Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum
Abstract
:1. Introduction
2. Results
2.1. Texture Analysis of Plum Fruits
2.2. Endogenous MT Content in Plum Fruits
2.3. Cell Wall Substance Content in Plum Fruits
2.4. Cell Wall Metabolism-Related Enzyme Activity in Plum Fruits
2.5. The DEGs Following Exogenous MT Treatment
2.6. Functional Classification of DEGs
2.7. Analysis of the Cell Wall Metabolism-Related DEGs
2.8. qRT-PCR Analysis of the DEGs
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Experimental Design
4.3. Determination of Items
4.3.1. Determination of the Fruit Texture
4.3.2. Determination of the Cell Wall Substance Content
4.3.3. Determination of the MT Content
4.3.4. Determination of the Cell Wall Metabolism-Related Enzyme Activity
4.3.5. RNA Library Preparation and Sequencing
4.3.6. Data Processing and Analysis of Differentially Expressed Genes (DEGs)
4.3.7. Candidate DEGs Expression Analysis by Quantitative RT-PCR (qRT-PCR)
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bennett, A.B.; Labavitch, J.M. Ethylene and ripening-regulated expression and function of fruit cell wall modifying proteins. Plant Sci. 2008, 175, 130–136. [Google Scholar] [CrossRef]
- Xiao, J.L.; Qin, M.; Ling, G.Z.; Li, X.F. Advances in studies on the resistance of plant cell walls to harmful metals and salt. Guangdong Agric. Sci. 2020, 47, 73–80. [Google Scholar]
- Zhang, C.; Xiong, Z.; Yang, H.; Wu, W. Changes in pericarp morphology, physiology and cell wall composition account for flesh firmness during the ripening of blackberry (Rubus spp.) fruit. Sci. Hortic. 2019, 250, 59–68. [Google Scholar] [CrossRef]
- Liu, G.; Hu, Q.; Zhang, X.; Jiang, J.; Zhang, Y.; Zhang, Z.; Arnao, M. Melatonin biosynthesis and signal transduction in plants in response to environmental conditions. J. Exp. Bot. 2022, 73, 5818–5827. [Google Scholar] [CrossRef]
- Xie, X.; Ding, D.; Bai, D.; Zhu, Y.; Sun, W.; Sun, Y.; Zhang, D. Melatonin biosynthesis pathways in nature and its production in engineered microorganisms. Synth. Syst. Biotechnol. 2022, 7, 544–553. [Google Scholar] [CrossRef]
- Shao, M.; Liu, R.; Sun, P.; Guan, S.; Liao, B.; Li, S.; Cong, T.; Liang, K.; Ma, H.; Sun, C. Human body networks mechanisms of melatonin and its clinical applications. Chin. J. Clin. Pharmacol. Ther. 2022, 27, 1031–1040. [Google Scholar]
- Tan, D.; Reiter, R.J.; Dietz, K. An evolutionary view of melatonin synthesis and metabolism related to its biological functions in plants. J. Exp. Bot. 2020, 71, 4677–4689. [Google Scholar] [CrossRef]
- Yang, X.X.; Chen, J.; Ma, Y.; Huang, M.H.; Qiu, T.; Bian, H.W.; Han, N.; Wang, J.H. Function, mechanism, and application of plant melatonin: An update with a focus on the cereal crop, barley (Hordeum vulgare L.). Antioxidants 2022, 11, 634. [Google Scholar] [CrossRef]
- Tian, D.J.; Duan, C.Y.; Liu, S.H.; Li, G.Q.; Wang, F.; Deng, J. Effects of exogenous melatonin on postharvest fruit cell wall metabolism. For. Sci. Technol. 2022, 64, 1–4. [Google Scholar]
- Zhang, Y.W.; Xing, Y.; Chen, F.S. Research progress of pectin degrading enzymes and related genes in fruit softening. Storage Process 2019, 19, 147–153. [Google Scholar]
- Cao, S.; Bian, K.; Shi, L.; Chung, H.H.; Chen, W.; Yang, Z. Role of melatonin in cell-wall disassembly and chilling tolerance in cold-stored peach fruit. J. Agric. Food Chem. 2018, 66, 5663–5670. [Google Scholar] [CrossRef] [PubMed]
- Zhai, R.; Liu, J.; Liu, F.; Zhao, Y.; Liu, L.; Fang, C.; Wang, H.; Li, X.; Wang, Z.; Ma, F.; et al. Melatonin limited ethylene production, softening and reduced physiology disorder in pear (Pyrus communis L.) fruit during senescence. Postharvest Biol. Technol. 2018, 139, 38–46. [Google Scholar] [CrossRef]
- Hu, W.; Yang, H.; Tie, W.; Yan, Y.; Ding, Z.; Liu, Y.; Wu, C.; Wang, J.; Reiter, R.J.; Tan, D.X.; et al. Natural variation in banana varieties highlights the role of melatonin in postharvest ripening and quality. J. Agric. Food Chem. 2017, 65, 9987–9994. [Google Scholar] [CrossRef]
- Tijero, V.; Muñoz, P.; Munné-Bosch, S. Melatonin as an inhibitor of sweet cherries ripening in orchard trees. Plant Physiol. Biochem. 2019, 140, 88–95. [Google Scholar] [CrossRef]
- Mansouri, S.; Sarikhani, H.; Sayyari, M.; Soleimani Aghdam, M. Melatonin accelerates strawberry fruit ripening by triggering GAMYB gene expression and promoting ABA accumulation. Sci. Hortic. 2021, 281, 109919. [Google Scholar] [CrossRef]
- Sun, Q.; Zhang, N.; Wang, J.; Cao, Y.; Li, X.; Zhang, H.; Zhang, L.; Tan, D.X.; Guo, Y.D. A label-free differential proteomics analysis reveals the effect of melatonin on promoting fruit ripening and anthocyanin accumulation upon postharvest in tomato. J. Pineal Res. 2016, 61, 138–153. [Google Scholar] [CrossRef] [PubMed]
- Verde, A.; Miguez, J.M.; Gallardo, M. Role of melatonin in apple fruit during growth and ripening: Possible interaction with ethylene. Plants 2022, 11, 688. [Google Scholar] [CrossRef]
- Qiu, X.; Zhang, H.; Zhang, H.; Duan, C.; Xiong, B.; Wang, Z. Fruit textural characteristics of 23 plum (Prunus salicina Lindl) cultivars: Evaluation and cluster analysis. Hortscience 2021, 56, 816–823. [Google Scholar] [CrossRef]
- He, M.; Wu, Y.; Wang, Y.; Hong, M.; Li, T.; Deng, T.; Jiang, Y. Valeric acid suppresses cell wall polysaccharides disassembly to maintain fruit firmness of harvested ‘Waizuili’ plum (Prunus salicina Lindl). Sci. Hortic. 2022, 291, 110608. [Google Scholar] [CrossRef]
- Zhao, D.; Luan, Y.; Shi, W.; Tang, Y.; Huang, X.; Tao, J. Melatonin enhances stem strength by increasing lignin content and secondary cell wall thickness in herbaceous peony. J. Exp. Bot. 2022, 73, 5974–5991. [Google Scholar] [CrossRef]
- Song, L.; Zhang, W.; Li, Q.; Jiang, Z.; Wang, Y.; Xuan, S.; Zhao, J.; Luo, S.; Shen, S.; Chen, X. Melatonin alleviates chilling injury and maintains postharvest quality by enhancing antioxidant capacity and inhibiting cell wall degradation in cold-stored eggplant fruit. Postharvest Biol. Technol. 2022, 194, 112092. [Google Scholar] [CrossRef]
- He, J.; Zhuang, X.; Zhou, J.; Sun, L.; Wan, H.; Li, H.; Lyu, D. Exogenous melatonin alleviates cadmium uptake and toxicity in apple rootstocks. Tree Physiol. 2020, 40, 746–761. [Google Scholar] [CrossRef]
- Li, Y.; Liu, C.; Shi, Q.; Yang, F.; Wei, M. Mixed red and blue light promotes ripening and improves quality of tomato fruit by influencing melatonin content. Environ. Exp. Bot. 2021, 185, 104407. [Google Scholar] [CrossRef]
- Kou, X.; Feng, Y.; Yuan, S.; Zhao, X.; Wu, C.; Wang, C.; Xue, Z. Different regulatory mechanisms of plant hormones in the ripening of climacteric and non-climacteric fruits: A review. Plant Mol.Biol. 2021, 107, 477–497. [Google Scholar] [CrossRef]
- Bu, J.; Yu, Y.; Aisikaer, G.; Ying, T. Postharvest UV-C irradiation inhibits the production of ethylene and the activity of cell wall-degrading enzymes during softening of tomato (Lycopersicon esculentum L.) fruit. Postharvest Biol. Technol. 2013, 86, 337–345. [Google Scholar] [CrossRef]
- Perez-Pastrana, J.; Islas-Flores, I.; Barany, I.; Alvarez-Lopez, D.; Canto-Flick, A.; Canto-Canche, B.; Pena-Yam, L.; Munoz-Ramirez, L.; Aviles-Vinas, S.; Testillano, P.S.; et al. Development of the ovule and seed of Habanero chili pepper (Capsicum chinense Jacq.): Anatomical characterization and immunocytochemical patterns of pectin methyl-esterification. J. Plant Physiol. 2018, 230, 1–12. [Google Scholar] [CrossRef]
- Win, N.M.; Yoo, J.; Naing, A.H.; Kwon, J.; Kang, I. 1-Methylcyclopropene (1-MCP) treatment delays modification of cell wall pectin and fruit softening in “Hwangok” and “Picnic” apples during cold storage. Postharvest Biol. Technol. 2021, 180, 111599. [Google Scholar] [CrossRef]
- Sun, Q.; Zhang, N.; Wang, J.; Zhang, H.; Li, D.; Shi, J.; Li, R.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes ripening and improves quality of tomato fruit during postharvest life. J. Exp. Bot. 2015, 66, 657–668. [Google Scholar] [CrossRef]
- Tong, Z.G.; Wang, F.; Gao, Z.H.; Zhou, J.; Xu, Q.H.; Zhang, Z. Advances in research on the relationship between pectolytic enzymes and fruit softening. J. Fruit Sci. 2011, 28, 305–312. [Google Scholar]
- Tian, A.M.; Liu, J.L.; Cao, J.S. Beta galactosidase in plants. Chin. J. Cell Biol. 2014, 36, 703–707. [Google Scholar]
- Yang, L.; Cong, P.; He, J.; Bu, H.; Qin, S.; Lyu, D. Differential pulp cell wall structures lead to diverse fruit textures in apple (Malus domestica). Protoplasma 2022, 259, 1205–1217. [Google Scholar] [CrossRef] [PubMed]
- Miedes, E.; Lorences, E.P. Xyloglucan endotransglucosylase/hydrolases (XTHs) during tomato fruit growth and ripening. J. Plant Physiol. 2009, 166, 489–498. [Google Scholar] [CrossRef] [PubMed]
- Qu, G.; Ba, L.; Wang, R.; Li, J.; Ma, C.; Ji, N.; Cao, S. Effects of melatonin on blueberry fruit quality and cell wall metabolism during low temperature storage. Ciênc. Tecnol. Aliment. 2022, 42, e40822. [Google Scholar] [CrossRef]
- Sun, Y.H. Research on the Mechanism of Melatonin Treatment Delaying Fruit Softening of Cold Storage Jujube Based on Transcriptome Sequencing. Master’s Thesis, Shenyang Agricultural University, Shenyang, China, 2022. [Google Scholar]
- Hu, P.; Li, G.; Zhao, X.; Zhao, F.; Li, L.; Zhou, H. Transcriptome profiling by RNA-Seq reveals differentially expressed genes related to fruit development and ripening characteristics in strawberries (Fragaria x ananassa). PeerJ 2018, 6, e4976. [Google Scholar] [CrossRef]
- Nham, N.T.; de Freitas, S.T.; Macnish, A.J.; Carr, K.M.; Kietikul, T.; Guilatco, A.J.; Jiang, C.Z.; Zakharov, F.; Mitcham, E.J. A transcriptome approach towards understanding the development of ripening capacity in ‘Bartlett’ pears (Pyrus communis L.). BMC Genom. 2015, 16, 762. [Google Scholar] [CrossRef]
- Sun, Y.J.; Jiang, Y.P.; Shi, Z.D.; Zhang, X.H.; Li, F.J.; Li, X.A. Effects of preharvest regulation of ethylene on texture changes of ‘Gala’ apple fruit during cold storage. North. Hortic. 2021, 45, 97–104. [Google Scholar]
- Xiao, W.; Tu, H.Y.; Zhang, A.L. Experimental Supervision of Plant Physiology; Sun Yat-sen University Press: Guangzhou, China, 2020; pp. 83–87. [Google Scholar]
- Shang, H.T. Study on Mechanisms of Mealiness or Leaheriness Development in Chilling Injured Peach Fruit. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2011. [Google Scholar]
- Cao, J.K.; Jiang, W.B.; Zhao, Y.M. Experiment Guidance of Postharvest Physiology and Biochemistry of Fruit and Vegetable; China Light Industry Press: Beijing, China, 2007; pp. 85–99. [Google Scholar]
- Xiong, Q.E. Experimental Course in Plant Physiology; Sichuan Science and Technology Press: Chengdu, China, 2002; pp. 63–75. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Method 2001, 25, 402–408. [Google Scholar] [CrossRef]
Samples | Clean Reads | Clean Bases | GC Content | Percentage ≥ Q30 |
---|---|---|---|---|
CK1c | 24,047,569 | 7,195,641,968 | 46.25% | 94.31% |
CK2c | 22,524,544 | 6,738,533,176 | 45.96% | 94.35% |
CK3c | 22,254,407 | 6,658,967,860 | 45.96% | 94.39% |
CK1d | 22,766,320 | 6,811,703,926 | 46.03% | 94.57% |
CK2d | 19,728,390 | 5,892,366,136 | 46.27% | 94.89% |
CK3d | 22,134,960 | 6,623,316,176 | 46.08% | 94.47% |
MT1c | 22,571,792 | 6,754,964,140 | 46.13% | 94.27% |
MT2c | 21,401,071 | 6,404,898,452 | 45.95% | 94.61% |
MT3c | 21,720,819 | 6,501,062,054 | 45.94% | 94.62% |
MT1d | 24,216,209 | 7,245,015,474 | 46.14% | 94.45% |
MT2d | 22,413,674 | 6,708,954,516 | 46.04% | 94.20% |
MT3d | 21,038,544 | 6,297,492,174 | 45.95% | 95.00% |
Sample | Total Reads | Mapped Reads | Uniq Mapped Reads | Multiple Map Reads | Reads Map to ‘+’ | Reads Map to ‘−’ |
---|---|---|---|---|---|---|
CK1c | 48,095,138 | 45,248,937 (94.08%) | 40,854,635 (84.95%) | 4,394,302 (9.14%) | 26,672,296 (55.46%) | 26,685,363 (55.48%) |
CK2c | 45,049,088 | 42,402,828 (94.13%) | 39,140,794 (86.88%) | 3,262,034 (7.24%) | 23,701,056 (52.61%) | 23,697,471 (52.60%) |
CK3c | 44,508,814 | 41,746,240 (93.79%) | 38,631,674 (86.80%) | 3,114,566 (7.00%) | 23,243,929 (52.22%) | 23,248,047 (52.23%) |
CK1d | 45,532,640 | 42,705,134 (93.79%) | 39,323,894 (86.36%) | 3,381,240 (7.43%) | 24,101,914 (52.93%) | 24,108,373 (52.95%) |
CK2d | 39,456,780 | 37,007,767 (93.79%) | 33,478,908 (84.85%) | 3,528,859 (8.94%) | 21,746,347 (55.11%) | 21,749,992 (55.12%) |
CK3d | 44,269,920 | 41,299,332 (93.29%) | 38,207,075 (86.30%) | 3,092,257 (6.99%) | 23,034,074 (52.03%) | 23,038,665 (52.04%) |
MT1c | 45,143,584 | 42,433,505 (94.00%) | 39,213,367 (86.86%) | 3,220,138 (7.13%) | 23,684,264 (52.46%) | 23,695,294 (52.49%) |
MT2c | 42,802,142 | 40,335,705 (94.24%) | 37,342,807 (87.25%) | 2,992,898 (6.99%) | 22,441,527 (52.43%) | 22,441,944 (52.43%) |
MT3c | 43,441,638 | 40,880,319 (94.10%) | 37,895,016 (87.23%) | 2,985,303 (6.87%) | 22,695,312 (52.24%) | 22,700,036 (52.25%) |
MT1d | 48,432,418 | 45,536,663 (94.02%) | 42,110,064 (86.95%) | 3,426,599 (7.08%) | 25,405,517 (52.46%) | 25,417,786 (52.48%) |
MT2d | 44,827,348 | 42,115,270 (93.95%) | 38,933,242 (86.85%) | 3,182,028 (7.10%) | 23,467,777 (52.35%) | 23,486,024 (52.39%) |
MT3d | 42,077,088 | 39,808,166 (94.61%) | 36,812,988 (87.49%) | 2,995,178 (7.12%) | 22,225,118 (52.82%) | 22,234,922 (52.84%) |
DEG Set | Total | COG | GO | KEGG | KOG | NR | Pfam | Swiss-Prot | eggNOG |
---|---|---|---|---|---|---|---|---|---|
CKc vs. MTc | 436 | 123 | 350 | 302 | 174 | 436 | 353 | 329 | 396 |
CKd vs. MTd | 369 | 128 | 306 | 260 | 154 | 367 | 297 | 283 | 349 |
Gene Name | Gene ID in NCBI (NR_Symbol) | Description | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Tm (°C) |
---|---|---|---|---|---|
PPE8B | LOC103340502 | Pectinesterase/pectinesterase inhibitor PPE8B [Prunus mume] | TTTCCGACTGCCTTGATT | TTGCCCTTCTGATTCTGG | 52.30 |
RCA | LOC117618678 | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic isoform X1 [Prunus dulcis] | GCACCGCTGAGCCTAAAT | TTCCACCTCTGCTACAATCCTG | 57.17 |
XTH23 (period c) | LOC18792321 | Probable xyloglucan endotransglucosylase/hydrolase protein 23 [Prunus persica] | GCTTCTTACGCTGTCCCT | GCTCCAATCTGCCTTCAC | 54.36 |
PME | LOC18789392 | 21 kDa protein [Prunus persica] | GCCGCTCTTCACGACTGCT | CATTCTCCGCTCGCTTGGT | 60.43 |
At4g24780 | - | Pectase lyase [Prunus salicina] | GCAGAGGCTGGCAGATTG | CGACCGTCGATGGTCTTG | 56.85 |
GSVIVT00026920001 | LOC103323077 | Probable polygalacturonase [Prunus mume] | TGGTGGGATTGGTTTAGC | ATAAGGCGACTCTGGAGG | 52.59 |
BGAL8 | LOC110771136 | Beta-galactosidase 8-like isoform X1 [Prunus avium] | TGGAACAGGAAACGGTAA | CTGAAGCCCAACAGTCAA | 51.31 |
PGIP | - | Polygalacturonase inhibiting protein [Prunus salicina] | CCTCCTCTGCTTGACCCT | GGAGTTGATGCGGTTTGT | 55.86 |
XTH23 (period d) | - | Unnamed protein product [Prunus armeniaca] | CAAAGAGCAGCAGTTCTACCT | GCCCAGTCATCAGCGTTC | 56.76 |
PECS-1.1 | LOC103327551 | Pectinesterase [Prunus mume] | GACTTGCCTTGATGGGTTCT | GCATTGCTGCATAGTTGTTCT | 56.05 |
Xyl2 | LOC103331025 | Beta-glucosidase BoGH3B isoform X1 [Prunus mume] | TTTGAGAACCCTTTGGCTGAT | TTGGGAAGAGGTATGACTGGAT | 55.56 |
BGLU41 | - | Unnamed protein product [Prunus armeniaca] | AAGTACCAGAACCCTCCG | AAACCGAACAGTGTAGCC | 52.26 |
BGLU11 | LOC103330636 | Beta-glucosidase 11-like [Prunus mume] | GGACCTGTCAACCCGAAGG | CGTTGTGGCGGAAGAAAT | 54.87 |
CAC | At1g60780 | Clathrin adaptor complexes medium subunit | GGGATACGCTACAAGAAGAATGAG | CTTACACTCTGGCATACCACTCAA | 58.65 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Zhang, L.; Xu, Y.; Zhang, X.; Zhu, Y.; Wang, J.; Xia, H.; Liang, D.; Lv, X.; Lin, L. Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. Int. J. Mol. Sci. 2023, 24, 13495. https://doi.org/10.3390/ijms241713495
Li Z, Zhang L, Xu Y, Zhang X, Zhu Y, Wang J, Xia H, Liang D, Lv X, Lin L. Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. International Journal of Molecular Sciences. 2023; 24(17):13495. https://doi.org/10.3390/ijms241713495
Chicago/Turabian StyleLi, Zhiyu, Lu Zhang, Yaxin Xu, Xuemei Zhang, Yanzhou Zhu, Jin Wang, Hui Xia, Dong Liang, Xiulan Lv, and Lijin Lin. 2023. "Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum" International Journal of Molecular Sciences 24, no. 17: 13495. https://doi.org/10.3390/ijms241713495
APA StyleLi, Z., Zhang, L., Xu, Y., Zhang, X., Zhu, Y., Wang, J., Xia, H., Liang, D., Lv, X., & Lin, L. (2023). Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. International Journal of Molecular Sciences, 24(17), 13495. https://doi.org/10.3390/ijms241713495