Optical Thickness-Encoded Suspension Array for High-Throughput Multiplexed Gene Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Characterization
2.3. Preparation of Quantum Dot-Labeled Signal Probes
2.4. Encoding and Decoding of SAs
2.5. Specificity and Gradient Detection
2.6. Multiplexed Detection
2.7. Optical Decoding System
3. Results and Discussion
3.1. Characterization of Encoded SA
3.2. Specificity and Concentration Response of Optical Thickness-Encoded SA in DNA Detection
3.3. Application of Optical Thickness-Encoded SA in Multiplexed DNA Detection
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Milde-Langosch, K.; Riethdorf, S.; Löning, T. Association of human Papillomavirus infection with carcinoma of the cervix uteri and its Precursor lesions:Theoretical and Practical implications. Virchows Arch. 2000, 437, 227–233. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Zhu, J.J.; Wang, Q.; Xie, L.X.; Lu, M.; Wang, J.L.; Wang, C.F.; Zhong, T.Y.; Zheng, L.; Pan, M.C.; et al. Development and evaluation of a reverse dot blot assay for the simultaneous detection of common alpha and beta thalassemia in Chinese. Blood Cells Mol Dis. 2012, 48, 86–90. [Google Scholar] [CrossRef] [PubMed]
- Fan, F.; Stiles, J.; Mikhlina, A.; Lu, X.; Babady, N.E.; Tang, Y.W. Clinical validation of the lyra direct HSV 1+2/VZV assay for simultaneous detection and differentiation of three herpesviruses in Cutaneous and Mucocutaneous Lesions. Clin. Microbiol. 2014, 52, 3799–3801. [Google Scholar] [CrossRef] [PubMed]
- Altinok, I. Multiplex PCR assay for detection of four major bacterial pathogens causing rainbow trout disease. Dis Aquat Organ. 2011, 93, 199. [Google Scholar] [CrossRef]
- Pillet, S.; Verhoeven, P.O.; Epercieux, A.; Bourlet, T.; Pozzetto, B. Development and validation of a laboratory-developed multiplex real-time PCR assay on the BD max system for detection of herpes simplex virus and varicella-zoster virus DNA in various clinical specimens. Clin Microbiol. 2015, 53, 1921–1926. [Google Scholar] [CrossRef]
- Houser, B. Bio-Rad’s Bio-Plex® suspension array system, xMAP technology overview. Arch. Physiol. Biochem. 2012, 118, 192–196. [Google Scholar] [CrossRef]
- Sammons, D.L.; MacKenzie, B.A.; Semenova, V.; Snawder, J.E.; Quinn, C.P.; Biagini, R.E.; Stamey, K.; Smith, J.P.; Striley, C.A.; Steward Clark, E.; et al. Comparison of a multiplexed fluorescent covalent microsphere immunoassay and an enzyme-linked immunosorbent assay for measurement of human immunoglobulin G antibodies to anthrax toxins. Clin Diagn. Lab. Immunol. 2004, 11, 50–55. [Google Scholar]
- Smith, P.L.; WalkerPeach, C.R.; Fulton, R.J.; DuBois, D.B. A rapid, sensitive, multiplexed assay for detection of viral nucleic acids using the Flow Metrix system. Clin. Chem. 1998, 44, 2054–2056. [Google Scholar]
- Suzuki, W.; Osaka, T.; Sekizawa, A.; Kitagawa, M.; Honma, I. Development of a fibrous DNA chip for cost-effective β-thalassemia genotyping. Int. J. Hematol. 2012, 96, 301–307. [Google Scholar] [CrossRef]
- Ye, F.; Li, M.S.; Taylor, J.D.; Nguyen, Q.; Colton, H.M.; Casey, W.M.; Wagner, M.; Weiner, M.P.; Chen, J.W. Fluorescent microsphere-based readout technology for multiplexed human single nucleotide polymorphism analysis and bacterial identification. Hum. Mutat. 2001, 17, 305–316. [Google Scholar] [CrossRef]
- Fulton, R.J.; McDade, R.L.; Smith, P.L.; Kienker, L.J.; Kettman, J.R. Advanced multiplexed analysis with the FlowMetrix system. Clin.Chem. 1997, 43, 1749–1756. [Google Scholar] [PubMed]
- Buranda, T.; Lopez, G.P.; Simons, P.; Pastuszyn, A.; Sklar, L.A. Detection of epitope-tagged proteins in flow cytometry: Fluorescence resonance energy transfer-based assays on beads with femtomole resolution. Anal. Biochem. 2001, 298, 151–162. [Google Scholar] [CrossRef] [PubMed]
- Swartzman, E.E.; Miraglia, S.J.; Mellentin-Michelotti, J.; Evangelista, L.; Yuan, P.M. A homogeneous and multiplexed immunoassay for high-throughput screening using fluorometric microvolume assay technology. Anal. Biochem. 1999, 271, 143–151. [Google Scholar] [CrossRef]
- Bellisario, R.; Colinas, R.J.; Pass, K.A. Simultaneous measurement of thyroxine and thyrotropin from newborn dried blood-spot specimens using a multiplexed fluorescent microsphere immunoassay. Clin Chem. 2000, 46, 1422–1424. [Google Scholar]
- Tárnok, A.; Hambsch, J.; Chen, R.; Varro, R. Cytometric bead array to measure six cytokines in twenty-five microliters of serum. Clin.Chem. 2003, 49, 1000–1002. [Google Scholar] [CrossRef]
- Naciff, J.M.; Richardson, B.D.; Oliver, K.G.; Jump, M.L.; Torontali, S.M.; Juhlin, K.D.; Carr, G.J.; Paine, J.R.; Tiesman, J.P.; Daston, G.P. Design of a Microsphere-Based High-Throughput Gene Expression Assay to Determine Estrogenic Potential. Environ Health Perspect. 2005, 113, 1164–1171. [Google Scholar] [CrossRef][Green Version]
- Prabhakar, U.; Eirikis, E.; Reddy, M.; Silvestro, E.; Spitz, S.; Pendley, C.; Davis, H.M.; Miller, B.E. Validation and comparative analysis of a multiplexed assay for the simultaneous quantitative measurement of Th1/Th2 cytokines in human serum and human peripheral blood mononuclear cell culture supernatants. J. Immunol. Methods. 2004, 291, 27–38. [Google Scholar] [CrossRef]
- Feng, G.X.; He, Q.H.; Xie, W.Y.; He, Y.H.; Chen, X.J.; Wang, B.; Lu, B.R.; Guan, T. Dual-spectra encoded suspension array using reversed-phase microemulsion UV curing and electrostatic self-assembling. Rsc.Adv. 2018, 8, 21272–21279. [Google Scholar] [CrossRef]
- Wang, Z.Y.; Zong, S.F.; Li, W.; Wang, C.L.; Xu, S.H.; Chen, H.; Cui, Y.P. SERS-fluorescence joint spectral encoding using organic-metal-QD hybrid nanoparticles with a huge encoding capacity for high-throughput biodetection: Putting theory into practice. Am. Chem. Soc. 2012, 134, 2993–3000. [Google Scholar] [CrossRef]
- Del Mercato, L.L.; Abbasi, A.Z.; Ochs, M.; Parak, W.J. Multiplexed sensing of ions with barcoded polyelectrolyte capsules. ACS Nano. 2011, 5, 9668–9674. [Google Scholar] [CrossRef]
- Leng, Y.K.; Sun, K.; Chen, X.Y.; Li, W.W. Suspension arrays based on nanoparticle-encoded microspheres for high-throughput multiplexed detection. Chem. Soc. Rev. 2015, 44, 5552–5595. [Google Scholar] [CrossRef] [PubMed]
- Laing, S.; Gracie, K.; Faulds, K. Multiplex in vitro detection using SERS. Chem. Soc. Rev. 2016, 45, 1901–1918. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Lorenzo, L.; Fabris, L.; Alvarez-Puebla, R.A. Multiplex optical sensing with surface-enhanced Raman scattering: A critical review. Anal. Chim. Acta. 2012, 745, 10–23. [Google Scholar] [CrossRef] [PubMed]
- Campbell, M.; Sharp, D.N.; Harrison, M.T.; Denning, R.G.; Turberfield, A.G. Fabrication of photonic crystals for the visible spectrum by holographic lithography. Nature 2000, 404, 53–56. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z.Z.; Cao, Y.; Chen, H.H.; Ito, F.; Zhao, Y.H.; Nagai, K.; Zhao, X.W. Colloidal crystal beads as supports for biomolecular screening. Angew. Chem. 2006, 45, 6835–6838. [Google Scholar]
- Lu, B.R.; He, Q.H.; He, Y.H.; Chen, X.J.; Feng, G.X.; Liu, S.Y.; Ji, Y.H. Dual-channel-coded microbeads for multiplexed detection of biomolecules using assembling of quantum dots and element coding Nanoparticles. Anal. Chim. Acta. 2018, 1024, 153–160. [Google Scholar] [CrossRef]
- He, Y.H.; Wang, Y.; Ji, Y.H.; Liu, Y.X.; He, Q.H.; Liu, L. The detection method for small molecules coupled with a molecularly imprinted polymer/quantum dot chip using a home-built optical system. Anal. Bioanal. Chem. 2016, 408, 5261–5268. [Google Scholar]
- He, Q.H.; Liu, Y.X.; He, Y.H.; Zhu, L.; Zhang, Y.L.; Shen, Z.Y. Digital barcodes of suspension array using laser induced breakdown spectroscopy. Sci. Rep. 2016, 6, 36511. [Google Scholar] [CrossRef]
- Shen, Z.Y.; He, Y.H.; Zhang, G.; He, Q.H.; Li, D.M.; Ji, Y.H. Dual-wavelength digital holographic phase and fluorescence microscopy for optical thickness encoded suspension array. Opt. Lett. 2018, 43, 739–742. [Google Scholar] [CrossRef]
Virus/Pathogenic Bacteria | Sequence Name | Base Sequence (5’—3’) |
---|---|---|
HPV | Target sequence 1 | AGATATTTGGAATAACATGACCTGGATGCA |
Capture probe 1 | TTATTCCAAATATCT(A10)-NH2 | |
Signal probe 1 | NH2-(A10)TGCATCCAGGTCATG | |
Staphylococcus aureus (gltS) | Target sequence 2 | ACGTTGCATCGGAAACATTGTGTTCTG |
Capture probe 2 | TTCCGATGCAACGT)-NH2 | |
Signal probe 2 | NH2-CAGAACACAATGT | |
Escherichia coli 0157: H7 (stx2) | Target sequence 3 | TACTCCGGAAGCACATTGCTGAATC |
Capture probe 3 | TGCTTCCGGAGTA-NH2 | |
Signal probe 3 | NH2-GATTCAGCAATG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, H.; Chen, X.; Lu, B.; Ji, Y. Optical Thickness-Encoded Suspension Array for High-Throughput Multiplexed Gene Detection. Sensors 2019, 19, 5425. https://doi.org/10.3390/s19245425
Ma H, Chen X, Lu B, Ji Y. Optical Thickness-Encoded Suspension Array for High-Throughput Multiplexed Gene Detection. Sensors. 2019; 19(24):5425. https://doi.org/10.3390/s19245425
Chicago/Turabian StyleMa, Huiying, Xuejing Chen, Bangrong Lu, and Yanhong Ji. 2019. "Optical Thickness-Encoded Suspension Array for High-Throughput Multiplexed Gene Detection" Sensors 19, no. 24: 5425. https://doi.org/10.3390/s19245425
APA StyleMa, H., Chen, X., Lu, B., & Ji, Y. (2019). Optical Thickness-Encoded Suspension Array for High-Throughput Multiplexed Gene Detection. Sensors, 19(24), 5425. https://doi.org/10.3390/s19245425