Variable Expression of Oncogene-Induced Senescence/SASP Surrogates in HPV-Associated Precancerous Cervical Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Tissue Samples
2.2. Sample Processing and RNA and DNA Extraction
2.3. HPV Detection and Genotyping
2.4. Reverse Transcriptase (cDNA) and Real-Time Quantitative PCR
2.5. Immunohistochemistry (IHC) for Lamin B1
2.6. Immunofluorescence (IF) for Lamin B1 and HPV16 + HPV 18
2.7. Statistical Analysis
3. Results
3.1. Examining the Prevalence of HPV Subtypes in Precanerous Cervical Lesions
3.2. Examination of OIS Markers Expression in Cervical Precancerous Lesions
3.3. Expression Variability of SASP Factors in Cervical Precancerous Lesions
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Arbyn, M.; Weiderpass, E.; Bruni, L.; de Sanjosé, S.; Saraiya, M.; Ferlay, J.; Bray, F. Estimates of incidence and mortality of cervical cancer in 2018: A worldwide analysis. Lancet Glob. Health 2020, 8, e191–e203. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Giaquinto, A.N.; Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 2024, 74, 12–49. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.; Ismail, A.; Pappas-Gogos, G.; Boussios, S. HPV and Cervical Cancer: A Review of Epidemiology and Screening Uptake in the UK. Pathogens 2023, 12, 298. [Google Scholar] [CrossRef]
- Lin, S.; Zhang, B.; Lin, Y.; Lin, Y.; Zuo, X. Dysbiosis of Cervical and Vaginal Microbiota Associated with Cervical Intraepithelial Neoplasia. Front. Cell. Infect. Microbiol. 2022, 12, 767693. [Google Scholar] [CrossRef]
- Peng, G.; Dong, H.; Liang, T.; Li, L.; Liu, J. Diagnosis of cervical precancerous lesions based on multimodal feature changes. Comput. Biol. Med. 2021, 130, 104209. [Google Scholar] [CrossRef]
- McCredie, M.R.; Sharples, K.J.; Paul, C.; Baranyai, J.; Medley, G.; Jones, R.W.; Skegg, D.C. Natural history of cervical neoplasia and risk of invasive cancer in women with cervical intraepithelial neoplasia 3: A retrospective cohort study. Lancet Oncol. 2008, 9, 425–434. [Google Scholar] [CrossRef] [PubMed]
- Saslow, D.; Solomon, D.; Lawson, H.W.; Killackey, M.; Kulasingam, S.L.; Cain, J.; Garcia, F.A.R.; Moriarty, A.T.; Waxman, A.G.; Wilbur, D.C.; et al. American Cancer Society, American Society for Colposcopy and Cervical Pathology, and American Society for Clinical Pathology screening guidelines for the prevention and early detection of cervical cancer. CA Cancer J. Clin. 2012, 62, 147–172. [Google Scholar] [CrossRef]
- Scarth, J.A.; Patterson, M.R.; Morgan, E.L.; Macdonald, A. The human papillomavirus oncoproteins: A review of the host pathways targeted on the road to transformation. J. Gen. Virol. 2021, 102, 001540. [Google Scholar] [CrossRef] [PubMed]
- Schrank, T.P.; Kim, S.; Rehmani, H.; Kothari, A.; Wu, D.; Yarbrough, W.G.; Issaeva, N. Direct Comparison of HPV16 Viral Genomic Integration, Copy Loss, and Structural Variants in Oropharyngeal and Uterine Cervical Cancers Reveal Distinct Relationships to E2 Disruption and Somatic Alteration. Cancers 2022, 14, 4488. [Google Scholar] [CrossRef]
- James, C.D.; Fontan, C.T.; Otoa, R.; Das, D.; Prabhakar, A.T.; Wang, X.; Bristol, M.L.; Morgan, I.M. Human Papillomavirus 16 E6 and E7 Synergistically Repress Innate Immune Gene Transcription. mSphere 2020, 5, 10–1128. [Google Scholar] [CrossRef]
- Szymonowicz, K.A.; Chen, J. Biological and clinical aspects of HPV-related cancers. Cancer Biol. Med. 2020, 17, 864–878. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Tian, Y.; Zhang, W.; Liu, R.; Zhang, W. Rab12 Promotes Radioresistance of HPV-Positive Cervical Cancer Cells by Increasing G2/M Arrest. Front. Oncol. 2021, 11, 586771. [Google Scholar] [CrossRef] [PubMed]
- Saleh, T.; Khasawneh, A.I.; Himsawi, N.; Abu-Raideh, J.; Ejeilat, V.; Elshazly, A.M.; Gewirtz, D.A. Senolytic Therapy: A Potential Approach for the Elimination of Oncogene-Induced Senescent HPV-Positive Cells. Int. J. Mol. Sci. 2022, 23, 15512. [Google Scholar] [CrossRef]
- Hanahan, D. Hallmarks of Cancer: New Dimensions. Cancer Discov. 2022, 12, 31–46. [Google Scholar] [CrossRef]
- Kosar, M.; Bartkova, J.; Hubackova, S.; Hodny, Z.; Lukas, J.; Bartek, J. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type-and insult-dependent manner, and follow expression of p16ink4a. Cell Cycle 2011, 10, 457–468. [Google Scholar] [CrossRef]
- Collado, M.; Gil, J.; Efeyan, A.; Guerra, C.; Schuhmacher, A.J.; Barradas, M.; Benguría, A.; Zaballos, A.; Flores, J.M.; Barbacid, M.; et al. Tumour biology: Senescence in premalignant tumours. Nature 2005, 436, 642. [Google Scholar] [CrossRef]
- Zhu, H.; Blake, S.; Kusuma, F.K.; Pearson, R.B.; Kang, J.; Chan, K.T. Oncogene-induced senescence: From biology to therapy. Mech. Ageing Dev. 2020, 187, 111229. [Google Scholar] [CrossRef] [PubMed]
- Hoppe-seyler, K.; Bossler, F.; Braun, J.A.; Herrmann, A.L.; Hoppe-seyler, F. The HPV E6 / E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends Microbiol. 2018, 26, 158–168. [Google Scholar] [CrossRef]
- Saab, R. Senescence and pre-malignancy: How do tumors progress? Semin. Cancer Biol. 2011, 21, 385–391. [Google Scholar] [CrossRef]
- Coppé, J.-P.; Desprez, P.-Y.; Krtolica, A.; Campisi, J. The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 2010, 5, 99–118. [Google Scholar] [CrossRef]
- Kang, T.W.; Yevsa, T.; Woller, N.; Hoenicke, L.; Wuestefeld, T.; Dauch, D.; Hohmeyer, A.; Gereke, M.; Rudalska, R.; Potapova, A.; et al. Senescence surveillance of pre-malignant hepatocytes limits liver cancer development. Nature 2011, 479, 547–551. [Google Scholar] [CrossRef] [PubMed]
- Buhl, J.L.; Selt, F.; Hielscher, T.; Guiho, R.; Ecker, J.; Sahm, F.; Ridinger, J.; Riehl, D.; Usta, D.; Ismer, B.; et al. The Senescence-associated Secretory Phenotype Mediates Oncogene-induced Senescence in Pediatric Pilocytic Astrocytoma. Clin. Cancer Res. 2019, 25, 1851–1866. [Google Scholar] [CrossRef] [PubMed]
- Saleh, T.; Tyutynuk-Massey, L.; Cudjoe, E.K.; Idowu, M.O.; Landry, J.W.; Gewirtz, D.A. Non-Cell Autonomous Effects of the Senescence-Associated Secretory Phenotype in Cancer Therapy. Front. Oncol. 2018, 8, 164. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Segura, A.; de Jong, T.V.; Melov, S.; Guryev, V.; Campisi, J.; Demaria, M. Unmasking Transcriptional Heterogeneity in Senescent Cells. Curr. Biol. 2017, 27, 2652–2660. [Google Scholar] [CrossRef] [PubMed]
- Hoare, M.; Ito, Y.; Kang, T.W.; Weekes, M.P.; Matheson, N.J.; Patten, D.A.; Shetty, S.; Parry, A.J.; Menon, S.; Salama, R.; et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat. Cell Biol. 2016, 18, 979–992. [Google Scholar] [CrossRef]
- Khasawneh, A.I.; Himsawi, N.; Abu-Raideh, J.; Salameh, M.; Abdullah, N.; Khasawneh, R.; Saleh, T. Prevalence of Human Papillomavirus Associated with Head and Neck Squamous Cell Carcinoma in Jordanian Patients. Open Microbiol. J. 2020, 14, 57–64. [Google Scholar] [CrossRef]
- Khasawneh, A.I.; Himsawi, N.; Sammour, A.; Al Shboul, S.; Alorjani, M.; Al-Momani, H.H.; Shahin, U.; Al-Momani, H.H.; Alotaibi, M.R.; Saleh, T. Association of Human Papilloma Virus, Cytomegalovirus, and Epstein–Barr Virus with Breast Cancer in Jordanian Women. Medicina 2024, 60, 699. [Google Scholar] [CrossRef]
- Regier, N.; Frey, B. Experimental comparison of relative RT-qPCR quantification approaches for gene expression studies in poplar. BMC Mol. Biol. 2010, 11, 57. [Google Scholar] [CrossRef]
- Liu, W.; Lu, X.; He, G.; Gao, X.; Li, M.; Wu, J.; Li, Z.; Wu, J.; Wang, J.; Luo, C. Cytosolic protection against ultraviolet induced DNA damage by blueberry anthocyanins and anthocyanidins in hepatocarcinoma HepG2 cells. Biotechnol. Lett. 2013, 35, 491–498. [Google Scholar] [CrossRef]
- Park, S.S.; Lee, Y.K.; Park, S.H.; Lim, S.B.; Choi, Y.W.; Shin, J.S.; Kim, Y.H.; Kim, J.H.; Park, T.J. p15INK4B is an alternative marker of senescent tumor cells in colorectal cancer. Heliyon 2023, 9, e13170. [Google Scholar] [CrossRef]
- González-Gualda, E.; Baker, A.G.; Fruk, L.; Muñoz-Espín, D.; González-Gualda, E.; Baker, A.G.; Fruk, L.; Muñoz-Espín, D. A Guide to Assessing Cellular Senescence In Vitro and In Vivo. FEBS J. 2021, 288, 56–80. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Lan, F.; Wang, X.; Yu, Y.; Ouyang, X.; Zheng, F.; Han, J.; Lin, Y.; Xie, Y.; Xie, F.; et al. IL-1β-induced activation of p38 promotes metastasis in gastric adenocarcinoma via upregulation of AP-1/c-fos, MMP2 and MMP9. Mol. Cancer 2014, 13, 18. [Google Scholar] [CrossRef] [PubMed]
- Del Rey, M.J.; Valín, Á.; Usategui, A.; Ergueta, S.; Martín, E.; Municio, C.; Cañete, J.D.; Blanco, F.J.; Criado, G.; Pablos, J.L. Senescent synovial fibroblasts accumulate prematurely in rheumatoid arthritis tissues and display an enhanced inflammatory phenotype. Immun. Ageing 2019, 16, 29. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Zhao, K.N.; Masci, P.P.; Lakhani, S.R.; Antonsson, A.; Simpson, P.T.; Vitetta, L. TGFβ isoforms and receptors mRNA expression in breast tumours: Prognostic value and clinical implications. BMC Cancer 2015, 15, 1010. [Google Scholar] [CrossRef]
- Saleh, T.; Alhesa, A.; Al-Balas, M.; Abuelaish, O.; Mansour, A.; Awad, H.; El-Sadoni, M.; Carpenter, V.J.; Azab, B. Expression of therapy-induced senescence markers in breast cancer samples upon incomplete response to neoadjuvant chemotherapy. Biosci. Rep. 2021, 41, BSR20210079. [Google Scholar] [CrossRef]
- El-Sadoni, M.; Al Shboul, S.; Alhesa, A.; Shahin, N.A.; Alsharaiah, E.; Ismail, M.A.; Ababneh, N.A.; Alotaibi, M.R.; Azab, B.; Saleh, T. A three-marker signature identifies senescence in human breast cancer exposed to neoadjuvant chemotherapy. Cancer Chemother. Pharmacol. 2023, 91, 345–360. [Google Scholar] [CrossRef] [PubMed]
- Al Shboul, S.; Boyle, S.; Singh, A.; Saleh, T.; Alrjoub, M.; Abu Al Karsaneh, O.; Mryyian, A.; Dawoud, R.; Gul, S.; Abu Baker, S.; et al. FISH analysis reveals CDKN2A and IFNA14 co-deletion is heterogeneous and is a prominent feature of glioblastoma. Brain Tumor Pathol. 2024, 41, 4–17. [Google Scholar] [CrossRef]
- Freund, A.; Laberge, R.-M.R.M.; Demaria, M.; Campisi, J. Lamin B1 loss is a senescence-associated biomarker. Mol. Biol. Cell 2012, 23, 2066–2075. [Google Scholar] [CrossRef]
- Shah, P.P.; Donahue, G.; Otte, G.L.; Capell, B.C.; Nelson, D.M.; Cao, K.; Aggarwala, V.; Cruickshanks, H.A.; Rai, T.S.; McBryan, T.; et al. Lamin B1 depletion in senescent cells triggers large-scale changes in gene expression and the chromatin landscape. Genes Dev. 2013, 27, 1787–1799. [Google Scholar] [CrossRef]
- Saleh, T.; Alhesa, A.; El-Sadoni, M.; Shahin, N.A.; Alsharaiah, E.; Al Shboul, S.; Awad, H.; Bloukh, S.; Al-Balas, M.; Alsalem, M.; et al. The Expression of the Senescence-Associated Biomarker Lamin B1 in Human Breast Cancer. Diagnostics 2022, 12, 609. [Google Scholar] [CrossRef]
- Galluzzi, L.; Bravo-San Pedro, J.M.; Kroemer, G. Autophagy Mediates Tumor Suppression via Cellular Senescence. Trends Cell Biol. 2016, 26, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Al Shboul, S.; El-Sadoni, M.; Alhesa, A.; Shahin, N.A.; Abuquteish, D.; Abu, O.; Karsaneh, A.; Alsharaiah, E.; Ismail, M.A.; Massey, L.T.; et al. NOXA expression is downregulated in human breast cancer undergoing incomplete pathological response and senescence after neoadjuvant chemotherapy. Sci. Rep. 2023, 13, 15903. [Google Scholar] [CrossRef]
- Ogrodnik, M.; Carlos Acosta, J.; Adams, P.D.; d’Adda di Fagagna, F.; Baker, D.J.; Bishop, C.L.; Chandra, T.; Collado, M.; Gil, J.; Gorgoulis, V.; et al. Guidelines for minimal information on cellular senescence experimentation in vivo. Cell 2024, 187, 4150–4175. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.Y.; Souroullas, G.P.; Diekman, B.O.; Krishnamurthy, J.; Hall, B.M.; Sorrentino, J.A.; Parker, J.S.; Sessions, G.A.; Gudkov, A.V.; Sharpless, N.E. Cells exhibiting strong p16INK4a promoter activation in vivo display features of senescence. Proc. Natl. Acad. Sci. USA 2019, 116, 2603–2611. [Google Scholar] [CrossRef]
- Sharpless, N.E.; Sherr, C.J. Forging a signature of in vivo senescence. Nat. Rev. Cancer 2015, 15, 397–408. [Google Scholar] [CrossRef] [PubMed]
- Michaloglou, C.; Vredeveld, L.C.W.; Soengas, M.S.; Denoyelle, C.; Kuilman, T.; Van Der Horst, C.M.A.M.; Majoor, D.M.; Shay, J.W.; Mooi, W.J.; Peeper, D.S. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 2005, 436, 720–724. [Google Scholar] [CrossRef]
- Bartkova, J.; Hořejší, Z.; Koed, K.; Krämer, A.; Tort, F.; Zleger, K.; Guldberg, P.; Sehested, M.; Nesland, J.M.; Lukas, C.; et al. DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis. Nature 2005, 434, 864–870. [Google Scholar] [CrossRef]
- Ye, Y.; Jones, T.; Wang, T.; Zeng, X.; Liu, Y.; Zhao, C. Comprehensive overview of genotype distribution and prevalence of human papillomavirus in cervical lesions. Gynecol. Obstet. Clin. Med. 2024, 4, e000005. [Google Scholar] [CrossRef]
- Zhong, F.; Li, Z.; Sun, Y.; Xiao, Y.; Li, J.; Zhou, X.; Cong, Q.; Sui, L.; Tao, X.; Zhao, C. HPV genotyping of cervical histologic specimens of 61,422 patients from the largest women hospital in China. Front. Oncol. 2023, 13, 1161631. [Google Scholar] [CrossRef]
- Tang, X.; Jones, T.E.; Jiang, W.; Austin, M.; He, Y.; Li, L.; Tong, L.; Wang, C.; Yang, K.; Yin, R.; et al. Extended human papillomavirus genotype distribution in cervical intraepithelial neoplasia and cancer: Analysis of 40,352 cases from a large academic gynecologic center in China. J. Med. Virol. 2023, 95, e28302. [Google Scholar] [CrossRef]
- Shoja, Z.; Farahmand, M.; Hosseini, N.; Jalilvand, S. A Meta-Analysis on Human Papillomavirus Type Distribution among Women with Cervical Neoplasia in the WHO Eastern Mediterranean Region. Intervirology 2019, 62, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Obeidat, B.; Matalka, I.; Mohtaseb, A.; Jaradat, S.; Hayajneh, W.; Khasawneh, R.; Haddad, H.; Obeidat, F. Prevalence and distribution of high-risk human papillomavirus genotypes in cervical carcinoma, low-grade, and high-grade squamous intraepithelial lesions in Jordanian women. Eur. J. Gynecol. Oncol. 2013, 34, 257–260. [Google Scholar]
- Spinillo, A.; Gardella, B.; Roccio, M.; Alberizzi, P.; Cesari, S.; Patrizia, M.; Silini, E. Multiple human papillomavirus infection with or without type 16 and risk of cervical intraepithelial neoplasia among women with cervical cytological abnormalities. Cancer Causes Control 2014, 25, 1669–1676. [Google Scholar] [CrossRef] [PubMed]
- Anderson, L.A.; O’Rorke, M.A.; Wilson, R.; Jamison, J.; Gavin, A.T. HPV prevalence and type-distribution in cervical cancer and premalignant lesions of the cervix: A population-based study from Northern Ireland. J. Med. Virol. 2016, 88, 1262–1270. [Google Scholar] [CrossRef]
- Chen, G.; Zheng, P.; Gao, L.; Zhao, J.; Wang, Y.; Qin, W. Prevalence and genotype distribution of human papillomavirus in women with cervical cancer or cervical intraepithelial neoplasia in Henan province, central China. J. Med. Virol. 2020, 92, 3743–3749. [Google Scholar] [CrossRef]
- Correa, R.M.; Baena, A.; Valls, J.; Colucci, M.C.; Mendoza, L.; Rol, M.; Wiesner, C.; Ferrera, A.; Fellner, M.D.; González, J.V.; et al. Distribution of human papillomavirus genotypes by severity of cervical lesions in HPV screened positive women from the ESTAMPA study in Latin America. PLoS ONE 2022, 17, e0272205. [Google Scholar] [CrossRef]
- Mejía, L.; Muñoz, D.; Trueba, G.; Tinoco, L.; Zapata, S. Prevalence of human papillomavirus types in cervical cancerous and precancerous lesions of Ecuadorian women. J. Med. Virol. 2016, 88, 144–152. [Google Scholar] [CrossRef]
- Dikovskaya, D.; Cole, J.J.; Mason, S.M.; Nixon, C.; Karim, S.A.; McGarry, L.; Clark, W.; Hewitt, R.N.; Sammons, M.A.; Zhu, J.; et al. Mitotic Stress Is an Integral Part of the Oncogene-Induced Senescence Program that Promotes Multinucleation and Cell Cycle Arrest. Cell Rep. 2015, 12, 1483–1496. [Google Scholar] [CrossRef]
- Serrano, M.; Lin, A.W.; McCurrach, M.E.; Beach, D.; Lowe, S.W. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 1997, 88, 593–602. [Google Scholar] [CrossRef]
- Courtois-Cox, S.; Jones, S.L.; Cichowski, K. Many roads lead to oncogene-induced senescence. Oncogene 2008. [Google Scholar] [CrossRef]
- Baz-Martínez, M.; Da Silva-Álvarez, S.; Rodríguez, E.; Guerra, J.; El Motiam, A.; Vidal, A.; Garciá-Caballero, T.; González-Barcia, M.; Sánchez, L.; Munõz-Fontela, C.; et al. Cell senescence is an antiviral defense mechanism. Sci. Rep. 2016, 6, 37007. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.; Ji, S. Cellular senescence: Molecular mechanisms and pathogenicity. J. Cell. Physiol. 2018, 233. [Google Scholar] [CrossRef]
- Wells, S.I. Papillomavirus E2 induces senescence in HPV-positive cells via pRB- and p21CIP-dependent pathways. EMBO J. 2000, 19, 5762–5771. [Google Scholar] [CrossRef]
- Evangelisti, C.; Rusciano, I.; Mongiorgi, S.; Ramazzotti, G.; Lattanzi, G.; Manzoli, L.; Cocco, L.; Ratti, S. The wide and growing range of lamin B-related diseases: From laminopathies to cancer. Cell. Mol. Life Sci. 2022, 79, 126. [Google Scholar] [CrossRef]
- Li, L.; Du, Y.; Kong, X.; Li, Z.; Jia, Z.; Cui, J.; Gao, J.; Wang, G.; Xie, K. Lamin B1 is a novel therapeutic target of betulinic acid in pancreatic cancer. Clin. Cancer Res. 2013, 19, 4651–4661. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Xu, M.Z.; Poon, R.T.; Day, P.J.; Luk, J.M. Circulating Lamin B1 (LMNB1) biomarker detects early stages of liver cancer in patients. J. Proteome Res. 2010, 9, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; Vong, J.S.-L.; Asafova, A.; Garvalov, B.K.; Caputo, L.; Cordero, J.; Singh, A.; Boettger, T.; Günther, S.; Fink, L.; et al. Lamin B1 loss promotes lung cancer development and metastasis by epigenetic derepression of RET. J. Exp. Med. 2019, 216, 1377–1395. [Google Scholar] [CrossRef] [PubMed]
- Wazir, U.; Ahmad, M.; Bridger, J.; Harvey, A.; Jiang, W.; Sharma, A.; Mokbel, K. Abstract P6-04-14: mRNA expressions of lamin B1 and lamin B receptor: Clinical correlations with human breast cancer. Cancer Res. 2013, 73 (Suppl. S24), P6–04–14. [Google Scholar] [CrossRef]
- Zhang, Y.; Guo, L.; Xing, P.; Chen, Y.; Li, F.; Zhu, W.; Lu, X. Increased expression of oncogene-induced senescence markers during cervical squamous cell cancer development. Int. J. Clin. Exp. Pathol. 2014, 7, 8911. [Google Scholar]
- Feng, W.; Xiao, J.; Zhang, Z.; Rosen, D.G.; Brown, R.E.; Liu, J.; Duan, X. Senescence and apoptosis in carcinogenesis of cervical squamous carcinoma. Mod. Pathol. 2007, 20, 961–966. [Google Scholar] [CrossRef]
- Zhang, Z.; Rosen, D.G.; Yao, J.L.; Huang, J.; Liu, J. Expression of p14ARF, p15INK4b, p16INK4a, and DCR2 increases during prostate cancer progression. Mod. Pathol. 2006, 19, 1339–1343. [Google Scholar] [CrossRef] [PubMed]
- Holm, R.; Førsund, M.; Nguyen, M.T.; Nesland, J.M.; Trope, C.G. Expression of p15INK4b and p57KIP2 and relationship with clinicopathological features and prognosis in patients with vulvar squamous cell carcinoma. PLoS ONE 2013, 8, e61273. [Google Scholar] [CrossRef] [PubMed]
- Dimri, G.P.; Lee, X.; Basile, G.; Acosta, M.; Scott, G.; Roskelley, C.; Medrano, E.E.; Linskensi, M.; Rubelj, I.; Pereira-Smith, O.; et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 1995, 92, 9363–9367. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.Y.; Han, J.A.; Im, J.S.; Morrone, A.; Johung, K.; Goodwin, E.C.; Kleijer, W.J.; DiMaio, D.; Hwang, E.S. Senescence-associated β-galactosidase is lysosomal β-galactosidase. Aging Cell 2006, 5, 187–195. [Google Scholar] [CrossRef]
- Kurz, D.J.D.J.; Decary, S.; Hong, Y.; Erusalimsky, J.D.J.D. Senescence-associated (beta)-galactosidase reflects an increase in lysosomal mass during replicative ageing of human endothelial cells. J. Cell Sci. 2000, 113, 3613–3622. [Google Scholar] [CrossRef]
- Hall, B.M.; Balan, V.; Gleiberman, A.S.; Strom, E.; Krasnov, P.; Virtuoso, L.P.; Rydkina, E.; Vujcic, S.; Balan, K.; Gitlin, I.I.; et al. p16(Ink4a) and senescence-associated β-galactosidase can be induced in macrophages as part of a reversible response to physiological stimuli. Aging 2017, 9, 1867–1884. [Google Scholar] [CrossRef] [PubMed]
- Matacchione, G.; Perugini, J.; Di Mercurio, E.; Sabbatinelli, J.; Prattichizzo, F.; Senzacqua, M.; Storci, G.; Dani, C.; Lezoche, G.; Guerrieri, M.; et al. Senescent macrophages in the human adipose tissue as a source of inflammaging. GeroScience 2022, 44, 1941–1960. [Google Scholar] [CrossRef]
- Kopp, H.G.; Hooper, A.T.; Shmelkov, S.V.; Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol. Histopathol. 2007, 22, 971–976. [Google Scholar] [CrossRef]
- Silva, D.C.; Gonçalves, A.K.; Cobucci, R.N.; Mendonça, R.C.; Lima, P.H.; Cavalcanti, G. Immunohistochemical expression of p16, Ki-67 and p53 in cervical lesions—A systematic review. Pathol. Res. Pract. 2017, 213, 723–729. [Google Scholar] [CrossRef]
- Wu, J.; Li, X.J.; Zhu, W.; Liu, X.P. Detection and pathological value of papillomavirus DNA and p16INK4A and p53 protein expression in cervical intraepithelial neoplasia. Oncol. Lett. 2014, 7, 738–744. [Google Scholar] [CrossRef][Green Version]
- Saleh, T.; Bloukh, S.; Carpenter, V.J.; Alwohoush, E.; Bakeer, J.; Darwish, S.; Azab, B.; Gewirtz, D.A. Therapy-Induced Senescence: An “Old” Friend Becomes the Enemy. Cancers 2020, 12, 822. [Google Scholar] [CrossRef] [PubMed]
- Takasugi, M.; Yoshida, Y.; Hara, E.; Ohtani, N. The role of cellular senescence and SASP in tumour microenvironment. FEBS J. 2023, 290, 1348–1361. [Google Scholar] [CrossRef] [PubMed]
- Takasugi, M.; Yoshida, Y.; Ohtani, N. Cellular senescence and the tumour microenvironment. Mol. Oncol. 2022, 16, 3333–3351. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Liu, M.; Hong, D.; Zeng, M.; Zhang, X. The Paradoxical Role of Cellular Senescence in Cancer. Front. Cell Dev. Biol. 2021, 9, 722205. [Google Scholar] [CrossRef] [PubMed]
- Faget, D.V.; Ren, Q.; Stewart, S.A. Unmasking senescence: Context-dependent effects of SASP in cancer. Nat. Rev. Cancer 2019, 19, 439–453. [Google Scholar] [CrossRef]
- Mendonça, F.; Teles, A.M.; Do Desterro Soares Brandão Nascimento, M.; Dos Santos, A.P.A.; Lopes, F.F.; Paiva, A.; Brito, H.O.; da Costa, R.G. Human papillomavirus modulates matrix metalloproteinases during carcinogenesis: Clinical significance and role of viral oncoproteins. In Vivo 2022, 36, 2531–2541. [Google Scholar] [CrossRef]
- Vieira, G.V.; Dos Santos, F.S.; Lepique, A.P.; da Fonseca, C.K.; Innocentini, L.M.A.R.; Braz-Silva, P.H.; Quintana, S.M.; Sales, K.U. Proteases and HPV-Induced Carcinogenesis. Cancers 2022, 14, 3038. [Google Scholar] [CrossRef]
- Matheus, E.R.; Zonta, M.A.; Discacciati, M.G.; Paruci, P.; Velame, F.; Cardeal, L.B.S.; Barros, S.B.M.; Pignatari, A.C.; Maria-Engler, S.S. MMP-9 expression increases according to the grade of squamous intraepithelial lesion in cervical smears. Diagn. Cytopathol. 2014, 42, 827–833. [Google Scholar] [CrossRef]
- Padežnik, T.; Oleksy, A.; Cokan, A.; Takač, I.; Sobočan, M. Changes in the extracellular matrix in endometrial and cervical cancer: A systematic review. Int. J. Mol. Sci. 2023, 24, 5463. [Google Scholar] [CrossRef]
- Carrero, Y.N.; Callejas, D.E.; Mosquera, J.A. In situ immunopathological events in human cervical intraepithelial neoplasia and cervical cancer: Review. Transl. Oncol. 2021, 14, 101058. [Google Scholar] [CrossRef]
- Mhatre, M.; McAndrew, T.; Carpenter, C.; Burk, R.D.; Einstein, M.H.; Herold, B.C. Cervical intraepithelial neoplasia is associated with genital tract mucosal inflammation. Sex. Transm. Dis. 2012, 39, 591–597. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Lin, Y.; Ye, X.; Feng, C.; Lu, Y.; Yang, G.; Dong, C. Expression of IL-1α and IL-6 is Associated with Progression and Prognosis of Human Cervical Cancer. Med. Sci. Monit. 2016, 22, 4475–4481. [Google Scholar] [CrossRef] [PubMed]
- Matamoros, J.A.; da Silva, M.I.F.; de Moura, P.M.M.F.; Leitão, M.d.C.G.; Coimbra, E.C. Reduced Expression of IL-1β and IL-18 Proinflammatory Interleukins Increases the Risk of Developing Cervical Cancer. Asian Pac. J. Cancer Prev. 2019, 20, 2715–2721. [Google Scholar] [CrossRef]
- Garrido, F.; Wild, C.M.; Mittelberger, J.; Dobler, F.; Schneider, M.; Ansorge, N.; Köpke, M.; Strieder, A.; Ditsch, N.; Jeschke, U.; et al. The role of chemokines in cervical cancers. Medicina 2021, 57, 1141. [Google Scholar] [CrossRef]
- Zijlmaans, H.J.M.A.A.; Fleuren, G.J.; Baelde, H.J.; Eilers, P.H.C.; Kenter, G.G.; Gorter, A. The absence of CCL2 expression in cervical carcinoma is associated with increased survival and loss of heterozygosity at 17q11.2. J. Pathol. 2006, 208, 507–517. [Google Scholar] [CrossRef]
- Ling, Z.; Yang, X.; Chen, X.; Xia, J.; Cheng, B.; Tao, X. CCL2 promotes cell migration by inducing epithelial-mesenchymal transition in oral squamous cell carcinoma. J. Oral Pathol. Med. 2019, 48, 477–482. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Avila, L.; Castro-Amaya, A.M.; Molina-Pineda, A.; Hernández-Gutiérrez, R.; Jave-Suarez, L.F.; Aguilar-Lemarroy, A. The Value of CXCL1, CXCL2, CXCL3, and CXCL8 as Potential Prognosis Markers in Cervical Cancer: Evidence of E6/E7 from HPV16 and 18 in Chemokines Regulation. Biomedicines 2023, 11, 2655. [Google Scholar] [CrossRef]
- Tchkonia, T.; Zhu, Y.; Van Deursen, J.; Campisi, J.; Kirkland, J.L. Cellular senescence and the senescent secretory phenotype: Therapeutic opportunities. J. Clin. Investig. 2013, 123, 966–972. [Google Scholar] [CrossRef]
- Davalos, A.R.; Coppe, J.P.; Campisi, J.; Desprez, P.Y. Senescent cells as a source of inflammatory factors for tumor progression. Cancer Metastasis Rev. 2010, 29, 273–283. [Google Scholar] [CrossRef]
- Wang, B.; Han, J.; Elisseeff, J.H.; Demaria, M. The senescence-associated secretory phenotype and its physiological and pathological implications. Nat. Rev. Mol. Cell Biol. 2024, 25, 958–978. [Google Scholar] [CrossRef]
- Rodier, F.; Campisi, J. Four faces of cellular senescence. J. Cell Biol. 2011, 192, 547–556. [Google Scholar] [CrossRef] [PubMed]
- Patel, N.H.; Bloukh, S.; Alwohosh, E.; Alhesa, A.; Saleh, T.; Gewirtz, D.A. Autophagy and senescence in cancer therapy. Adv. Cancer Res. 2021, 150, 1–74. [Google Scholar] [CrossRef] [PubMed]
- Mattoscio, D.; Medda, A.; Chiocca, S. Human Papilloma Virus and Autophagy. Int. J. Mol. Sci. 2018, 19, 1775. [Google Scholar] [CrossRef] [PubMed]
- Vescovo, T.; Pagni, B.; Piacentini, M.; Fimia, G.M.; Antonioli, M. Regulation of Autophagy in Cells Infected with Oncogenic Human Viruses and Its Impact on Cancer Development. Front. Cell Dev. Biol. 2020, 8, 47. [Google Scholar] [CrossRef]
- Hanning, J.E.; Saini, H.K.; Murray, M.J.; Caffarel, M.M.; Van Dongen, S.; Ward, D.; Barker, E.M.; Scarpini, C.G.; Groves, I.J.; Stanley, M.A.; et al. Depletion of HPV16 early genes induces autophagy and senescence in a cervical carcinogenesis model, regardless of viral physical state. J. Pathol. 2013, 231, 354–366. [Google Scholar] [CrossRef]
- Natarajan, E.; Saeb, M.; Crum, C.P.; Woo, S.B.; McKee, P.H.; Rheinwald, J.G. Co-expression of p16INK4A and laminin 5 γ2 by microinvasive and superficial squamous cell carcinomas in vivo and by migrating wound and senescent keratinocytes in culture. Am. J. Pathol. 2003, 163, 477–491. [Google Scholar] [CrossRef]
- Saleh, T.; Bloukh, S.; Hasan, M.; Al Shboul, S. Therapy-induced senescence as a component of tumor biology: Evidence from clinical cancer. Biochim. Biophys. Acta (BBA) Rev. Cancer 2023, 1878, 188994. [Google Scholar] [CrossRef]
Gene | Forward | Reverse | Ref |
---|---|---|---|
CDKN1A | GAGGCCGGGATGAGTTGGGAGGAG | CAGCCGGCGTTTGGAGTGGTAGAA | [29] |
CDKN2A | GGGTCGGGTAGAGGAGGTG | CATCATGACCTGGATCGGC | [30] |
CDKN2B | GACCGGGAATAACCTTCCAT | CACCAGGTCCAGTCAAGGAT | [30] |
LMNB1 | GTATGAAGAGGAGATTAACGAGAC | TACTCAATTTGACGCCCAG | [31] |
MMP9 | CAGTCCACCCTTGTGCTCTTC | TGCCACCCGAGTGTAACCAT | [32] |
IL1A | AGAGGAAGAAATCATCAAGC | TTATACTTTGATTGAGGGCG | [31] |
CCL2 | GATCTCAGTGCAGAGGCTCG | TGCTTGTCCAGGTGGTCCAT | [31] |
CXCL8 | AAGAGCCAGGAAGAAACCACC | CTGCAGAAATCAGGAAGGCTG | [33] |
TGFB1 | TCGCCAGAGTGGTTATCTT | TAGTGAACCCGTTGATGTCC | [34] |
GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC | [31] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saleh, T.; Himsawi, N.; Al Rousan, A.; Alhesa, A.; El-Sadoni, M.; Khawaldeh, S.; Shahin, N.A.; Ghalioun, A.A.; Shawish, B.; Friehat, K.; et al. Variable Expression of Oncogene-Induced Senescence/SASP Surrogates in HPV-Associated Precancerous Cervical Tissue. Curr. Issues Mol. Biol. 2024, 46, 13696-13712. https://doi.org/10.3390/cimb46120818
Saleh T, Himsawi N, Al Rousan A, Alhesa A, El-Sadoni M, Khawaldeh S, Shahin NA, Ghalioun AA, Shawish B, Friehat K, et al. Variable Expression of Oncogene-Induced Senescence/SASP Surrogates in HPV-Associated Precancerous Cervical Tissue. Current Issues in Molecular Biology. 2024; 46(12):13696-13712. https://doi.org/10.3390/cimb46120818
Chicago/Turabian StyleSaleh, Tareq, Nisreen Himsawi, Amani Al Rousan, Ahmad Alhesa, Mohammed El-Sadoni, Suzan Khawaldeh, Nisreen Abu Shahin, Ala’ Abu Ghalioun, Bayan Shawish, Kholoud Friehat, and et al. 2024. "Variable Expression of Oncogene-Induced Senescence/SASP Surrogates in HPV-Associated Precancerous Cervical Tissue" Current Issues in Molecular Biology 46, no. 12: 13696-13712. https://doi.org/10.3390/cimb46120818
APA StyleSaleh, T., Himsawi, N., Al Rousan, A., Alhesa, A., El-Sadoni, M., Khawaldeh, S., Shahin, N. A., Ghalioun, A. A., Shawish, B., Friehat, K., Alotaibi, M. R., Abu Al Karsaneh, O., Abu-Humaidan, A., Khasawneh, R., Khasawneh, A. I., & Al Shboul, S. (2024). Variable Expression of Oncogene-Induced Senescence/SASP Surrogates in HPV-Associated Precancerous Cervical Tissue. Current Issues in Molecular Biology, 46(12), 13696-13712. https://doi.org/10.3390/cimb46120818