Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Total RNA Extraction and cDNA Synthesis
2.3. Candidate Reference Genes and Primer Design
2.4. RT-qPCR Assay
2.5. Data Analysis
2.6. Comparison of Reference Genes and Unstable Reference Genes
3. Results
3.1. Primer Specificity and PCR Amplification Efficiency Verification
3.2. Candidate Reference Genes Ct Values
3.3. Analysis of Gene Expression Stability
3.4. Reffinder Analysis and Reference Gene Selection
3.5. Comparison of Reference Genes and Unstable Candidate Reference Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| ACT7 | actin 7 |
| ACT97 | actin 97 |
| UBQ1 | ubiquitin extension protein1 |
| eIF2 | eukaryotic translation initiation factor 2 |
| eIF3 | eukaryotic translation initiation factor 3 |
| HIS | histone H3 |
| BIG | auxin transport protein BIG |
| TUB | tubulin beta |
| AGD11 | ADP-ribosylation factor activating protein AGD11 |
| EFG | elongation factor G |
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase |
| CYP | cyclophilin |
| RPL25 | 50S ribosomal protein L25 |
| UBC | ubiquitin conjugating enzyme ATG10 |
| RPB1 | RNA polymerase II subunit RPB1 |
Appendix A


References
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Guan, H.; Song, M.; Fu, Y.; Han, X.; Lei, M.; Ren, J.; Guo, B.; He, W.; Wei, Y. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets. PeerJ 2018. [Google Scholar] [CrossRef] [PubMed]
- Moreira, V.S.; Soares, V.L.F.; Silva, R.J.S.; Sousa, A.O.; Otoni, W.C.; Costa, M.G.C. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L. Physiol. Mol. Biol. Plants 2018, 24, 369–378. [Google Scholar] [CrossRef]
- Lee, P.D.; Sladek, R.; Greenwood, C.M.T.; Hudson, T.J. Control genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res. 2002, 12, 292–297. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.-Y.; Seo, P.J.; Yang, M.-S.; Xiang, F.; Park, C.-M. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR. BMC Plant Biol. 2008, 8, 112. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zhang, H.; Liu, L.; Li, W.; Wei, Y.; Shi, S. Validation of Reference Genes for RT-qPCR Studies of Gene Expression in Preharvest and Postharvest Longan Fruits under Different Experimental Conditions. Front. Plant Sci. 2016, 7. [Google Scholar] [CrossRef] [PubMed]
- Tian, C.; Jiang, Q.; Wang, F.; Wang, G.L.; Xu, Z.S.; Xiong, A.S. Selection of suitable reference genes for qPCR normalization under abiotic stresses and hormone stimuli in carrot leaves. PLoS ONE 2015, 10, e0117569. [Google Scholar] [CrossRef] [PubMed]
- Sgamma, T.; Pape, J.; Massiah, A.; Jackson, S. Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods 2016, 12. [Google Scholar] [CrossRef]
- Jain, N.; Vergish, S.; Khurana, J.P. Validation of house-keeping genes for normalization of gene expression data during diurnal/circadian studies in rice by RT-qPCR. Sci. Rep. 2018, 8. [Google Scholar] [CrossRef]
- Ferna’ndez-Aparicio, M.; Wickett, N.J.; Timko, M.P.; Huang, K.; Wafula, E.K.; dePamphilis, C.W.; Honaas, L.A.; Yoder, J.I.; Westwood, J.H. Application of qRT-PCR and RNA-seq analysis for the identification of housekeeping genes useful for normalization of gene expression values during Striga hermonthica development. Mol. Biol. Rep. 2013, 40, 3395–3407. [Google Scholar] [CrossRef]
- Chen, H.; Yang, Z.; Hu, Y.; Tan, J.; Jia, J.; Xu, H.; Chen, X. Reference genes selection for quantitative gene expression studies in Pinus massoniana L. Trees 2015, 30, 685–696. [Google Scholar] [CrossRef]
- Bao, W.; Qu, Y.; Shan, X.; Wan, Y. Screening and Validation of Housekeeping Genes of the Root and Cotyledon of Cunninghamia lanceolata under Abiotic Stresses by Using Quantitative Real-Time PCR. Int. J. Mol. Sci. 2016, 17, 1198. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Chen, C.; Cai, H.; Wu, L. Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus. Genes 2018, 9, 475. [Google Scholar] [CrossRef]
- Liu, S.; Sun, Z.; Xu, M. Identification and characterization of long non-coding RNAs involved in the formation and development of poplar adventitious roots. Ind. Crops Prod. 2018, 118, 334–346. [Google Scholar] [CrossRef]
- Chen, C.; Zheng, Y.; Zhong, Y.; Wu, Y.; Li, Z.; Xu, L.; Xu, M. Transcriptome analysis and identification of genes related to terpenoid biosynthesis in Cinnamomum camphora. BMC Genom. 2016, 11, e0157370. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, Y.; Ding, L.; Zhang, J.; Wei, J.; Wang, H. Validation of Reference Genes for Gene Expression by Quantitative Real-Time RT-PCR in Stem Segments Spanning Primary to Secondary Growth in Populus tomentosa. PLoS ONE 2016, 11, e0157370. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zhang, J.; Pan, Y.; Huang, H.; Lou, X.; Tong, Z. Identification and evaluation of reference genes for normalization in quantitative real-time PCR analysis in the premodel tree Betula luminifera. J. For. Res. 2016, 28, 273–282. [Google Scholar] [CrossRef]
- Jacob, F.; Guertler, R.; Naim, S.; Nixdorf, S.; Heinzelmann-Schwarz, V. Careful Selection of Reference Genes is Required for Reliable Performance of RT-qPCR in Human Normal and Cancer Cell Lines. PLoS ONE 2013, 8, e59180. [Google Scholar] [CrossRef]
- Yang, Y.; Xu, M.; Luo, Q.; Wang, J.; Li, H. De novo transcriptome analysis of Liriodendron chinense petals and leaves by illumina sequencing. Gene 2014, 534, 155–162. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhang, H.; Xie, T.; Xu, Y.; Zhao, L.; Tian, W. Effects of Climate Change on the Potentially Suitable Climatic Geographical Range of Liriodendron chinense. Forests 2017, 8, 399. [Google Scholar] [CrossRef]
- Hao, R.; He, S.; Tang, S.; Wu, S. Geographical distribution of Liriodendron chinense in China and its significance. J. Plant Resour. Environ. 1995, 4, 1–6, (Chinese with English Abstract). [Google Scholar]
- Xu, J.; Li, G. Cloning and primary functional analysis of LcPAT8 gene from Liriodendron chinense. Sci. Silvae Sin. 2017, 53, 10, (Chinese with English Abstract). [Google Scholar]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal. Genome Biol. 2002, 3. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: Bestkeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Chen, L.; Feng, Y.; Yao, J.; Li, B.; Xu, M.; Li, H. High genetic diversity but limited gene flow among remnant and fragmented natural populations of Liriodendron chinense Sarg. Biochem. Syst. Ecol. 2014, 54, 230–236. [Google Scholar] [CrossRef]
- Ma, J.; Wei, L.; Li, J.; Li, H. The Analysis of Genes and Phytohormone Metabolic Pathways Associated with Leaf Shape Development in Liriodendron chinense via De Novo Transcriptome Sequencing. Genes 2018, 9, 577. [Google Scholar] [CrossRef] [PubMed]
- Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.; Moorman, A.F.M. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef]
- Zhao, J.; Yang, F.; Feng, J.; Wang, Y.; Lachenbruch, B.; Wang, J.; Wan, X. Genome-Wide Constitutively Expressed Gene Analysis and New Reference Gene Selection Based on Transcriptome Data: A Case Study from Poplar/Canker Disease Interaction. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef]
- Artico, S.; Nardeli, S.M.; Brilhante, O.; Alves-Ferreira, M. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data. BMC Plant Biol. 2010, 10, 49. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez, L.; Mauriat, M.; Guenin, S.; Pelloux, J.; Lefebvre, J.F.; Louvet, R.; Rusterucci, C.; Moritz, T.; Guerineau, F.; Bellini, C.; et al. The lack of a systematic validation of reference genes: A serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnol. J. 2008, 6, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Yuan, F.; Long, G.; Qin, L.; Deng, Z. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Mol. Biol. Rep. 2012, 39, 1831–1838. [Google Scholar] [CrossRef] [PubMed]
- Die, J.V.; Roman, B.; Nadal, S.; Gonzalez-Verdejo, C.I. Evaluation of candidate reference genes for expression studies in Pisum sativum under different experimental conditions. Planta 2010, 232, 145–153. [Google Scholar] [CrossRef] [PubMed]
- Mallona, I.; Lischewski, S.; Julia Weiss, B.H.; Egea-Cortines, M. Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida. BMC Plant Biol. 2010, 10, 414. [Google Scholar] [CrossRef] [PubMed]
- Rudy, H.; Simon, H.; Godfrey, N. Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.). BMC Plant Biol. 2010, 10, 71. [Google Scholar]
- Schmidt, G.W.; Delaney, S.K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress. Mol. Genet. Genom. 2010, 283, 233–241. [Google Scholar] [CrossRef]
- Wu, Z.J.; Tian, C.; Jiang, Q.; Li, X.H.; Zhuang, J. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis). Sci. Rep. 2016, 6, 19748. [Google Scholar] [CrossRef]
- Xu, M.; Zhang, B.; Su, X.; Zhang, S.; Huang, M. Reference gene selection for quantitative real-time polymerase chain reaction in Populus. Anal. Biochem. 2011, 408, 337–339. [Google Scholar] [CrossRef]
- Amorim, L.L.B.; Ferreira-Neto, J.R.C.; Bezerra-Neto, J.P.; Pandolfi, V.; de Araujo, F.T.; da Silva Matos, M.K.; Santos, M.G.; Kido, E.A.; Benko-Iseppon, A.M. Cowpea and abiotic stresses: Identification of reference genes for transcriptional profiling by qPCR. Plant Methods 2018, 14, 88–105. [Google Scholar] [CrossRef]
- Nguyen, D.Q.; Eamens, A.L.; Grof, C.P.L. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis. Plant Methods 2018, 14, 24–36. [Google Scholar] [CrossRef] [PubMed]
- Liang, W.; Zou, X.; Carballar-Lejarazu, R.; Wu, L.; Sun, W.; Yuan, X.; Wu, S.; Li, P.; Ding, H.; Ni, L.; et al. Selection and evaluation of reference genes for qRT-PCR analysis in Euscaphis konishii Hayata based on transcriptome data. Plant Methods 2018, 14, 42–51. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Zhang, N.; Si, H.; Calderon-Urrea, A. Selection and validation of reference genes for RT-qPCR analysis in potato under abiotic stress. Plant Methods 2017, 13, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Jian, B.; Liu, B.; Bi, Y.; Hou, W.; Wu, C.; Han, T. Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol. Biol. 2008, 9, 59. [Google Scholar] [CrossRef]
- Liu, Q.; Qi, X.; Yan, H.; Huang, L.; Nie, G.; Zhang, X. Reference gene selection for quantitative real-time reverse-transcriptase pcr in annual ryegrass (Lolium multiflorum) subjected to various abiotic stresses. Molecules 2018, 23, 172. [Google Scholar] [CrossRef]
- Acevedo, R.M.; Avico, E.H.; Ruiz, O.A.; Sansberro, P.A. Assessment of reference genes for real-time quantitative PCR normalization in Ilex paraguariensis leaves during drought. Biol. Plant. 2018, 62, 89–96. [Google Scholar] [CrossRef]
- Wan, D.; Wan, Y.; Yang, Q.; Zou, B.; Ren, W.; Ding, Y.; Wang, Z.; Wang, R.; Wang, K.; Hou, X. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses. PLoS ONE 2017, 12, e0169465. [Google Scholar] [CrossRef]
- Zhang, K.; Li, M.; Cao, S.; Sun, Y.; Long, R.; Kang, J.; Yan, L.; Cui, H. Selection and validation of reference genes for target gene analysis with quantitative real-time PCR in the leaves and roots of Carex rigescens under abiotic stress. Ecotoxicol. Environ. Safety 2018, 168, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Li, H. Gene cloning and expression analysis of DHHC protein family genes from Liriodendron chinense. Guihaia 2015, 36, 1052–1060, (Chinese with English Abstract). [Google Scholar]




| Gene Name | Primer Sequence (5′-3′) | Tentative Annotation | Amplicon Size (bp) | E | R |
|---|---|---|---|---|---|
| ACT7 | For:TCGAGCAGGAGCTAGAGACA | Actin 7 | 131 | 1.87 | 0.99 |
| Rev:AAGAGATGGCTGGAAGAGGA | |||||
| ACT97 | For:TTCCCGTTCAGCAGTGGTCG | Actin 97 | 187 | 1.89 | 0.99 |
| Rev:TGGTCGCACAACTGGTATCG | |||||
| UBQ1 | For:ACGGGCAAGACCATTACCTT | Ubiquitin extension | 121 | 1.89 | 0.99 |
| Rev:GCTTCCCTGCAAAGATCAACC | protein 1 | ||||
| eIF2 | For:ACCTAGAGTGCCGGATGTACGAA | Eukaryotic translation | 201 | 1.88 | 0.99 |
| Rev:CTTGCTGAGGTCGATGTATCCCTT | initiation factor 2 | ||||
| eIF3 | For:CATCCAATTTCACTTTCCGCTCCAC | Eukaryotic translation | 236 | 1.91 | 0.99 |
| Rev:AATCACCAGCAGACGAGAAGCA | initiation factor 3 | ||||
| HIS | For:TCAAGCCCTCTCACCACGGA | Histone H3 | 245 | 1.89 | 0.99 |
| Rev:GCAAGAGGCAGCAGAGGCAT | |||||
| BIG | For:GCCACAGAAGCCAGCGACAACA | Auxin transport | 229 | 1.81 | 0.99 |
| Rev:ACCCCACCATCTCCTTCACGTT | protein BIG | ||||
| AGD11 | For:ACCCAGCCTTCGTCCCTTCCAT | ADP-ribosylation factor | 111 | 1.86 | 0.99 |
| Rev:TGCCATCCCTCTCACTCTCCCT | activating protein AGD11 | ||||
| EFG | For:TGCATGGGCCTCTTGAATGTCCT | Elongation factor G | 193 | 1.88 | 0.99 |
| Rev:TGGACCTCTTGTTGCATTGGCTT | |||||
| GAPDH | For:GATCCCTTCATCACGACCGAT | Glyceraldehyde-3-phosphate | 191 | 1.86 | 0.99 |
| Rev:ACAACATATTCAGCGCCAGT | dehydrogenase | ||||
| CYP | For:CAGTCTTCCACCGCATAATCCCA | Cyclophilin | 152 | 2.04 | 0.99 |
| Rev:TGCCATTGATAACATGCCGGGAC | |||||
| RPL25 | For:TCCCGGAACCTACATGCGTCT | 50S ribosomal | 258 | 1.84 | 0.99 |
| Rev:ACATTACACCGCAGCAAATTGTCC | protein L25 | ||||
| UBC | For:CTTCCTGACGCAATCGCTTTCCACT | Ubiquitin conjugating | 178 | 1.86 | 0.99 |
| Rev:CAAATTCTCGCCGCACATCACAACC | enzyme ATG10 | ||||
| RPB1 | For:CTGCTGCCCTCATCCTTATTGCT | RNA polymerase II | 259 | 1.86 | 0.99 |
| Rev:CATCCAGTCCTTACAGCCCGACA | subunit RPB1 | ||||
| TUB | For:ACGGCAGACGATGAGGAGTATGAG | Tubulin beta | 275 | 1.87 | 0.99 |
| Rev:TCACGCCATAGGATAAGCAAACCA |
| Ranks | All Samples Gene Names | Stability Value | Vegetative Organs Gene Names | Stability Value | Flower Organs Gene Names | Stability Value |
|---|---|---|---|---|---|---|
| 1 | eIF3 | 0.16 | TUB | 0.46 | eIF3 | 0.15 |
| 2 | ACT97 | 0.18 | eIF3 | 0.47 | eIF2 | 0.16 |
| 3 | UBC | 0.22 | UBC | 0.49 | ACT97 | 0.18 |
| 4 | ACT7 | 0.24 | ACT97 | 0.50 | UBC | 0.20 |
| 5 | GAPDH | 0.26 | ACT7 | 0.55 | EFG | 0.23 |
| 6 | eIF2 | 0.26 | BIG | 0.55 | HIS | 0.24 |
| 7 | EFG | 0.26 | RPB1 | 0.60 | ACT7 | 0.28 |
| 8 | HIS | 0.28 | HIS | 0.61 | GAPDH | 0.30 |
| 9 | RPB1 | 0.38 | eIF2 | 0.62 | RPB1 | 0.31 |
| 10 | TUB | 0.42 | AGD11 | 0.62 | BIG | 0.34 |
| 11 | BIG | 0.42 | CYC | 0.64 | AGD11 | 0.34 |
| 12 | CYC | 0.50 | GAPDH | 0.66 | TUB | 0.44 |
| 13 | RPL25 | 0.55 | EFG | 0.70 | RPL25 | 0.47 |
| 14 | AGD11 | 0.65 | RPL25 | 0.89 | CYC | 0.49 |
| 15 | UBQ1 | 1.05 | UBQ1 | 1.36 | UBQ1 | 0.80 |
| Ranks | Total Samples Gene Name | SD | CV | Vegetative Organs Gene Name | SD | CV | Flower Organs Gene Name | SD | CV |
|---|---|---|---|---|---|---|---|---|---|
| 1 | ACT97 | 0.612 | 2.92 | UBC | 0.67 | 2.50 | UBC | 0.50 | 1.92 |
| 2 | HIS | 0.62 | 3.45 | ACT97 | 0.68 | 3.17 | eIF3 | 0.50 | 2.28 |
| 3 | RPB1 | 0.67 | 2.96 | RPB1 | 0.70 | 3.05 | ACT7 | 0.52 | 2.63 |
| 4 | eIF3 | 0.68 | 3.05 | HIS | 0.72 | 3.94 | GAPDH | 0.53 | 2.99 |
| 5 | UBC | 0.68 | 2.59 | BIG | 0.73 | 2.95 | HIS | 0.54 | 3.04 |
| 6 | ACT7 | 0.71 | 3.53 | CYP | 0.74 | 3.35 | ACT97 | 0.54 | 2.58 |
| 7 | CYP | 0.73 | 3.35 | eIF3 | 0.80 | 3.48 | eIF2 | 0.54 | 2.42 |
| 8 | TUB | 0.74 | 3.20 | TUB | 0.80 | 3.41 | AGD11 | 0.56 | 2.26 |
| 9 | eIF2 | 0.77 | 3.40 | ACT7 | 0.84 | 4.07 | RPB1 | 0.62 | 2.76 |
| 10 | GAPDH | 0.78 | 4.32 | AGD11 | 0.85 | 3.12 | TUB | 0.63 | 2.76 |
| 11 | EFG | 0.79 | 3.28 | eIF2 | 0.87 | 3.70 | EFG | 0.64 | 2.71 |
| 12 | BIG | 0.81 | 3.37 | RPL25 | 0.88 | 3.63 | BIG | 0.69 | 2.90 |
| 13 | RPL25 | 0.86 | 3.61 | GAPDH | 0.91 | 4.86 | RPL25 | 0.71 | 3.02 |
| 14 | AGD11 | 1.12 | 4.40 | UBQ1 | 0.93 | 4.20 | CYP | 0.72 | 3.30 |
| 15 | UBQ1 | 1.25 | 5.90 | EFG | 0.95 | 3.85 | UBQ1 | 1.02 | 4.93 |
| Samples | Ranks | geNorm | NormFinder | BestKeeper | RefFinder |
|---|---|---|---|---|---|
| Total samples | 1 | GAPDH | eIF3 | ACT97 | eIF3 |
| 2 | ACT7 | ACT97 | HIS | ACT97 | |
| 3 | eIF3 | UBC | RPB1 | ACT7 | |
| 4 | ACT97 | ACT7 | eIF3 | GAPDH | |
| 5 | EFG | GAPDH | UBC | UBC | |
| Vegetative organs | 1 | HIS | TUB | UBC | ACT97 |
| 2 | UBC | eIF3 | ACT97 | ACT7 | |
| 3 | ACT97 | UBC | RPB1 | GAPDH | |
| 4 | RPB1 | ACT97 | HIS | UBC | |
| 5 | BIG | ACT7 | BIG | eIF3 | |
| Flower organs | 1 | eIF2 | eIF3 | UBC | eIF3 |
| 2 | HIS | eIF2 | eIF3 | UBC | |
| 3 | UBC | ACT97 | ACT7 | eIF2 | |
| 4 | ACT97 | UBC | GAPDH | ACT7 | |
| 5 | eIF3 | EFG | HIS | ACT97 |
| Ranks | All Samples Geo-Mean of Ranking Values | Gene Name | Vegetative Organs Geo-Mean of Ranking Values | Gene Name | Flower Organs Geo-Mean of Ranking Values | Gene Name |
|---|---|---|---|---|---|---|
| 1 | 1.86 | eIF3 | 1.57 | ACT97 | 1.57 | eIF3 |
| 2 | 2.00 | ACT97 | 2.45 | ACT7 | 3.25 | UBC |
| 3 | 2.91 | ACT7 | 3.46 | GAPDH | 3.44 | eIF2 |
| 4 | 4.33 | GAPDH | 3.96 | UBC | 3.48 | ACT7 |
| 5 | 4.36 | UBC | 4.28 | eIF3 | 3.66 | ACT97 |
| 6 | 5.66 | HIS | 5.63 | HIS | 4.00 | GAPDH |
| 7 | 6.59 | eIF2 | 5.89 | TUB | 6.22 | EFG |
| 8 | 6.93 | EFG | 7.95 | RPB1 | 6.45 | HIS |
| 9 | 7.02 | RPB1 | 8.13 | CYP | 9.00 | RPB1 |
| 10 | 8.91 | TUB | 9.03 | EFG | 9.69 | AGD11 |
| 11 | 10.61 | CYP | 9.64 | BIG | 11.45 | TUB |
| 12 | 11.49 | BIG | 10.24 | eIF2 | 11.49 | BIG |
| 13 | 13.00 | RPL25 | 12.17 | AGD11 | 12.74 | CYP |
| 14 | 14.00 | AGD11 | 14.00 | RPL25 | 14.00 | RPL25 |
| 15 | 15.00 | UBQ1 | 15.00 | UBQ1 | 15.00 | UBQ1 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tu, Z.; Hao, Z.; Zhong, W.; Li, H. Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg. Forests 2019, 10, 441. https://doi.org/10.3390/f10050441
Tu Z, Hao Z, Zhong W, Li H. Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg. Forests. 2019; 10(5):441. https://doi.org/10.3390/f10050441
Chicago/Turabian StyleTu, Zhonghua, Ziyuan Hao, Weiping Zhong, and Huogen Li. 2019. "Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg" Forests 10, no. 5: 441. https://doi.org/10.3390/f10050441
APA StyleTu, Z., Hao, Z., Zhong, W., & Li, H. (2019). Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg. Forests, 10(5), 441. https://doi.org/10.3390/f10050441

