Knockdown of BAP31 Downregulates Galectin-3 to Inhibit the Wnt/β-Catenin Signaling Pathway to Modulate 5-FU Chemosensitivity and Cancer Stemness in Colorectal Cancer
Abstract
:1. Introduction
2. Results
2.1. BAP31 Is Increased in CRC Cells and Associated with Chemosensitivity to 5-FU
2.2. BAP31 Is Associated with Stemness of CRC Cells In Vitro
2.3. Knockdown of BAP31 Suppresses Tumorigenesis and Stemness of CRC Cells In Vivo
2.4. Knockdown of BAP31 Downregulates Galectin-3 to Inhibit the Wnt/β-Catenin Signaling Pathway
2.5. BAP31 Regulates Stemness through Wnt/β-Catenin Signaling Pathway
2.6. Knockdown of BAP31 Increases Chemosensitivity to 5-FU by Inhibiting the Wnt/β-Catenin Signaling Pathway
2.7. Intrabodies against BAP31 Enhance Antitumor Effects of 5-FU In Vivo
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Chemicals
4.2. BAP31 sh-RNA Transfection
4.3. MTT and Colony Formation Assays
4.4. Tumor Sphere Formation Assay
4.5. qRT-PCR Assay
4.6. Western Blot Assay
4.7. Immunofluorescence Analysis
4.8. Xenograft Tumors in Nude Mice
4.9. IHC and TUNEL Assays
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dekker, E.; Tanis, P.J.; Vleugels, J.L.A.; Kasi, P.M.; Wallace, M.B. Colorectal cancer. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef]
- Brenner, H.; Kloor, M.; Pox, C.P. Colorectal cancer. Lancet 2014, 383, 1490–1502. [Google Scholar] [CrossRef] [PubMed]
- Salibasic, M.; Pusina, S.; Bicakcic, E.; Pasic, A.; Gavric, I.; Kulovic, E.; Rovcanin, A.; Beslija, S. Colorectal Cancer Surgical Treatment, our Experience. Med. Arch. 2019, 73, 412–414. [Google Scholar] [CrossRef]
- Morris, V.K.; Kennedy, E.B.; Baxter, N.N.; Benson, A.B., 3rd; Cercek, A.; Cho, M.; Ciombor, K.K.; Cremolini, C.; Davis, A.; Deming, D.A.; et al. Treatment of Metastatic Colorectal Cancer: ASCO Guideline. J. Clin. Oncol. 2023, 20, 678–700. [Google Scholar] [CrossRef] [PubMed]
- Vodenkova, S.; Buchler, T.; Cervena, K.; Veskrnova, V.; Vodicka, P.; Vymetalkova, V. 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future. Clin. Pharmacol. Ther. 2020, 206, 107447. [Google Scholar] [CrossRef]
- Saif, M.W. Capecitabine versus continuous-infusion 5-fluorouracil for colorectal cancer: A retrospective efficacy and safety comparison. Clin. Color. Cancer 2005, 5, 89–100. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Goding Sauer, A.; Fedewa, S.A.; Butterly, L.F.; Anderson, J.C.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2020. Ca-Cancer J. Clin. 2020, 70, 145–164. [Google Scholar] [CrossRef]
- Li, Y.; Wang, Z.; Ajani, J.A.; Song, S. Drug resistance and Cancer stem cells. Cell Commun. Signal. 2021, 19, 19. [Google Scholar] [CrossRef]
- Dagogo-Jack, I.; Shaw, A.T. Tumour heterogeneity and resistance to cancer therapies. Nat. Rev. Clin. Oncol. 2018, 15, 81–94. [Google Scholar] [CrossRef]
- Holohan, C.; Van Schaeybroeck, S.; Longley, D.B.; Johnston, P.G. Cancer drug resistance: An evolving paradigm. Nat. Rev. Cancer 2013, 13, 714–726. [Google Scholar] [CrossRef] [PubMed]
- Robey, R.W.; Pluchino, K.M.; Hall, M.D.; Fojo, A.T.; Bates, S.E.; Gottesman, M.M. Revisiting the role of ABC transporters in multidrug-resistant cancer. Nat. Rev. Cancer 2018, 18, 452–464. [Google Scholar] [CrossRef] [PubMed]
- Bukowski, K.; Kciuk, M.; Kontek, R. Mechanisms of Multidrug Resistance in Cancer Chemotherapy. Int. J. Mol. Sci. 2020, 21, 3233. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Tian, X.; Ji, L.; Zhang, X.; Cao, Y.; Shen, C.; Hu, Y.; Wong, J.W.H.; Fang, J.-Y.; Hong, J.; et al. A tumor microenvironment-specific gene expression signature predicts chemotherapy resistance in colorectal cancer patients. NPJ Precis. Oncol. 2021, 5, 7. [Google Scholar] [CrossRef] [PubMed]
- Ramos, E.K.; Hoffmann, A.D.; Gerson, S.L.; Liu, H. New Opportunities and Challenges to Defeat Cancer Stem Cells. Trends Cancer 2017, 3, 780–796. [Google Scholar] [CrossRef]
- Fulda, S. Regulation of apoptosis pathways in cancer stem cells. Cancer Lett. 2013, 338, 168–173. [Google Scholar] [CrossRef]
- Nusse, R.; Clevers, H. Wnt/beta-Catenin Signaling, Disease, and Emerging Therapeutic Modalities. Cell 2017, 169, 985–999. [Google Scholar] [CrossRef]
- Teeuwssen, M.; Fodde, R. Wnt Signaling in Ovarian Cancer Stemness, EMT, and Therapy Resistance. J. Clin. Med. 2019, 8, 1658. [Google Scholar] [CrossRef]
- De Sousa, E.M.F.; Vermeulen, L. Wnt Signaling in Cancer Stem Cell Biology. Cancers 2016, 8, 1658. [Google Scholar] [CrossRef]
- Krishnamurthy, N.; Kurzrock, R. Targeting the Wnt/beta-catenin pathway in cancer: Update on effectors and inhibitors. Cancer Treat. Rev. 2018, 62, 50–60. [Google Scholar] [CrossRef]
- Cheng, X.; Xu, X.; Chen, D.; Zhao, F.; Wang, W. Therapeutic potential of targeting the Wnt/beta-catenin signaling pathway in colorectal cancer. Biomed. Pharmacother. 2019, 110, 473–481. [Google Scholar] [CrossRef]
- Dang, E.; Yang, S.; Song, C.; Jiang, D.; Li, Z.; Fan, W.; Sun, Y.; Tao, L.; Wang, J.; Liu, T.; et al. BAP31, a newly defined cancer/testis antigen, regulates proliferation, migration, and invasion to promote cervical cancer progression. Cell Death Dis. 2018, 9, 791. [Google Scholar] [CrossRef] [PubMed]
- Quistgaard, E.M. BAP31: Physiological functions and roles in disease. Biochimie 2021, 186, 105–129. [Google Scholar] [CrossRef]
- Sun, M.; Liu, X.; Wei, W.; Ge, N.; Luo, S.; Shen, S.; Ge, R. BAP31 Promotes Proliferation, Invasion, and Metastasis of Liver Cancer Cells via Activating PI3K/AKT Pathway. J. Healthc. Eng. 2022, 2022, 7686728. [Google Scholar] [CrossRef]
- Wang, A.; Zhang, Y.; Cao, P. Inhibition of BAP31 expression inhibits cervical cancer progression by suppressing metastasis and inducing intrinsic and extrinsic apoptosis. Biochem. Biophys. Res. Commun. 2019, 508, 499–506. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Jiao, K.; Jia, C.C.; Li, G.X.; Yuan, Q.; Xu, J.K.; Hou, Y.; Wang, B. BAP31 regulates IRAK1-dependent neuroinflammation in microglia. J. Neuroinflamm. 2019, 16, 281. [Google Scholar] [CrossRef] [PubMed]
- Namusamba, M.; Li, Z.; Zhang, Q.; Wang, C.; Wang, T.; Wang, B. Biological roles of the B cell receptor-associated protein 31: Functional Implication in Cancer. Mol. Biol. Rep. 2021, 48, 773–786. [Google Scholar] [CrossRef]
- Nguyen, M.; Breckenridge, D.G.; Ducret, A.; Shore, G.C. Caspase-resistant BAP31 inhibits fas-mediated apoptotic membrane fragmentation and release of cytochrome c from mitochondria. Mol. Cell. Biol. 2020, 20, 6731–6740. [Google Scholar] [CrossRef]
- Liu, T.; Yu, J.; Ge, C.; Zhao, F.; Miao, C.; Jin, W.; Su, Y.; Geng, Q.; Chen, T.; Xie, H.; et al. B-Cell Receptor-Associated Protein 31 Promotes Metastasis via AKT/β-Catenin/Snail Pathway in Hepatocellular Carcinoma. Front. Mol. Biosci. 2021, 8, 656151. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Hao, Z.; Tang, Z.; Li, C.; Cheng, L.; Wang, T.; Zhu, X.; He, Y.; Huang, Y.; Wang, B. BAP31 Regulates Wnt Signaling to Modulate Cell Migration in Lung Cancer. Front. Oncol. 2022, 12, 859195. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Guo, H.; Jiang, H.; Namusamba, M.; Wang, C.; Lan, T.; Wang, T.; Wang, B. A BAP31 intrabody induces gastric cancer cell death by inhibiting p27(kip1) proteasome degradation. Int. J. Cancer 2019, 144, 2051–2062. [Google Scholar] [CrossRef] [PubMed]
- Funasaka, T.; Raz, A.; Nangia-Makker, P. Nuclear transport of galectin-3 and its therapeutic implications. Semin. Cancer Biol. 2014, 27, 30–38. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; Mazurek, N.; Liu, C.; Sun, Y.; Ding, Q.Q.; Liu, K.; Hung, M.C.; Bresalier, R.S. Galectin-3 mediates nuclear beta-catenin accumulation and Wnt signaling in human colon cancer cells by regulation of glycogen synthase kinase-3beta activity. Cancer Res. 2009, 69, 1343–1349. [Google Scholar] [CrossRef] [PubMed]
- Chung, L.; Tang, S.; Wu, Y.; Sun, G.; Liu, H.; Sun, K. Galectin-3 augments tumor initiating property and tumorigenicity of lung cancer through interaction with β-catenin. Oncotarget 2015, 6, 4936–4952. [Google Scholar] [CrossRef]
- Vermeulen, L.; De Sousa, E.M.F.; van der Heijden, M.; Cameron, K.; de Jong, J.H.; Borovski, T.; Tuynman, J.B.; Todaro, M.; Merz, C.; Rodermond, H.; et al. Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat. Cell Biol. 2010, 12, 468–476. [Google Scholar] [CrossRef]
- Kumar, A.; Singh, A.K.; Singh, H.; Thareja, S.; Kumar, P. Regulation of thymidylate synthase: An approach to overcome 5-FU resistance in colorectal cancer. Med. Oncol. 2022, 40, 3. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Shi, P.; Zhao, G.; Xu, J.; Peng, W.; Zhang, J.; Zhang, G.; Wang, X.; Dong, Z.; Chen, F.; et al. Targeting cancer stem cell pathways for cancer therapy. Signal Transduct. Target. Ther. 2020, 5, 8. [Google Scholar] [CrossRef]
- Wang, X.; Chen, Y.; Wang, X.; Tian, H.; Wang, Y.; Jin, J.; Shan, Z.; Liu, Y.; Cai, Z.; Tong, X.; et al. Stem Cell Factor SOX2 Confers Ferroptosis Resistance in Lung Cancer via Upregulation of SLC7A11. Cancer Res. 2021, 81, 5217–5229. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Wang, C.; Li, R.; Liu, J.; Wang, J.; Wang, T.; Wang, B. The BAP31/miR-181a-5p/RECK axis promotes angiogenesis in colorectal cancer via fibroblast activation. Front. Oncol. 2023, 13, 1056903. [Google Scholar] [CrossRef]
- Liang, H.; Dong, J.; Cheng, Z.; Li, Q.; Feng, D.; Ling, B. B-cell receptor-associated protein 31 promotes migration and invasion in ovarian cancer cells. Exp. Ther. Med. 2021, 22, 858. [Google Scholar] [CrossRef]
- Ma, C.; Jin, R.M.; Chen, K.J.; Hao, T.; Li, B.S.; Zhao, D.H.; Jiang, H. Low expression of B-Cell-Associated protein 31 is associated with unfavorable prognosis in human colorectal cancer. Pathol. Res. Pract. 2018, 214, 661–666. [Google Scholar] [CrossRef]
- Xu, K.; Han, B.; Bai, Y.; Ma, X.Y.; Ji, Z.N.; Xiong, Y.; Miao, S.K.; Zhang, Y.Y.; Zhou, L.M. MiR-451a suppressing BAP31 can inhibit proliferation and increase apoptosis through inducing ER stress in colorectal cancer. Cell Death Dis. 2019, 10, 152. [Google Scholar] [CrossRef] [PubMed]
- Xie, P.; Mo, J.L.; Liu, J.H.; Li, X.; Tan, L.M.; Zhang, W.; Zhou, H.H.; Liu, Z.Q. Pharmacogenomics of 5-fluorouracil in colorectal cancer: Review and update. Cell. Oncol. 2020, 43, 989–1001. [Google Scholar] [CrossRef]
- Huang, X.; Ke, K.; Jin, W.; Zhu, Q.; Zhu, Q.; Mei, R.; Zhang, R.; Yu, S.; Shou, L.; Sun, X.; et al. Identification of Genes Related to 5-Fluorouracil Based Chemotherapy for Colorectal Cancer. Front. Immunol. 2022, 13, 887048. [Google Scholar] [CrossRef] [PubMed]
- Miranda, A.; Hamilton, P.T.; Zhang, A.W.; Pattnaik, S.; Becht, E.; Mezheyeuski, A.; Bruun, J.; Micke, P.; de Reynies, A.; Nelson, B.H. Cancer stemness, intratumoral heterogeneity, and immune response across cancers. Proc. Natl. Acad. Sci. USA 2019, 116, 9020–9029. [Google Scholar] [CrossRef]
- Castellon, E.A.; Indo, S.; Contreras, H.R. Cancer Stemness/Epithelial-Mesenchymal Transition Axis Influences Metastasis and Castration Resistance in Prostate Cancer: Potential Therapeutic Target. Int. J. Mol. Sci. 2022, 23, 14917. [Google Scholar] [CrossRef]
- Ren, Z.; Hu, M.; Wang, Z.; Ge, J.; Zhou, X.; Zhang, G.; Zheng, H. Ferroptosis-Related Genes in Lung Adenocarcinoma: Prognostic Signature and Immune, Drug Resistance, Mutation Analysis. Front. Genet. 2021, 12, 672904. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.L.; Jiao, B.H.; Wu, J.L.; Yang, J.K.; Hu, Y.H.; Cui, K. Mechanism of RIP2 enhancing stemness of glioma cells induces temozolomide resistance. CNS Neurosci. Ther. 2022, 28, 2319–2330. [Google Scholar] [CrossRef]
- Kim, W.T.; Seo Choi, H.; Min Lee, H.; Jang, Y.J.; Ryu, C.J. B-cell receptor-associated protein 31 regulates human embryonic stem cell adhesion, stemness, and survival via control of epithelial cell adhesion molecule. Stem Cells 2014, 32, 2626–2641. [Google Scholar] [CrossRef]
- Ma, Y.; Li, W.; Liu, Y.; Shi, Y.; Lin, Q.; Fu, D. Targeting Colorectal Cancer Stem Cells as an Effective Treatment for Colorectal Cancer. Technol. Cancer Res. Treat. 2020, 19, 1533033819892261. [Google Scholar] [CrossRef] [PubMed]
- Wahab, S.M.R.; Islam, F.; Gopalan, V.; Lam, A.K. The Identifications and Clinical Implications of Cancer Stem Cells in Colorectal Cancer. Clin. Colorectal Canc. 2017, 16, 93–102. [Google Scholar] [CrossRef]
- Abdou Hassan, W.; Muqresh, M.A.; Omer, M. The Potential Role of CD44 and CD133 in Colorectal Stem Cell Cancer. Cureus 2022, 14, e30509. [Google Scholar] [CrossRef]
- Yasuda, H.; Tanaka, K.; Okita, Y.; Araki, T.; Saigusa, S.; Toiyama, Y.; Yokoe, T.; Yoshiyama, S.; Kawamoto, A.; Inoue, Y.; et al. CD133, OCT4, and NANOG in ulcerative colitis-associated colorectal cancer. Oncol. Lett. 2011, 2, 1065–1071. [Google Scholar] [CrossRef]
- Najafi, S.; Rahimi, Z.; Mansoori, B.; Mohammadi, A.; Mohammadnejad, F.; Amini, M.; Mokhtazadeh, A.; Asadzadeh, Z.; Chi-Shing, C.W.; Baradaran, B. CD44 Suppression Improved the Chemosensitivity of HT-29 Colorectal Cancer Cells to 5-Fluorouracil and Inhibited Cell Migration. Adv. Pharm. Bull. 2023, 13, 551–562. [Google Scholar] [CrossRef]
- Khosravi, N.; Shahgoli, V.K.; Amini, M.; Safaei, S.; Mokhtarzadeh, A.; Mansoori, B.; Derakhshani, A.; Baghbanzadeh, A.; Baradaran, B. Suppression of Nanog inhibited cell migration and increased the sensitivity of colorectal cancer cells to 5-fluorouracil. Eur. J. Pharmacol. 2021, 894, 173871. [Google Scholar] [CrossRef]
- Shimura, T.; Takenaka, Y.; Tsutsumi, S.; Hogan, V.; Kikuchi, A.; Raz, A. Galectin-3, a Novel Binding Partner of β-Catenin. Cancer Res. 2004, 64, 6363–6367. [Google Scholar] [CrossRef]
- Liu, F.; Patterson, R.; Wang, J. Intracellular functions of galectins. Biochim. Biophys. Acta-Biomembr. 2002, 1572, 263–273. [Google Scholar] [CrossRef] [PubMed]
- Ochieng, J.; Furtak, V.; Lukyanov, P. Extracellular functions of galectin-3. Glycoconj. J. 2002, 19, 527–535. [Google Scholar] [CrossRef]
- Dumic, J.; Dabelic, S.; Flögel, M. Galectin-3: An open-ended story. Biochim. Biophys. Acta 2006, 1760, 616–635. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Ming, T.; Tang, S.; Ren, S.; Yang, H.; Liu, M.; Tao, Q.; Xu, H. Wnt signaling in colorectal cancer: Pathogenic role and therapeutic target. Mol. Cancer 2022, 21, 144. [Google Scholar] [CrossRef]
- Ebrahimi, N.; Afshinpour, M.; Fakhr, S.S.; Kalkhoran, P.G.; Shadman-Manesh, V.; Adelian, S.; Beiranvand, S.; Rezaei-Tazangi, F.; Khorram, R.; Hamblin, M.R.; et al. Cancer stem cells in colorectal cancer: Signaling pathways involved in stemness and therapy resistance. Crit. Rev. Oncol. Hematol. 2023, 182, 103920. [Google Scholar] [CrossRef] [PubMed]
- Klotz, D. Colorectal cancer stem cells and their implications for novel anticancer therapy. Expert Rev. Anticancer. Ther. 2013, 13, 461–468. [Google Scholar] [CrossRef] [PubMed]
- Fanali, C.; Lucchetti, D.; Farina, M.; Corbi, M.; Cufino, V.; Cittadini, A.; Sgambato, A. Cancer stem cells in colorectal cancer from pathogenesis to therapy: Controversies and perspectives. World J. Gastroenterol. 2014, 20, 923–942. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, T.; Chung, G.T.; Forster, A.; Lobato, M.N.; Rabbitts, T.H. De novo production of diverse intracellular antibody libraries. Nucleic Acids Res. 2003, 31, e23. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, T.; Rabbitts, T.H. Functional intracellular antibody fragments do not require invariant intra-domain disulfide bonds. J. Mol. Biol. 2008, 376, 749–757. [Google Scholar] [CrossRef]
- Che, L.; Du, Z.B.; Wang, W.H.; Wu, J.S.; Han, T.; Chen, Y.Y.; Han, P.Y.; Lei, Z.; Chen, X.X.; He, Y.; et al. Intracellular antibody targeting HBx suppresses invasion and metastasis in hepatitis B virus-related hepatocarcinogenesis via protein phosphatase 2A-B56gamma-mediated dephosphorylation of protein kinase B. Cell Prolif. 2022, 55, e13304. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) |
---|---|
GAPDH-Forward | GACAGTCAGCCGCATCTTCT |
GAPDH-Reverse | TTAAAAGCAGCCCTGGTGAC |
BAP31-Forward | CCTCTATGCGGAGGTCTTTGT |
BAP31-Reverse | CCGTCACATCATCATACTTCCGA |
SOX2-Forward | GCCGAGTGGAAACTTTTGTCG |
SOX2-Reverse | GGCAGCGTGTACTTATCCTTCT |
Oct4-Forward | CTGGGTTGATCCTCGGACCT |
Oct4-Reverse | CCATCGGAGTTGCTCTCCA |
Nanog-Forward | AAGCATGTGTTGAACCTCTACC |
Nanog-Reverse | TGTGTTGGCTAGTTGGCTTCT |
c-MYC-Forward | GGCTCCTGGCAAAAGGTCA |
c-MYC-Reverse | CTGCGTAGTTGTGCTGATGT |
Antibody | Source | Cat# | Dilution |
---|---|---|---|
β-actin | Sigma | A1978 | 1:10,000 |
BAP31 | Sigma | SAB1406931 | 1:1000 |
HA | Sigma | H9658 | 1:10,000 |
Histone H3 | Abcam | ab308373 | 1:1000 |
CD44 | Abcam | ab254530 | 1:2000 |
CD133 | Abcam | ab222782 | 1:2000 |
Oct4 | Abcam | ab19857 | 1:1000 |
SOX2 | Abcam | ab97959 | 1:1000 |
Nanog | Abcam | ab21624 | 1:1000 |
c-MYC | Abcam | ab185656 | 1:2000 |
Galectin-3 | Abcam | b2785 | 1:1000 |
AKT | CST | 4685S | 1:1000 |
p-AKT | CST | 4060T | 1:2000 |
GSK-3β | Proteintech | 67558-1-Ig | 1:2000 |
p-GSK-3β | Proteintech | 22104-1-AP | 1:2000 |
β-catenin | Proteintech | 51067-2-AP | 1:2000 |
Anti-Mouse IgG-Peroxidase | Sigma | A9044 | 1:50,000 |
Anti-Rabbit IgG-Peroxidase | Sigma | A9169 | 1:50,000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Zhang, Q.; Wang, J.; Wang, C.; Lan, T.; Wang, T.; Wang, B. Knockdown of BAP31 Downregulates Galectin-3 to Inhibit the Wnt/β-Catenin Signaling Pathway to Modulate 5-FU Chemosensitivity and Cancer Stemness in Colorectal Cancer. Int. J. Mol. Sci. 2023, 24, 14402. https://doi.org/10.3390/ijms241814402
Liu J, Zhang Q, Wang J, Wang C, Lan T, Wang T, Wang B. Knockdown of BAP31 Downregulates Galectin-3 to Inhibit the Wnt/β-Catenin Signaling Pathway to Modulate 5-FU Chemosensitivity and Cancer Stemness in Colorectal Cancer. International Journal of Molecular Sciences. 2023; 24(18):14402. https://doi.org/10.3390/ijms241814402
Chicago/Turabian StyleLiu, Jingjing, Qi Zhang, Jiyu Wang, Changli Wang, Tian Lan, Tianyi Wang, and Bing Wang. 2023. "Knockdown of BAP31 Downregulates Galectin-3 to Inhibit the Wnt/β-Catenin Signaling Pathway to Modulate 5-FU Chemosensitivity and Cancer Stemness in Colorectal Cancer" International Journal of Molecular Sciences 24, no. 18: 14402. https://doi.org/10.3390/ijms241814402