. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhang, F.; Xu, M.; Huang, K.; Zhong, W.; Cai, W.; Yin, Z.; Huang, S.; Deng, Z.; Wei, M.; et al. Description and clinical treatment of an early outbreak of severe acute respiratory syndrome (SARS) in Guangzhou, PR China. J. Med. Microbiol. 2003, 52, 715–720. [Google Scholar] [CrossRef]
- Frieman, M.; Yount, B.; Heise, M.; Kopecky-Bromberg, S.A.; Palese, P.; Baric, R.S. Severe Acute respiratory syndrome coronavirus ORF6 antagonizes STAT1 function by sequestering nuclear import factors on the rough endoplasmic reticulum/golgi membrane. J. Virol. 2007, 81, 9812–9824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wathelet, M.G.; Orr, M.; Frieman, M.B.; Baric, R.S. Severe Acute Respiratory Syndrome Coronavirus Evades Antiviral Signaling: Role of nsp1 and Rational Design of an Attenuated Strain. J. Virol. 2007, 81, 11620–11633. [Google Scholar] [CrossRef] [Green Version]
- Minakshi, R.; Padhan, K.; Rani, M.; Khan, N.; Ahmad, F.; Jameel, S. The SARS Coronavirus 3a Protein Causes Endoplasmic Reticulum Stress and Induces Ligand-Independent Downregulation of the Type 1 Interferon Receptor. PLoS ONE 2009, 4, e8342. [Google Scholar] [CrossRef]
- Wu, Y.; Ma, L.; Zhuang, Z.; Cai, S.; Zhao, Z.; Zhou, L.; Zhang, J.; Wang, P.-H.; Zhao, J.; Cui, J. Main protease of SARS-CoV-2 serves as a bifunctional molecule in restricting type I interferon antiviral signaling. Signal Transduct. Target. Ther. 2020, 5, 1–3. [Google Scholar] [CrossRef]
- Xia, H.; Cao, Z.; Xie, X.; Zhang, X.; Chen, J.Y.-C.; Wang, H.; Menachery, V.D.; Rajsbaum, R.; Shi, P.-Y. Evasion of type I interferon by SARS-CoV-2. Cell Rep. 2020, 33, 108234. [Google Scholar] [CrossRef]
- Yuen, C.-K.; Lam, J.-Y.; Wong, W.-M.; Mak, L.-F.; Wang, X.; Chu, H.; Cai, J.-P.; Jin, D.-Y.; To, K.K.-W.; Chan, J.F.-W.; et al. SARS-CoV-2 nsp13, nsp14, nsp15 and orf6 function as potent interferon antagonists. Emerg. Microbes Infect. 2020, 9, 1418–1428. [Google Scholar] [CrossRef]
- Gargan, S.; Ahmed, S.; Mahony, R.; Bannan, C.; Napoletano, S.; O’Farrelly, C.; Borrow, P.; Bergin, C.; Stevenson, N.J. HIV-1 Promotes the Degradation of Components of the Type 1 IFN JAK/STAT Pathway and Blocks Anti-viral ISG Induction. EBioMedicine 2018, 30, 203–216. [Google Scholar] [CrossRef] [Green Version]
- Coelho, L.F.L.; de Freitas Almeida, G.M.; Mennechet, F.J.; Blangy, A.; Uzé, G. Interferon-α and-β differentially regulate osteoclastogenesis: Role of differential induction of chemokine CXCL11 expression. Proc. Natl. Acad. Sci. USA 2005, 102, 11917–11922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Najjar, I.; Fagard, R. STAT1 and pathogens, not a friendly relationship. Biochimie 2010, 92, 425–444. [Google Scholar] [CrossRef]
- Steen, H.C.; Gamero, A.M. STAT2 phosphorylation and signaling. JAK-STAT 2013, 2, e25790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Günther, J.; Seyfert, H.-M. The first line of defence: Insights into mechanisms and relevance of phagocytosis in epithelial cells. Semin. Immunopathol. 2018, 40, 555–565. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lieber, M.; Todaro, G.; Smith, B.; Szakal, A.; Nelson-Rees, W. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int. J. Cancer 1976, 17, 62–70. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Na, T.; Wu, T.; Yuan, B.-Z. Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells. PLoS ONE 2020, 15, e0227174. [Google Scholar] [CrossRef]
- Channappanavar, R.; Perlman, S. Pathogenic human coronavirus infections: Causes and consequences of cytokine storm and immunopathology. Semin. Immunopathol. 2017, 39, 529–539. [Google Scholar] [CrossRef]
- Hillyer, P.; Shepard, R.; Uehling, M.; Krenz, M.; Sheikh, F.; Thayer, K.R.; Huang, L.; Yan, L.; Panda, D.; Luongo, C.; et al. Differential responses by human respiratory epithelial cell lines to respiratory syncytial virus reflect distinct patterns of infection control. J. Virol. 2018, 92, 02202–02217. [Google Scholar] [CrossRef] [Green Version]
- Seng, L.-G.; Daly, J.; Chang, K.-C.; Kuchipudi, S.V. High Basal expression of interferon-stimulated genes in human bronchial epithelial (BEAS-2B) cells contributes to influenza a virus resistance. PLoS ONE 2014, 9, e109023. [Google Scholar] [CrossRef] [Green Version]
- Raftery, N.; Stevenson, N.J. Advances in anti-viral immune defence: Revealing the importance of the IFN JAK/STAT pathway. Cell. Mol. Life Sci. 2017, 74, 2525–2535. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.-H.; Yun, Y. HBx protein of hepatitis B virus activates Jak1-STAT signaling. J. Biol. Chem. 1998, 273, 25510–25515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Danial, N.N.; Pernis, A.; Rothman, P.B. Jak-STAT Signaling Induced by the v-abl oncogene. Science 1995, 269, 1875–1877. [Google Scholar] [CrossRef] [PubMed]
- Ruvolo, V.; Navarro, L.; Sample, C.E.; David, M.; Sung, S.; Swaminathan, S. The Epstein-Barr virus SM protein induces STAT1 and interferon-stimulated gene expression. J. Virol. 2003, 77, 3690–3701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Convery, O.; Gargan, S.; Kickham, M.; Schroder, M.; O’Farrelly, C.; Stevenson, N.J. The hepatitis C virus (HCV) protein, p7, suppresses inflammatory responses to tumor necrosis factor (TNF)-α via signal transducer and activator of transcription (STAT) 3 and extracellular signal-regulated kinase (ERK)–mediated induction of suppressor of cytokine signaling (SOCS) 3. FASEB J. 2019, 33, 8732–8744. [Google Scholar] [CrossRef]
- Tacke, R.S.; Tosello-Trampont, A.; Nguyen, V.; Mullins, D.W.; Hahn, Y.S. Extracellular hepatitis C Virus core protein activates STAT3 in human monocytes/macrophages/dendritic cells via an IL-6 autocrine pathway. J. Biol. Chem. 2011, 286, 10847–10855. [Google Scholar] [CrossRef] [Green Version]
- Gong, G.; Waris, G.; Tanveer, R.; Siddiqui, A. Human hepatitis C virus NS5A protein alters intracellular calcium levels, induces oxidative stress, and activates STAT-3 and NF-κB. Proc. Natl. Acad. Sci. USA 2001, 98, 9599–9604. [Google Scholar] [CrossRef] [Green Version]
- Yu, Y.; Wang, R.; Nan, Y.; Zhang, L.; Zhang, Y. Induction of STAT1 phosphorylation at serine 727 and expression of proinflammatory cytokines by porcine reproductive and respiratory syndrome virus. PLoS ONE 2013, 8, e61967. [Google Scholar] [CrossRef] [PubMed]
- McLaren, J.; Rowe, M.; Brennan, P.; Borghan, M.A.; Mori, Y.; El-Mahmoudy, A.-B.; Ito, N.; Sugiyama, M.; Takewaki, T.; Minamoto, N. Epstein-Barr virus induces a distinct form of DNA-bound STAT1 compared with that found in interferon-stimulated B lymphocytes. J. Gen. Virol. 2007, 88, 1876–1886. [Google Scholar] [CrossRef]
- Boudewijns, R.; Thibaut, H.J.; Kaptein, S.J.; Li, R.; Vergote, V.; Seldeslachts, L.; Van Weyenbergh, J.; De Keyzer, C.; Bervoets, L.; Sharma, S. STAT2 signaling restricts viral dissemination but drives severe pneumonia in SARS-CoV-2 infected hamsters. Nat. Commun. 2020, 11, 1–10. [Google Scholar] [CrossRef]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.-C.; Uhl, S.; Hoagland, D.; Møller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sachs, D. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 2020, 181, 1036–1045. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Han, S.; Liu, R.; Meng, L.; He, H.; Zhang, Y.; Wang, C.; Lv, Y.; Wang, J.; Li, X.; et al. Chloroquine and hydroxychloroquine as ACE2 blockers to inhibit viropexis of 2019-nCoV Spike pseudotyped virus. Phytomedicine 2020, 79, 153333. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Zhang, L.; Luk, H.K.; Xiong, L.; Peng, X.; Li, K.S.; He, X.; Zhao, P.; Fan, R.Y.; Wong, A.C. Receptor usage of a novel bat lineage C betacoronavirus reveals evolution of MERS-related coronavirus spike proteins for human DPP4 binding. J. Infect. Dis. 2018, 218, 197–207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- ACE2 Expression in Different Cell Lines. Available online: https://www.proteinatlas.org/ENSG00000130234-ACE2/cell+line (accessed on 10 December 2021).
- DPP4 Expression in Different Cell Lines. Available online: https://www.proteinatlas.org/ENSG00000197635-DPP4/cell+line (accessed on 10 December 2021).
- Ye, R.; Liu, Z. ACE2 exhibits protective effects against LPS-induced acute lung injury in mice by inhibiting the LPS-TLR4 pathway. Exp. Mol. Pathol. 2019, 113, 104350. [Google Scholar] [CrossRef]
- Lv, J.; Yu, P.; Wang, Z.; Deng, W.; Bao, L.; Liu, J.; Li, F.; Zhu, Q.; Zhou, N.; Lv, Q. ACE2 expression is regulated by AhR in SARS-CoV-2-infected macaques. Cell. Mol. Immunol. 2021, 18, 1308–1310. [Google Scholar] [CrossRef] [PubMed]
- DPP4 Expression in Tissues. Available online: https://www.proteinatlas.org/ENSG00000197635-DPP4/tissue (accessed on 10 December 2021).
- Ziegler, C.G.; Allon, S.J.; Nyquist, S.K.; Mbano, I.M.; Miao, V.N.; Tzouanas, C.N.; Cao, Y.; Yousif, A.S.; Bals, J.; Hauser, B.M. SARS-CoV-2 receptor ACE2 is an interferon-stimulated gene in human airway epithelial cells and is detected in specific cell subsets across tissues. Cell 2020, 181, 1016–1035.e19. [Google Scholar] [CrossRef] [PubMed]
- Saccon, E.; Chen, X.; Mikaeloff, F.; Rodriguez, J.E.; Szekely, L.; Vinhas, B.S.; Krishnan, S.; Byrareddy, S.N.; Frisan, T.; Végvári, Á. Cell-type-resolved quantitative proteomics map of interferon response against SARS-CoV-2. Iscience 2021, 24, 102420. [Google Scholar] [CrossRef]
- Elliott, J.; Lynch, O.T.; Suessmuth, Y.; Qian, P.; Boyd, C.R.; Burrows, J.F.; Buick, R.; Stevenson, N.J.; Touzelet, O.; Gadina, M.; et al. Respiratory Syncytial Virus NS1 Protein Degrades STAT2 by Using the Elongin-Cullin E3 Ligase. J. Virol. 2007, 81, 3428–3436. [Google Scholar] [CrossRef] [Green Version]
- Stevenson, N.J.; Bourke, N.; Ryan, E.; Binder, M.; Fanning, L.; Johnston, J.A.; Hegarty, J.E.; Long, A.; O’Farrelly, C. Hepatitis C virus targets the interferon-α JAK/STAT pathway by promoting proteasomal degradation in immune cells and hepatocytes. FEBS Lett. 2013, 587, 1571–1578. [Google Scholar] [CrossRef] [Green Version]
- Ulane, C.M.; Rodriguez, J.J.; Parisien, J.-P.; Horvath, C.M. STAT3 Ubiquitylation and Degradation by Mumps Virus Suppress Cytokine and Oncogene Signaling. J. Virol. 2003, 77, 6385–6393. [Google Scholar] [CrossRef] [Green Version]
- Selinger, C.; Tisoncik-Go, J.; Menachery, V.D.; Agnihothram, S.; Law, G.L.; Chang, J.; Kelly, S.M.; Sova, P.; Baric, R.S.; Katze, M.G. Cytokine systems approach demonstrates differences in innate and pro-inflammatory host responses between genetically distinct MERS-CoV isolates. BMC Genom. 2014, 15, 1161. [Google Scholar] [CrossRef] [Green Version]
- Mizutani, T.; Fukushi, S.; Murakami, M.; Hirano, T.; Saijo, M.; Kurane, I.; Morikawa, S. Tyrosine dephosphorylation of STAT3 in SARS coronavirus-infected Vero E6 cells. FEBS Lett. 2004, 577, 187–192. [Google Scholar] [CrossRef] [Green Version]
- Haller, O.; Kochs, G. Human MxA protein: An interferon-induced dynamin-like GTPase with broad antiviral activity. J. Interf. Cytokine Res. 2011, 31, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Ward, S.V.; Samuel, C.E. Regulation of the interferon-inducible PKR kinase gene: The KCS Element is a constitutive promoter element that functions in concert with the interferon-stimulated response element. Virology 2002, 296, 136–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sung, P.S.; Hong, S.-H.; Chung, J.-H.; Kim, S.; Park, S.-H.; Kim, H.M.; Yoon, S.K.; Shin, E.-C. IFN-λ4 potently blocks IFN-α signalling by ISG15 and USP18 in hepatitis C virus infection. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Stevenson, N.J.; Murphy, A.G.; Bourke, N.; Keogh, C.A.; Hegarty, J.E.; O’Farrelly, C. Ribavirin enhances IFN-α Signalling and MxA expression: A novel immune modulation mechanism during treatment of HCV. PLoS ONE 2011, 6, e27866. [Google Scholar] [CrossRef] [PubMed]
- Mu, J.; Fang, Y.; Yang, Q.; Shu, T.; Wang, A.; Huang, M.; Jin, L.; Deng, F.; Qiu, Y.; Zhou, X. SARS-CoV-2 N protein antagonizes type I interferon signaling by suppressing phosphorylation and nuclear translocation of STAT1 and STAT2. Cell Discov. 2020, 6, 1–4. [Google Scholar] [CrossRef]
- Loutfy, M.R.; Blatt, L.M.; Siminovitch, K.A.; Ward, S.; Wolff, B.; Lho, H.; Pham, D.H.; Deif, H.; LaMere, E.A.; Chang, M.; et al. Interferon alfacon-1 plus corticosteroids in severe acute respiratory syndrome: A preliminary study. JAMA 2003, 290, 3222–3228. [Google Scholar] [CrossRef] [Green Version]
- Arabi, Y.M.; Alothman, A.; Balkhy, H.H.; Al-Dawood, A.; AlJohani, S.; Al Harbi, S.; Kojan, S.; Al Jeraisy, M.; Deeb, A.M.; Assiri, A.M.; et al. Treatment of Middle East Respiratory Syndrome with a combination of lopinavir-ritonavir and interferon-beta1b (MIRACLE trial): Study protocol for a randomized controlled trial. Trials 2018, 19, 81. [Google Scholar] [CrossRef]
- Pang, J.; Wang, M.X.; Ang, I.Y.H.; Tan, S.H.X.; Lewis, R.F.; Chen, J.I.-P.; Gutierrez, R.A.; Gwee, S.X.W.; Chua, P.E.Y.; Yang, Q.; et al. Potential rapid diagnostics, vaccine and therapeutics for 2019 novel coronavirus (2019-nCoV): A systematic review. J. Clin. Med. 2020, 9, 623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monk, P.D.; Marsden, R.J.; Tear, V.J.; Brookes, J.; Batten, T.N.; Mankowski, M.; Gabbay, F.J.; Davies, D.E.; Holgate, S.T.; Ho, L.-P. Safety and efficacy of inhaled nebulised interferon beta-1a (SNG001) for treatment of SARS-CoV-2 infection: A randomised, double-blind, placebo-controlled, phase 2 trial. Lancet Respir. Med. 2021, 9, 196–206. [Google Scholar] [CrossRef]
- Lokugamage, K.G.; Schindewolf, C.; Menachery, V.D. SARS-CoV-2 sensitive to type I interferon pretreatment. BioRxiv 2020. BioRxiv:2020.03.07.982264. [Google Scholar]
Gene Name | Forward Primer Sequence | Reverse Primer Sequence | Ref. |
---|---|---|---|
RPS15 (NM_001308226.2) [Housekeeping Reference Gene] | CGGACCAAAGCGATCTCTTC | CGCACTGTACAGCTGCATCA | [43] |
MxA (NM_001178046.3) | GGTGGTGGTCCCCAGTAATG | ACCACGTCCACAACCTTGTCT | [43] |
ISG15 (NM_005101.4) | TCCTGCTGGTGGTGGACAA | TTGTTATTCCTCACCAGGATGCT | [43] |
PKR (NM_002759.4) | TCTACGCTTTGGGGCTAA | GCCATCCCGTAGGTCTGT | [44] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Gargan, S.; Roche, F.M.; Frieman, M.; Stevenson, N.J. Inhibition of the IFN-α JAK/STAT Pathway by MERS-CoV and SARS-CoV-1 Proteins in Human Epithelial Cells. Viruses 2022, 14, 667. https://doi.org/10.3390/v14040667
Zhang Y, Gargan S, Roche FM, Frieman M, Stevenson NJ. Inhibition of the IFN-α JAK/STAT Pathway by MERS-CoV and SARS-CoV-1 Proteins in Human Epithelial Cells. Viruses. 2022; 14(4):667. https://doi.org/10.3390/v14040667
Chicago/Turabian StyleZhang, Yamei, Siobhan Gargan, Fiona M. Roche, Matthew Frieman, and Nigel J. Stevenson. 2022. "Inhibition of the IFN-α JAK/STAT Pathway by MERS-CoV and SARS-CoV-1 Proteins in Human Epithelial Cells" Viruses 14, no. 4: 667. https://doi.org/10.3390/v14040667
APA StyleZhang, Y., Gargan, S., Roche, F. M., Frieman, M., & Stevenson, N. J. (2022). Inhibition of the IFN-α JAK/STAT Pathway by MERS-CoV and SARS-CoV-1 Proteins in Human Epithelial Cells. Viruses, 14(4), 667. https://doi.org/10.3390/v14040667