Next Article in Journal
ZmHMA3, a Member of the Heavy-Metal-Transporting ATPase Family, Regulates Cd and Zn Tolerance in Maize
Previous Article in Journal
FXR Maintains the Intestinal Barrier and Stemness by Regulating CYP11A1-Mediated Corticosterone Synthesis in Biliary Obstruction Diseases
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum

College of Horticulture, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(17), 13495; https://doi.org/10.3390/ijms241713495
Submission received: 9 August 2023 / Revised: 24 August 2023 / Accepted: 29 August 2023 / Published: 30 August 2023
(This article belongs to the Section Molecular Plant Sciences)

Abstract

:
In this study, we investigated the effect of exogenous melatonin (MT) on cell wall metabolism leading to Chinese plum (Prunus salicina Lindl.) fruit softening. Exogenous MT treatment increased the endogenous MT content in plum fruits before fruit ripening. However, in mature plum fruits, exogenous MT treatment decreased the fruit hardness, pulp hardness, fruit elasticity, contents of ion-bound pectin, covalently-bound pectin, hemicellulose, and cellulose, and activities of xyloglucan endotransglycosylase/hydrolase and endo-β-1,4-glucanase, and increased the water-soluble pectin content, and activities of pectin methyl esterase, pectin lyase, polygalacturonase, β-galactopyranosidase, and α-L-arabinofuranosidase. Transcriptome analysis revealed that the differentially expressed genes (DEGs) associated with cell wall metabolism in the exogenous MT-treated plum fruits were mainly enriched in the pentose and glucuronate interconversions, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and galactose metabolism pathways. Analysis of these DEGs revealed that exogenous MT treatment affected the expression of genes regulating the cell wall metabolism. Overall, exogenous MT treatment promotes the fruit softening of Chinese plum.

1. Introduction

The change in cell wall metabolism is an important indicator of fruit ripening, which plays a critical role in fruit softening [1]. The cell wall is a complex, multilayered dynamic network structure composed of pectin, cellulose, hemicellulose, mineral elements, and a few structural proteins [2]. At the early stage of fruit development, the cell wall is thick but gradually disintegrates, leading to cell expansion as the fruit develops. Subsequently, the cell wall structure is significantly disrupted, the hemicellulose depolymerizes, and intercellular adhesion is significantly reduced at the late stage of fruit ripening [3].
Melatonin (MT) is a tryptophan-indole derivative widely found in plants and animals. It was first extracted from the pineal gland of cattle in 1958, hence the name pinealectin [4]. In vertebrates, MT is synthesized in the pineal gland in four consecutive enzymatic reactions with tryptophan as the precursor [5]. In the human body, MT plays a key role in regulating the biological clock and the sleep–wake cycle, and also has anti-inflammatory, antioxidant, immunomodulatory, analgesic, and anxiety-reducing properties [6]. In plants, there are multiple pathways for MT synthesis; thus, MT synthesis in plants is more complex [7]. Several recent studies have pointed out that MT is important in regulating seed germination, morphogenesis, material metabolism, and resistance to external stresses [8]. In addition, MT influences plant maturation and cell wall metabolism [9].
In fruits, high pectin methyl esterase (PME) and low polygalacturonase (PG) activities significantly increase the accumulation of demethylated pectin, resulting in fruit pulverization [10]. However, treatment with 100 μM of MT maintains a balance between PpPME and PpPG transcripts, up-regulates some arabinogalactan-like protein family genes, and alleviates cell wall modification by positively regulating the activity of cell wall modifying enzymes and protein synthesis, which alleviates fruit pulverization [11]. In pear fruit, treatment with 100 μM of MT affected the expression of genes related to cell wall degradation, though the effects varied depending on the pear variety [12]. However, there are no systematic studies on the influence of MT on fruit cell wall metabolism.
Ethylene plays an important role in fruit ripening. However, Hu et al. (2017) [13] pointed out that the changes in MT content in bananas are more consistent with the trend of ripening changes than ethylene. Notably, treatment with 50 μM of MT reduces ethylene production by regulating the expression of MaACO1 and MaACS1, which delays the post-harvest ripening of fruits. More importantly, the exogenous MT (100 μM) treatment affects the endogenous hormone level in sweet cherries. Interestingly, the MT trend is consistent with that of jasmonic acid and salicylic acid in plants. At the same time, MT inhibits sweet cherry fruit ripening by crosstalk with cytokinins [14]. In strawberry fruits, MT (1000 μM) increases H2O2 accumulation and up-regulates TDC, SNAT, T1000H, ASMT, and abscisic acid content to promote fruit ripening [15]. Similarly, MT plays an important role during fruit ripening in tomatoes and apples [16,17].
Chinese plum (Prunus salicina Lindl.) is a common temperate fruit with a high economic value and is widely loved by consumers, but the content of lignin in the fruit affects its commercial value [18,19]. MT biosynthesis has the same regulatory factors as lignin biosynthesis, and exogenous MT treatment influences plant lignin synthesis [20]. Although previous research has revealed that MT affects the ripening of horticultural crops [15,16,17], there is little information on the influence of MT on fruit cell wall metabolism during fruit ripening. Therefore, this study investigated the effects of exogenous MT application on fruit cell wall metabolism during Chinese plum fruit ripening and used the transcriptome profiles to explore the molecular mechanisms regulating the plum fruit cell wall metabolism following MT treatment.

2. Results

2.1. Texture Analysis of Plum Fruits

There were no significant changes in plum fruit hardness at 7 and 14 days following exogenous MT treatment compared to the control (Figure 1A). However, the exogenous MT treatment significantly increased the fruit hardness at 21 days and decreased it at 28 days compared to the control. At the same time, the pulp hardness showed a gradual decrease from fruit development to maturity. Notably, the changes in pulp hardness after the exogenous MT treatment was consistent with the changes in fruit hardness (Figure 1B), with significant changes at 21 and 28 days only. The exogenous MT treatment increased the pulp hardness by 7.15% compared to the control at 21 days and decreased it by 14.43% at 28 days. In contrast, the exogenous MT treatment had no significant changes in fruit elasticity at 7, 14, and 21 days, which decreased by 5.68% compared to the control at 28 days (Figure 1C). Therefore, the exogenous MT treatment decreased the hardness and elasticity of plum fruits only at maturity.

2.2. Endogenous MT Content in Plum Fruits

The endogenous MT content in plum fruits showed an increasing trend following the exogenous MT treatment (Figure 1D). Specifically, the exogenous MT treatment significantly increased the endogenous MT content by 4.17, 5.26, and 23.61% at 7, 14, and 21 days, respectively, compared to the control. However, there was no significant difference in the endogenous MT content between exogenous MT treatment and control plum fruits at 28 days.

2.3. Cell Wall Substance Content in Plum Fruits

The water-soluble pectin in plum fruits decreased during plum fruit development (Figure 2A). Exogenous MT treatment only increased the water-soluble pectin content at 21 and 28 days by 10.86 and 12.27%, respectively, compared to the control. However, there were no significant changes in the water-soluble pectin content at 7 and 14 days between the exogenous MT treatment and the control.
The ion-bound pectin content was lower in the exogenous MT-treated plum fruits than in the control at 28 days (Figure 2B). Similarly, the covalently-bound pectin content was lower in the exogenous MT-treated plum fruits than in the control at 21 and 28 days (Figure 2C). However, the changes in the ion-bound and covalently-bound pectin treated with exogenous MT were insignificant compared to the control. Exogenous MT treatment also decreased the hemicellulose content at 7 and 28 days but had no significant changes at 14 and 21 days compared to the control (Figure 2D). On the contrary, the exogenous MT treatment increased the cellulose content by 6.82 and 9.88% at 7 and 14 days, respectively, and decreased it by 7.31% at 28 days (Figure 2E) compared to the control. Interestingly, the exogenous MT treatment only decreased the lignin content at 7 days, with no significant effects on 14, 21, and 28 days (Figure 2F). Therefore, exogenous MT treatment promoted cell wall degradation in plum fruits at maturity.

2.4. Cell Wall Metabolism-Related Enzyme Activity in Plum Fruits

Exogenous MT treatment had no significant effect on the PME activity in plum fruits in the early stage of plum fruit development (Figure 3A). However, at 28 days, the exogenous MT treatment increased the PME activity by 70.76% compared to the control. For the PL activity, exogenous MT treatment significantly decreased its activity at 14 days but increased it at 28 days (Figure 3B). On the contrary, there were no significant differences in the PL activity between the exogenous MT-treated and control plum fruits at 7 and 21 days. The PG and β-GAL activities in exogenous MT-treated plum fruits were higher than the control at 7, 14, 21, and 28 days (Figure 3C,D). Exogenous MT treatment also increased the XTH activity at 7 and 14 days but decreased it at 21 and 28 days (Figure 3E). The α-AF activity in the exogenous MT-treated plum fruits was lower than the control at 7, 14, and 21 days and higher than the control at 28 days (Figure 3F). The EG activity in the exogenous MT treatment fruits was lower than the control at 7 and 28 days, with no significant differences with the control at 14 and 21 days (Figure 3G).

2.5. The DEGs Following Exogenous MT Treatment

To further investigate the effect of exogenous MT on the cell wall metabolism during ripening of plum fruits, transcriptome sequencing analysis was used to analyze the samples of plum fruits at 21 and 28 days after treatment. A total of 12 samples (c represents 21 days, and d represents 28 days) were analyzed on the Illumina platform. The sequencing results revealed that the GC content was greater than 45%, and the percentage of Q30 was greater than 94% (Table 1) implying a high sequencing and library construction sample quality. The comparison efficiency of the sample reads with the reference genome ranged between 93.29 and 94.61% (Table 2). The Pearson correlation coefficient further revealed a high correlation between all samples (Figure 4). In addition, 450 DEGs were detected at 21 days, of which 157 were down-regulated, and 302 were up-regulated (Figure 5A). At the same time, 380 DEGs were detected at 28 days, of which 297 were down-regulated, and 83 were up-regulated. Among them, 45 DEGs were detected at both 21 and 28 days (Figure 5B).

2.6. Functional Classification of DEGs

The GO enrichment analyses revealed that 350 DEGs were enriched at 21 days and 306 DEGs at 28 days (Table 3). The DEGs at 21 days were enriched in the biological processes, including photosynthesis, light harvesting in photosystem I, protein-chromophore linkage, xyloglucan metabolic process, xyloglucan metabolic process, chromophore linkage, xyloglucan metabolic process, plant-type cell wall organization, cell wall organization, and cell wall biogenesis (Figure 6A). At 28 days, the DEGs were enriched in photosynthesis, suberin biosynthesis, and lipid metabolic processes (Figure 6D). In the cellular components, the DEGs were enriched in the photosystem I, photosystem II, plastoglobule, and cell wall at 21 days (Figure 6B) and photosystem I reaction center, integral membrane components, and cell wall at 28 days (Figure 6E). In the molecular functions, the DEGs were enriched in chlorophyll-binding, xyloglucan: xyloglucosyl transferase activity, and cellulose synthase (UDP-forming) activity at 21 days (Figure 6C), and the transferase activity, transferring acyl groups other than amino-acyl groups, pectinesterase inhibitor activity, among others, at 28 days (Figure 6F).
Subsequently, KEGG pathway enrichment analysis detected 302 and 260 DEGs enriched at 21 and 28 days, respectively (Table 3). At 21 days, the DEGs were mainly enriched in the photosynthesis-antenna proteins, plant–pathogen interaction, and glycerophospholipid metabolism pathways (Figure 7A). At 28 days, the DEGs were mainly enriched in photosynthesis and plant–pathogen interactions (Figure 7B).

2.7. Analysis of the Cell Wall Metabolism-Related DEGs

DEGs analysis identified 11 genes related to cell wall metabolism in the exogenous MT-treated group at 21 days. These cell wall metabolism-related DEGs were mainly enriched in the pentose and glucuronate interconversions and phenylpropanoid biosynthesis pathways (Figure 8). PG, galacturan 1,4-alpha-galacturonidase, and UDP-glucose 6-dehydrogenase activities were up-regulated in the pentose and glucuronate interconversions pathway. At the same time, the PME activity inhibitor and PL were up and down-regulated (Figure 8A). Additionally, the expression of cinnamoyl-CoA reductase was down-regulated in the pentose and glucuronate interconversions pathway, while peroxidase was up and down-regulated (Figure 8B).
At 28 days, 16 genes related to cell wall metabolism in the exogenous MT-treated plum fruits were mainly enriched in the pentose and glucuronate interconversions, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and galactose metabolism pathways. Pectinesterase and pectate lyase were down-regulated in the pentose and glucuronate interconversions pathway, and galacturan 1,4-alpha-galacturonidase was up-regulated (Figure 8C). In the phenylpropanoid biosynthesis pathway, beta-glucosidase was up-regulated, cinnamoyl-CoA reductase was down-regulated, and shikimate O-hydroxycinnamoyltransferase was both up-regulated and down-regulated (Figure 8D). Beta-glucosidase was up-regulated in the cyanoamino acid metabolism pathway (Figure 8E). In the galactose metabolism pathway, UDP-sugar pyrophosphorylase and beta-galactosidase were down-regulated (Figure 8F).

2.8. qRT-PCR Analysis of the DEGs

The expression patterns of the six and nine DEGs at 21 and 28 days, respectively, screened by qRT-PCR analysis, were consistent with the RNA-seq results (Figure 9). Notably, PPE8B, XTH23, At4g24780, and GSVIVT0002692001 were up-regulated, and RCA and PME were down-regulated at 21 days post-MT treatment. At 28 days, PGIP, Xyl2, BGLU41, and BGLU11 were up-regulated, and PPE8B, RCA, BGAL8, XTH23, and PECS-1.1 were down-regulated in the MT-treated group.

3. Discussion

In eggplants, exogenous MT treatment up-regulates the MT synthesis-related genes and the endogenous MT content [21]. In apples, exogenous MT application also increases the endogenous MT content [22]. Increasing endogenous MT content in tomatoes promotes fruit ripening and softening [23]. In various fruits, the exogenous MT treatment can delay or promote fruit ripening by mediating ethylene biosynthesis and signal transduction during fruit ripening [24]. In this study, exogenous MT treatment increased the endogenous MT content in plum fruits 7, 14, and 21 days post-treatment. This implies that the exogenous MT treatment promoted the accumulation of endogenous MT in plum fruits during fruit development, consistent with the results from previous studies [21,22]. However, the exogenous MT treatment had no significant effect on the endogenous MT content in plum fruits at 28 days (maturity period), implying that the endogenous MT content increased during fruit development and decreased during fruit ripening [24].
The changes in the cell wall components are directly related to the changes in the fruit texture [25]. Pectin is one of the important components of the cell wall. Generally, the cell wall hardness is closely related to the pectin structure and chemical modifications [26]. Fruit softening is accompanied by the degradation of the cell wall material, reduction of pectin methyl esterification and long-chain polymerization, and the conversion of intracellular insoluble pectin to soluble pectin [27]. In tomato fruits, exogenous MT treatment decreases the protopectin while increasing the soluble pectin and promoting fruit softening [28]. In this study, exogenous MT treatment increased the cellulose content in plum fruits in the early fruit development and decreased the cellulose, ion-bound pectin, covalently-bound pectin, and hemicellulose contents in the later stage of fruit development. Exogenous MT also increased the water-soluble pectin content in plum fruits later in fruit development. These results imply that exogenous MT treatment promoted the conversion of insoluble pectin to soluble pectin, and the depolymerization of cellulose and hemicellulose accelerated the cell wall degradation and promoted the plum fruit ripening, consistent with previous findings [28].
The cell wall-modifying hydrolases play an important role in fruit texture changes. Notably, the synergy of different hydrolases catalyzes cell wall degradation, a complex physiological process [29]. For example, PME catalyzes pectin demethylation, promoting the conversion of pectin lipids to pectic acid, which provides substrates for PG to act on and promote fruit softening [10]. β-GAL acts on pectin and hemicellulose, reducing the galactose residues in fruits and causing cell wall structural instability [30]. In synergy with XTH, xyloglucan, the most abundant hemicellulose in the plant cell wall, catalyzes the hydrolysis and transfer of xyloglucan to achieve cell wall remodeling [31]. In this study, exogenous MT treatment increased the plum fruit and pulp hardness 21 days post-treatment. Exogenous MT treatment also decreased the PL, α-AF, and EG activities and increased the XTH activity in plum fruits in the early development stage. These results indicate that the cell wall hydrolysis-related enzyme activities were decreased after exogenous MT treatment at the early stages of fruit development.
On the other hand, XTH, a bifunctional enzyme, mainly played an integrative role in plum fruits, integrating newly secreted xyloglucan chains into the cell wall and participating in the formation of a complex xyloglucan–cellulose structure, ultimately increasing fruit hardness 21 days after exogenous MT treatment. Only 2 of the 10 XTH genes are associated with tomato fruit ripening in tomato fruits. Moreover, XET and XEH activities are higher during fruit development and may mainly play a role in maintaining the structural integrity of the cell wall. Thus, the down-regulation of XTH during fruit ripening may facilitate fruit softening [32]. In this study, exogenous MT treatment decreased the plum fruit hardness, pulp hardness, and fruit elasticity during maturity (28 days after treatment). At the same time, the PME, PG, PL, β-GAL, and α-AF activities in the exogenous MT-treated plum fruits were higher than the control and the XTH and EG activities were lower. These results revealed that the exogenous MT treatment increased the pectin hydrolysis-related enzyme activities, causing the plum fruit to soften during the fruit ripening. However, previous studies revealed that MT treatment inhibits the activities of PME, PG, β-GAL, and Cx in fruits at the post-harvest storage stage [33]. This may be due to the different mechanisms of MT action at different treatment periods; thus, further studies must be conducted.
In the present study, the DEGs in MT-treated plum fruits regulated the pentose and glucuronate interconversions, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and galactose metabolism pathways. These four pathways are mainly regulated by genes related to cell wall metabolism. A previous study revealed that the cell wall metabolism-related genes in jujube fruits treated with MT are enriched in the interconversion of pentose and glucuronide and galactose metabolism pathways [34]. Transcriptome analysis has also revealed that the rapid decline in strawberry fruit hardness during fruit ripening is regulated by cell wall metabolism-related DEGs. Furthermore, the cell wall modifying enzyme-related DEGs are important in strawberry fruit development and ripening [35]. In pear fruits, the transcript abundance of cellulose synthase genes, XTH and Exps, significantly changes with decreasing pear fruit hardness after ripening. Moreover, the high expression levels of genes encoding pectin-degrading enzymes induce an increase in the pectic oligomers, which favors the increase in ethylene yield [36]. Exogenous MT treatment up-regulates the cell wall structure-related genes, including PG, pectin methyl esterase 1 (PE1), and β-galactosidase (TBG4) in tomato fruits, which accelerate pectin hydrolysis and promote fruit ripening and softening [28]. Many proteins involved in fruit ripening and cell wall metabolism are also affected by exogenous MT treatment. Furthermore, exogenous MT treatment positively regulates fruit ripening while negatively regulating fruit senescence [16]. In this study, 11 and 16 genes related to cell wall metabolism following exogenous MT treatment were differentially expressed in plum fruits at 21 and 28 days, respectively. Notably, PPE8B, XTH23, At4g24780, and GSVIVT0002692001 in exogenous MT-treated plum fruits were up-regulated at 21 days, while RCA and PME were down-regulated. At the same time, PGIP, Xyl2, BGLU41, and BGLU11 were up-regulated at 28 days in the exogenous MT-treated plum fruits, while PME activity inhibitor, PPE8B, RCA, BGAL8, XTH23, and PECS-1.1 were down-regulated. This implies that the exogenous MT treatment mediated the conversion of ion-bound and covalently-bound pectin to water-soluble pectin and the degradation of cellulose and hemicellulose through the pentose and glucuronate interconversions, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and galactose metabolism pathways at the mature stage of plum fruits, thus promoting the fruit softening.

4. Materials and Methods

4.1. Materials

The Chinese plum variety ‘Qiangcuidali’ grafted on a wild peach rootstock was used in this study. The grafted plum seedlings were planted in a 2000 m2 orchard at Sichuan Huijia Seven Colorful Fields Agricultural Technology Co., Chengdu, China (30°38′ N, 104°13′ E) in February 2018. The seedling spacing was 4 m (plant space) × 3 m (row space). MT was obtained from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).

4.2. Experimental Design

In May 2022, when the plum fruits were at the second rapid expansion period (90 days after flowering), 18 plum trees were selected for the present study. Among them, nine plum trees were treated with 100 μmol/L of MT [11,33], and the other nine were treated with tap water to serve as the control. Briefly, MT was dissolved in tap water and sprayed on the leaves until it started dripping (about 3 L per tree). The controls were sprayed with the same volume of tap water. Each treatment was replicated thrice with three trees per replicate. The MT and tap water treatments were applied again after 7 days. The fruits were sampled at 0, 7, 14, 21, and 28 (maturity) days after the first treatment. The fruit sampling at 0 and 7 days post-treatment was conducted before the spray application. Each time, 27 fruits were collected from the four directions per tree. Subsequently, the fruits were placed in an ice box and transported to the laboratory. In the laboratory, 12 fruits per tree were used for texture analysis, while the remaining 15 were immediately stored at −80 °C awaiting other index analyses.

4.3. Determination of Items

4.3.1. Determination of the Fruit Texture

The plum fruit flesh was cut with a 10 mm diameter punch, and a 9 mm-thick section of pulp below the peel was retained. Next, the texture profile analysis (TPA) was performed using a TA/2R disc probe attached to a TA.XTC-18 texture analyzer (Shanghai Bosin Industrial Development Co., Ltd., Shanghai, China). The test type was downward pressure, the test target was displacement, the test depth was 6 mm, and the test speed was 0.8 mm/s to determine the elasticity of the fruits [37]. Subsequently, puncture analysis of the equatorial fruit parts was performed using a TA/2N needle-type probe to determine the fruit and pulp hardness. The test type was downward pressure, the test target was deformation, the deformation index was 20%, and the test speed was 2 mm/s.

4.3.2. Determination of the Cell Wall Substance Content

The samples were dried and passed through a 0.425 mm sieve. Next, 1 g per sample was weighed in a centrifuge tube, and 30 mL of an 80% ethanol solution was added before boiling for 25 min. Subsequently, the precipitate was washed 1–2 times with 30 mL of 80% ethanol after cooling. The samples were then filtered under vacuum, and the residue was rinsed with 30 mL of the 80% ethanol solution. The obtained filter residue was soaked with 30 mL of 90% dimethyl sulfoxide overnight. Subsequently, the residue was soaked in acetone for 10–20 min to remove the dimethyl sulfoxide, vacuum filtered fully, rinsed in three changes of 30 mL of acetone each time, and dried to a constant weight. The final weight obtained was the cell wall substance [38].
The supernatant containing water-soluble pectin was obtained by weighing 0.05 g of the cell wall substance in a 10 mL capped centrifuge tube, adding 5 mL of deionized water, and shaking for 6 h. Next, 5 mL of sodium acetate buffer was added to the residue to obtain the supernatant containing ion-bound pectin after 6 h of shaking. Subsequently, 5 mL of a sodium carbonate solution was added to the residue to obtain the supernatant containing covalently-bound pectin after 6 h of shaking [39]. Finally, the carbazole ethanol colorimetric method described by Cao et al. (2007) [40] determined the different forms of pectin.
For hemicellulose quantification, 5 mL of a sodium hydroxide solution was added to the extracted pectin residue and shaken for 6 h to obtain the supernatant containing hemicellulose. Next, 2 mL of the hemicellulose supernatant was mixed with 3 mL of sulfuric acid and hydrolyzed in a boiling water bath at 100 °C for 2 h to obtain the hydrolyzed hemicellulose and the extracted hemicellulose residue (cellulose). Subsequently, 1.5 mL of sulfuric acid was added to the residue and left for 2 h. An appropriate amount of activated carbon and 3 mL of ultrapure water was then added to the residue and hydrolyzed in a boiling water bath at 100 °C for 2 h. The residue was then filtered to obtain the cellulose-containing solution. Finally, the cellulose and hemicellulose contents were determined by the anthrone and ethyl acetate colorimetric method [41].
The lignin content was determined by the acetylation method using the lignin content determination kit (Suzhou Grace Biotechnology Co., Ltd., Suzhou, China) following the manufacturer’s instructions.

4.3.3. Determination of the MT Content

The MT content was determined by the enzyme-linked immunosorbent assay using the plant MT ELISA kit (Jiangsu Enzyme Immunoassay Industry Co., Ltd., Yancheng, China) following the manufacturer’s instructions.

4.3.4. Determination of the Cell Wall Metabolism-Related Enzyme Activity

PME, pectin lyase (PL), PG, β-galactosidase (β-GAL), xyloglucan endo glycosyltransferase/hydrolase (XTH), α-L-arabinofuranosidase (α-AF), and endo-β-1,4-glucanase (EG) activities were determined using the PME, PL, PG, β-GAL, XTH, α-AF, and EGase kits (Suzhou Grace Biotechnology Co., Ltd., Suzhou, China), respectively, following the manufacturer’s instructions.

4.3.5. RNA Library Preparation and Sequencing

RNA was extracted from the fruit pulp using the RNAprep Pure Plant Kit (Tiangen, Beijing, China) according to the instructions provided by the manufacturer. Next, the extracted RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol. RNA sequencing libraries were then generated using the Hieff NGS Ultima Dual-mode mRNA Library Prep Kit for Illumina (Yeasen Biotechnology (Shanghai) Co., Ltd., Shanghai, China) following the manufacturer’s instructions.

4.3.6. Data Processing and Analysis of Differentially Expressed Genes (DEGs)

After sequencing, the obtained raw data (raw reads) were processed to obtain high-quality clean data. Next, sequence comparison to the reference genome of plum was performed using the Hisat2 tools. Subsequently, the differential expression analysis between treatments was performed using DESeq2. Genes with an adjusted p < 0.01 and fold change ≥ 2 were denoted as differentially expressed. Finally, the gene ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of the DEGs were performed.

4.3.7. Candidate DEGs Expression Analysis by Quantitative RT-PCR (qRT-PCR)

The first strand cDNA synthesis of the selected DEGs was performed using the M5 Super plus qPCR RT kit with gDNA remover from Mei5 Biotechnology Co., Ltd., Beijing, China, referring to the manufacturer’s instructions. The primers were designed using Primer Premier 5.0 software according to the reference gene sequences in plums (Table 4). RT-qPCR of the DEGs was performed on the CFX96TM Real-Time System platform using the 2X M5 HiPer SYBR Premix EsTaq (with Tli RNaseH) kit from Mei5 Biotechnology Co., Ltd., with CAC as the internal reference gene. The relative DEG expression levels were calculated using the 2−ΔΔCT method [42].

4.4. Statistical Analysis

The data were analyzed in triplicate by Student’s t-test (0.01 ≤ p < 0.05 or p < 0.01) using the SPSS 20.0.0 software (IBM, Inc., Armonk, NY, USA).

5. Conclusions

Exogenous MT treatment increases the endogenous MT in plum fruits at the early stage of fruit development. At maturity, exogenous MT treatment accelerates the plum fruit softening by decreasing the fruit hardness, promoting the conversion of ion-bound and covalently-bound pectin to water-soluble pectin, and degrading the cellulose and hemicellulose. Furthermore, exogenous MT treatment increases the PME, PG, PL, β-GAL, and α-AF activities and decreases XTH and EG activities during plum fruit ripening. Exogenous MT treatment also mediates the pentose and glucuronate interconversions, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and galactose metabolism pathways, regulating the expression of genes related to cell wall metabolism.

Author Contributions

Conceptualization, Z.L. and L.L.; Investigation, Z.L., L.Z., Y.X., X.Z., Y.Z., J.W., H.X. and D.L.; Data curation, Z.L., L.Z. and X.L.; Writing—original draft, Z.L.; Writing—review & editing, L.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Sichuan Provincial Science and Technology Program (2022JDKP0021), and Ya’an School Cooperation Project (2022–2024).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare that they have no competing interest.

References

  1. Bennett, A.B.; Labavitch, J.M. Ethylene and ripening-regulated expression and function of fruit cell wall modifying proteins. Plant Sci. 2008, 175, 130–136. [Google Scholar] [CrossRef]
  2. Xiao, J.L.; Qin, M.; Ling, G.Z.; Li, X.F. Advances in studies on the resistance of plant cell walls to harmful metals and salt. Guangdong Agric. Sci. 2020, 47, 73–80. [Google Scholar]
  3. Zhang, C.; Xiong, Z.; Yang, H.; Wu, W. Changes in pericarp morphology, physiology and cell wall composition account for flesh firmness during the ripening of blackberry (Rubus spp.) fruit. Sci. Hortic. 2019, 250, 59–68. [Google Scholar] [CrossRef]
  4. Liu, G.; Hu, Q.; Zhang, X.; Jiang, J.; Zhang, Y.; Zhang, Z.; Arnao, M. Melatonin biosynthesis and signal transduction in plants in response to environmental conditions. J. Exp. Bot. 2022, 73, 5818–5827. [Google Scholar] [CrossRef]
  5. Xie, X.; Ding, D.; Bai, D.; Zhu, Y.; Sun, W.; Sun, Y.; Zhang, D. Melatonin biosynthesis pathways in nature and its production in engineered microorganisms. Synth. Syst. Biotechnol. 2022, 7, 544–553. [Google Scholar] [CrossRef]
  6. Shao, M.; Liu, R.; Sun, P.; Guan, S.; Liao, B.; Li, S.; Cong, T.; Liang, K.; Ma, H.; Sun, C. Human body networks mechanisms of melatonin and its clinical applications. Chin. J. Clin. Pharmacol. Ther. 2022, 27, 1031–1040. [Google Scholar]
  7. Tan, D.; Reiter, R.J.; Dietz, K. An evolutionary view of melatonin synthesis and metabolism related to its biological functions in plants. J. Exp. Bot. 2020, 71, 4677–4689. [Google Scholar] [CrossRef]
  8. Yang, X.X.; Chen, J.; Ma, Y.; Huang, M.H.; Qiu, T.; Bian, H.W.; Han, N.; Wang, J.H. Function, mechanism, and application of plant melatonin: An update with a focus on the cereal crop, barley (Hordeum vulgare L.). Antioxidants 2022, 11, 634. [Google Scholar] [CrossRef]
  9. Tian, D.J.; Duan, C.Y.; Liu, S.H.; Li, G.Q.; Wang, F.; Deng, J. Effects of exogenous melatonin on postharvest fruit cell wall metabolism. For. Sci. Technol. 2022, 64, 1–4. [Google Scholar]
  10. Zhang, Y.W.; Xing, Y.; Chen, F.S. Research progress of pectin degrading enzymes and related genes in fruit softening. Storage Process 2019, 19, 147–153. [Google Scholar]
  11. Cao, S.; Bian, K.; Shi, L.; Chung, H.H.; Chen, W.; Yang, Z. Role of melatonin in cell-wall disassembly and chilling tolerance in cold-stored peach fruit. J. Agric. Food Chem. 2018, 66, 5663–5670. [Google Scholar] [CrossRef] [PubMed]
  12. Zhai, R.; Liu, J.; Liu, F.; Zhao, Y.; Liu, L.; Fang, C.; Wang, H.; Li, X.; Wang, Z.; Ma, F.; et al. Melatonin limited ethylene production, softening and reduced physiology disorder in pear (Pyrus communis L.) fruit during senescence. Postharvest Biol. Technol. 2018, 139, 38–46. [Google Scholar] [CrossRef]
  13. Hu, W.; Yang, H.; Tie, W.; Yan, Y.; Ding, Z.; Liu, Y.; Wu, C.; Wang, J.; Reiter, R.J.; Tan, D.X.; et al. Natural variation in banana varieties highlights the role of melatonin in postharvest ripening and quality. J. Agric. Food Chem. 2017, 65, 9987–9994. [Google Scholar] [CrossRef]
  14. Tijero, V.; Muñoz, P.; Munné-Bosch, S. Melatonin as an inhibitor of sweet cherries ripening in orchard trees. Plant Physiol. Biochem. 2019, 140, 88–95. [Google Scholar] [CrossRef]
  15. Mansouri, S.; Sarikhani, H.; Sayyari, M.; Soleimani Aghdam, M. Melatonin accelerates strawberry fruit ripening by triggering GAMYB gene expression and promoting ABA accumulation. Sci. Hortic. 2021, 281, 109919. [Google Scholar] [CrossRef]
  16. Sun, Q.; Zhang, N.; Wang, J.; Cao, Y.; Li, X.; Zhang, H.; Zhang, L.; Tan, D.X.; Guo, Y.D. A label-free differential proteomics analysis reveals the effect of melatonin on promoting fruit ripening and anthocyanin accumulation upon postharvest in tomato. J. Pineal Res. 2016, 61, 138–153. [Google Scholar] [CrossRef] [PubMed]
  17. Verde, A.; Miguez, J.M.; Gallardo, M. Role of melatonin in apple fruit during growth and ripening: Possible interaction with ethylene. Plants 2022, 11, 688. [Google Scholar] [CrossRef]
  18. Qiu, X.; Zhang, H.; Zhang, H.; Duan, C.; Xiong, B.; Wang, Z. Fruit textural characteristics of 23 plum (Prunus salicina Lindl) cultivars: Evaluation and cluster analysis. Hortscience 2021, 56, 816–823. [Google Scholar] [CrossRef]
  19. He, M.; Wu, Y.; Wang, Y.; Hong, M.; Li, T.; Deng, T.; Jiang, Y. Valeric acid suppresses cell wall polysaccharides disassembly to maintain fruit firmness of harvested ‘Waizuili’ plum (Prunus salicina Lindl). Sci. Hortic. 2022, 291, 110608. [Google Scholar] [CrossRef]
  20. Zhao, D.; Luan, Y.; Shi, W.; Tang, Y.; Huang, X.; Tao, J. Melatonin enhances stem strength by increasing lignin content and secondary cell wall thickness in herbaceous peony. J. Exp. Bot. 2022, 73, 5974–5991. [Google Scholar] [CrossRef]
  21. Song, L.; Zhang, W.; Li, Q.; Jiang, Z.; Wang, Y.; Xuan, S.; Zhao, J.; Luo, S.; Shen, S.; Chen, X. Melatonin alleviates chilling injury and maintains postharvest quality by enhancing antioxidant capacity and inhibiting cell wall degradation in cold-stored eggplant fruit. Postharvest Biol. Technol. 2022, 194, 112092. [Google Scholar] [CrossRef]
  22. He, J.; Zhuang, X.; Zhou, J.; Sun, L.; Wan, H.; Li, H.; Lyu, D. Exogenous melatonin alleviates cadmium uptake and toxicity in apple rootstocks. Tree Physiol. 2020, 40, 746–761. [Google Scholar] [CrossRef]
  23. Li, Y.; Liu, C.; Shi, Q.; Yang, F.; Wei, M. Mixed red and blue light promotes ripening and improves quality of tomato fruit by influencing melatonin content. Environ. Exp. Bot. 2021, 185, 104407. [Google Scholar] [CrossRef]
  24. Kou, X.; Feng, Y.; Yuan, S.; Zhao, X.; Wu, C.; Wang, C.; Xue, Z. Different regulatory mechanisms of plant hormones in the ripening of climacteric and non-climacteric fruits: A review. Plant Mol.Biol. 2021, 107, 477–497. [Google Scholar] [CrossRef]
  25. Bu, J.; Yu, Y.; Aisikaer, G.; Ying, T. Postharvest UV-C irradiation inhibits the production of ethylene and the activity of cell wall-degrading enzymes during softening of tomato (Lycopersicon esculentum L.) fruit. Postharvest Biol. Technol. 2013, 86, 337–345. [Google Scholar] [CrossRef]
  26. Perez-Pastrana, J.; Islas-Flores, I.; Barany, I.; Alvarez-Lopez, D.; Canto-Flick, A.; Canto-Canche, B.; Pena-Yam, L.; Munoz-Ramirez, L.; Aviles-Vinas, S.; Testillano, P.S.; et al. Development of the ovule and seed of Habanero chili pepper (Capsicum chinense Jacq.): Anatomical characterization and immunocytochemical patterns of pectin methyl-esterification. J. Plant Physiol. 2018, 230, 1–12. [Google Scholar] [CrossRef]
  27. Win, N.M.; Yoo, J.; Naing, A.H.; Kwon, J.; Kang, I. 1-Methylcyclopropene (1-MCP) treatment delays modification of cell wall pectin and fruit softening in “Hwangok” and “Picnic” apples during cold storage. Postharvest Biol. Technol. 2021, 180, 111599. [Google Scholar] [CrossRef]
  28. Sun, Q.; Zhang, N.; Wang, J.; Zhang, H.; Li, D.; Shi, J.; Li, R.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes ripening and improves quality of tomato fruit during postharvest life. J. Exp. Bot. 2015, 66, 657–668. [Google Scholar] [CrossRef]
  29. Tong, Z.G.; Wang, F.; Gao, Z.H.; Zhou, J.; Xu, Q.H.; Zhang, Z. Advances in research on the relationship between pectolytic enzymes and fruit softening. J. Fruit Sci. 2011, 28, 305–312. [Google Scholar]
  30. Tian, A.M.; Liu, J.L.; Cao, J.S. Beta galactosidase in plants. Chin. J. Cell Biol. 2014, 36, 703–707. [Google Scholar]
  31. Yang, L.; Cong, P.; He, J.; Bu, H.; Qin, S.; Lyu, D. Differential pulp cell wall structures lead to diverse fruit textures in apple (Malus domestica). Protoplasma 2022, 259, 1205–1217. [Google Scholar] [CrossRef] [PubMed]
  32. Miedes, E.; Lorences, E.P. Xyloglucan endotransglucosylase/hydrolases (XTHs) during tomato fruit growth and ripening. J. Plant Physiol. 2009, 166, 489–498. [Google Scholar] [CrossRef] [PubMed]
  33. Qu, G.; Ba, L.; Wang, R.; Li, J.; Ma, C.; Ji, N.; Cao, S. Effects of melatonin on blueberry fruit quality and cell wall metabolism during low temperature storage. Ciênc. Tecnol. Aliment. 2022, 42, e40822. [Google Scholar] [CrossRef]
  34. Sun, Y.H. Research on the Mechanism of Melatonin Treatment Delaying Fruit Softening of Cold Storage Jujube Based on Transcriptome Sequencing. Master’s Thesis, Shenyang Agricultural University, Shenyang, China, 2022. [Google Scholar]
  35. Hu, P.; Li, G.; Zhao, X.; Zhao, F.; Li, L.; Zhou, H. Transcriptome profiling by RNA-Seq reveals differentially expressed genes related to fruit development and ripening characteristics in strawberries (Fragaria x ananassa). PeerJ 2018, 6, e4976. [Google Scholar] [CrossRef]
  36. Nham, N.T.; de Freitas, S.T.; Macnish, A.J.; Carr, K.M.; Kietikul, T.; Guilatco, A.J.; Jiang, C.Z.; Zakharov, F.; Mitcham, E.J. A transcriptome approach towards understanding the development of ripening capacity in ‘Bartlett’ pears (Pyrus communis L.). BMC Genom. 2015, 16, 762. [Google Scholar] [CrossRef]
  37. Sun, Y.J.; Jiang, Y.P.; Shi, Z.D.; Zhang, X.H.; Li, F.J.; Li, X.A. Effects of preharvest regulation of ethylene on texture changes of ‘Gala’ apple fruit during cold storage. North. Hortic. 2021, 45, 97–104. [Google Scholar]
  38. Xiao, W.; Tu, H.Y.; Zhang, A.L. Experimental Supervision of Plant Physiology; Sun Yat-sen University Press: Guangzhou, China, 2020; pp. 83–87. [Google Scholar]
  39. Shang, H.T. Study on Mechanisms of Mealiness or Leaheriness Development in Chilling Injured Peach Fruit. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2011. [Google Scholar]
  40. Cao, J.K.; Jiang, W.B.; Zhao, Y.M. Experiment Guidance of Postharvest Physiology and Biochemistry of Fruit and Vegetable; China Light Industry Press: Beijing, China, 2007; pp. 85–99. [Google Scholar]
  41. Xiong, Q.E. Experimental Course in Plant Physiology; Sichuan Science and Technology Press: Chengdu, China, 2002; pp. 63–75. [Google Scholar]
  42. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Method 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Texture, structure, and endogenous MT content of plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Fruit hardness; (B): pulp hardness; (C): fruit elasticity; (D): endogenous MT content.
Figure 1. Texture, structure, and endogenous MT content of plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Fruit hardness; (B): pulp hardness; (C): fruit elasticity; (D): endogenous MT content.
Ijms 24 13495 g001
Figure 2. Cell wall substance content in plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Water-soluble pectin content; (B): ion-bound pectin content; (C): covalently-bound pectin content; (D): hemicellulose content; (E): cellulose content; (F): lignin content.
Figure 2. Cell wall substance content in plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Water-soluble pectin content; (B): ion-bound pectin content; (C): covalently-bound pectin content; (D): hemicellulose content; (E): cellulose content; (F): lignin content.
Ijms 24 13495 g002
Figure 3. Cell wall metabolism-related enzyme activity of plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Pectin methyl esterase (PME) activity; (B): pectin lyase (PL) activity; (C): polygalacturonase (PG) activity; (D): β-galactosaminidase (β-GAL) activity; (E): xyloglucan endotransglycosylase/hydrolase (XTH) activity; (F): α-L-arabinofuranosidase (α-AF) activity; (G): endo-β-1,4-glucanase (EG) activity.
Figure 3. Cell wall metabolism-related enzyme activity of plum fruits. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). (A): Pectin methyl esterase (PME) activity; (B): pectin lyase (PL) activity; (C): polygalacturonase (PG) activity; (D): β-galactosaminidase (β-GAL) activity; (E): xyloglucan endotransglycosylase/hydrolase (XTH) activity; (F): α-L-arabinofuranosidase (α-AF) activity; (G): endo-β-1,4-glucanase (EG) activity.
Ijms 24 13495 g003
Figure 4. Heatmap of gene expression correlation of samples. CK1c, CK2c, and CK3c represent three replicates of CK at 21 days after treatment. CK1d, CK2d, and CK3d represent three replicates of CK at 28 days after treatment. MT1c, MT2c, and MT3c represent three replicates of MT at 21 days after treatment. MT1d, MT2d, and MT3d represent three replicates of MT at 28 days after treatment.
Figure 4. Heatmap of gene expression correlation of samples. CK1c, CK2c, and CK3c represent three replicates of CK at 21 days after treatment. CK1d, CK2d, and CK3d represent three replicates of CK at 28 days after treatment. MT1c, MT2c, and MT3c represent three replicates of MT at 21 days after treatment. MT1d, MT2d, and MT3d represent three replicates of MT at 28 days after treatment.
Ijms 24 13495 g004
Figure 5. Statistical diagram of DEGs. (A): Number of DEGs; (B): Venn diagram of DEGs. CKc and MTc represent 21 days after treatment. CKd and MTd represent 28 days after treatment.
Figure 5. Statistical diagram of DEGs. (A): Number of DEGs; (B): Venn diagram of DEGs. CKc and MTc represent 21 days after treatment. CKd and MTd represent 28 days after treatment.
Ijms 24 13495 g005
Figure 6. GO enrichment analysis of DEGs at 21 and 28 days after treatment. (A): Biological process in c period (21 days after treatment); (B): cellular component in c period (21 days after treatment); (C): molecular function in c period (21 days after treatment); (D): biological process in d period (28 days after treatment); (E): cellular component in d period (28 days after treatment); (F): molecular function in d period (28 days after treatment).
Figure 6. GO enrichment analysis of DEGs at 21 and 28 days after treatment. (A): Biological process in c period (21 days after treatment); (B): cellular component in c period (21 days after treatment); (C): molecular function in c period (21 days after treatment); (D): biological process in d period (28 days after treatment); (E): cellular component in d period (28 days after treatment); (F): molecular function in d period (28 days after treatment).
Ijms 24 13495 g006aIjms 24 13495 g006b
Figure 7. KEGG enrichment analysis of DEGs at 21 and 28 days after treatment. (A): in c period (21 days after treatment); (B): in d period (28 days after treatment).
Figure 7. KEGG enrichment analysis of DEGs at 21 and 28 days after treatment. (A): in c period (21 days after treatment); (B): in d period (28 days after treatment).
Ijms 24 13495 g007
Figure 8. KEGG pathway annotation map of DEGs. (A): DEGs of the pentose and glucuronate interconversions pathway in period c (21 days after treatment); (B): DEGs of the phenylpropanoid biosynthesis pathway in period c (21 days after treatment); (C): DEGs of the pentose and glucuronate interconversions pathway in period d (28 days after treatment); (D): DEGs of the phenylpropanoid biosynthesis pathway in period d (28 days after treatment); (E): DEGs of the cyanoamino acid metabolism pathway in period d (28 days after treatment); (F): DEGs of the galactose metabolism pathway in period d (28 days after treatment). Red represents the up-regulation expressions of genes, green represents down-regulation expressions of genes, and blue represents both up-regulation and down-regulation expressions of genes.
Figure 8. KEGG pathway annotation map of DEGs. (A): DEGs of the pentose and glucuronate interconversions pathway in period c (21 days after treatment); (B): DEGs of the phenylpropanoid biosynthesis pathway in period c (21 days after treatment); (C): DEGs of the pentose and glucuronate interconversions pathway in period d (28 days after treatment); (D): DEGs of the phenylpropanoid biosynthesis pathway in period d (28 days after treatment); (E): DEGs of the cyanoamino acid metabolism pathway in period d (28 days after treatment); (F): DEGs of the galactose metabolism pathway in period d (28 days after treatment). Red represents the up-regulation expressions of genes, green represents down-regulation expressions of genes, and blue represents both up-regulation and down-regulation expressions of genes.
Ijms 24 13495 g008aIjms 24 13495 g008bIjms 24 13495 g008cIjms 24 13495 g008dIjms 24 13495 g008e
Figure 9. Relative expressions of screened DEGs. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). Period c: 21 days after treatment; period d: 28 days after treatment.
Figure 9. Relative expressions of screened DEGs. Values represent the mean ± SE (n = 3). Asterisks indicate significant differences between the treatments using the Student’s t-test (*: 0.01 ≤ p < 0.05; **: p < 0.01). Period c: 21 days after treatment; period d: 28 days after treatment.
Ijms 24 13495 g009aIjms 24 13495 g009b
Table 1. Statistical table of transcriptome sequencing data.
Table 1. Statistical table of transcriptome sequencing data.
SamplesClean ReadsClean BasesGC ContentPercentage ≥ Q30
CK1c24,047,5697,195,641,96846.25%94.31%
CK2c22,524,5446,738,533,17645.96%94.35%
CK3c22,254,4076,658,967,86045.96%94.39%
CK1d22,766,3206,811,703,92646.03%94.57%
CK2d19,728,3905,892,366,13646.27%94.89%
CK3d22,134,9606,623,316,17646.08%94.47%
MT1c22,571,7926,754,964,14046.13%94.27%
MT2c21,401,0716,404,898,45245.95%94.61%
MT3c21,720,8196,501,062,05445.94%94.62%
MT1d24,216,2097,245,015,47446.14%94.45%
MT2d22,413,6746,708,954,51646.04%94.20%
MT3d21,038,5446,297,492,17445.95%95.00%
K1c, CK2c, and CK3c represent three replicates of CK at 21 days after treatment. CK1d, CK2d, and CK3d represent three replicates of CK at 28 days after treatment. MT1c, MT2c, and MT3c represent three replicates of MT at 21 days after treatment. MT1d, MT2d, and MT3d represent three replicates of MT at 28 days after treatment.
Table 2. Statistics of sequence comparison of sample sequencing data with the selected reference genome.
Table 2. Statistics of sequence comparison of sample sequencing data with the selected reference genome.
SampleTotal ReadsMapped ReadsUniq Mapped ReadsMultiple Map ReadsReads Map to ‘+’Reads Map to ‘−’
CK1c48,095,13845,248,937
(94.08%)
40,854,635
(84.95%)
4,394,302
(9.14%)
26,672,296
(55.46%)
26,685,363
(55.48%)
CK2c45,049,08842,402,828
(94.13%)
39,140,794
(86.88%)
3,262,034
(7.24%)
23,701,056
(52.61%)
23,697,471
(52.60%)
CK3c44,508,81441,746,240
(93.79%)
38,631,674
(86.80%)
3,114,566
(7.00%)
23,243,929
(52.22%)
23,248,047
(52.23%)
CK1d45,532,64042,705,134
(93.79%)
39,323,894
(86.36%)
3,381,240
(7.43%)
24,101,914
(52.93%)
24,108,373
(52.95%)
CK2d39,456,78037,007,767
(93.79%)
33,478,908
(84.85%)
3,528,859
(8.94%)
21,746,347
(55.11%)
21,749,992
(55.12%)
CK3d44,269,92041,299,332
(93.29%)
38,207,075
(86.30%)
3,092,257
(6.99%)
23,034,074
(52.03%)
23,038,665
(52.04%)
MT1c45,143,58442,433,505
(94.00%)
39,213,367
(86.86%)
3,220,138
(7.13%)
23,684,264
(52.46%)
23,695,294
(52.49%)
MT2c42,802,14240,335,705
(94.24%)
37,342,807
(87.25%)
2,992,898
(6.99%)
22,441,527
(52.43%)
22,441,944
(52.43%)
MT3c43,441,63840,880,319
(94.10%)
37,895,016
(87.23%)
2,985,303
(6.87%)
22,695,312
(52.24%)
22,700,036
(52.25%)
MT1d48,432,41845,536,663
(94.02%)
42,110,064
(86.95%)
3,426,599
(7.08%)
25,405,517
(52.46%)
25,417,786
(52.48%)
MT2d44,827,34842,115,270
(93.95%)
38,933,242
(86.85%)
3,182,028
(7.10%)
23,467,777
(52.35%)
23,486,024
(52.39%)
MT3d42,077,08839,808,166
(94.61%)
36,812,988
(87.49%)
2,995,178
(7.12%)
22,225,118
(52.82%)
22,234,922
(52.84%)
K1c, CK2c, and CK3c represent three replicates of CK at 21 days after treatment. CK1d, CK2d, and CK3d represent three replicates of CK at 28 days after treatment. MT1c, MT2c, and MT3c represent three replicates of MT at 21 days after treatment. MT1d, MT2d, and MT3d represent three replicates of MT at 28 days after treatment.
Table 3. Statistics on the number of annotated DEGs.
Table 3. Statistics on the number of annotated DEGs.
DEG SetTotalCOGGOKEGGKOGNRPfamSwiss-ProteggNOG
CKc vs. MTc436123350302174436353329396
CKd vs. MTd369128306260154367297283349
CKc and MTc represent 21 days after treatment. CKd and MTd represent 28 days after treatment.
Table 4. Primer information of qRT-PCR.
Table 4. Primer information of qRT-PCR.
Gene NameGene ID in NCBI
(NR_Symbol)
DescriptionForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)Tm (°C)
PPE8BLOC103340502Pectinesterase/pectinesterase inhibitor PPE8B [Prunus mume]TTTCCGACTGCCTTGATTTTGCCCTTCTGATTCTGG52.30
RCALOC117618678Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic isoform X1 [Prunus dulcis]GCACCGCTGAGCCTAAATTTCCACCTCTGCTACAATCCTG57.17
XTH23 (period c)LOC18792321Probable xyloglucan endotransglucosylase/hydrolase protein 23 [Prunus persica]GCTTCTTACGCTGTCCCTGCTCCAATCTGCCTTCAC54.36
PMELOC1878939221 kDa protein [Prunus persica]GCCGCTCTTCACGACTGCTCATTCTCCGCTCGCTTGGT60.43
At4g24780-Pectase lyase [Prunus salicina]GCAGAGGCTGGCAGATTGCGACCGTCGATGGTCTTG56.85
GSVIVT00026920001LOC103323077Probable polygalacturonase [Prunus mume]TGGTGGGATTGGTTTAGCATAAGGCGACTCTGGAGG52.59
BGAL8LOC110771136Beta-galactosidase 8-like isoform X1 [Prunus avium]TGGAACAGGAAACGGTAACTGAAGCCCAACAGTCAA51.31
PGIP-Polygalacturonase inhibiting protein [Prunus salicina]CCTCCTCTGCTTGACCCTGGAGTTGATGCGGTTTGT55.86
XTH23 (period d)-Unnamed protein product [Prunus armeniaca]CAAAGAGCAGCAGTTCTACCTGCCCAGTCATCAGCGTTC56.76
PECS-1.1LOC103327551Pectinesterase [Prunus mume]GACTTGCCTTGATGGGTTCTGCATTGCTGCATAGTTGTTCT56.05
Xyl2LOC103331025Beta-glucosidase BoGH3B isoform X1 [Prunus mume]TTTGAGAACCCTTTGGCTGATTTGGGAAGAGGTATGACTGGAT55.56
BGLU41-Unnamed protein product [Prunus armeniaca]AAGTACCAGAACCCTCCGAAACCGAACAGTGTAGCC52.26
BGLU11LOC103330636Beta-glucosidase 11-like [Prunus mume]GGACCTGTCAACCCGAAGGCGTTGTGGCGGAAGAAAT54.87
CACAt1g60780Clathrin adaptor complexes medium subunitGGGATACGCTACAAGAAGAATGAGCTTACACTCTGGCATACCACTCAA58.65
Period c: 21 days after treatment; period d: 28 days after treatment.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Z.; Zhang, L.; Xu, Y.; Zhang, X.; Zhu, Y.; Wang, J.; Xia, H.; Liang, D.; Lv, X.; Lin, L. Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. Int. J. Mol. Sci. 2023, 24, 13495. https://doi.org/10.3390/ijms241713495

AMA Style

Li Z, Zhang L, Xu Y, Zhang X, Zhu Y, Wang J, Xia H, Liang D, Lv X, Lin L. Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. International Journal of Molecular Sciences. 2023; 24(17):13495. https://doi.org/10.3390/ijms241713495

Chicago/Turabian Style

Li, Zhiyu, Lu Zhang, Yaxin Xu, Xuemei Zhang, Yanzhou Zhu, Jin Wang, Hui Xia, Dong Liang, Xiulan Lv, and Lijin Lin. 2023. "Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum" International Journal of Molecular Sciences 24, no. 17: 13495. https://doi.org/10.3390/ijms241713495

APA Style

Li, Z., Zhang, L., Xu, Y., Zhang, X., Zhu, Y., Wang, J., Xia, H., Liang, D., Lv, X., & Lin, L. (2023). Transcriptome Profiles Reveal the Promoting Effects of Exogenous Melatonin on Fruit Softening of Chinese Plum. International Journal of Molecular Sciences, 24(17), 13495. https://doi.org/10.3390/ijms241713495

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop