Arsenic Induces M2 Macrophage Polarization and Shifts M1/M2 Cytokine Production via Mitophagy
Abstract
:1. Introduction
2. Results
2.1. Arsenic Induced M2 Polarization and Increased M2c-Asscoated Cytokines/Chemokines in m1 Macrophages
2.2. An Autophagy Inhibitor Reduced Arsenic-Induced M2 Polarization
2.3. Arsenic Promoted Autophagy in M1 Macrophages
2.4. Arsenic-Treated M1 Macrophages Promoted Epithelial Cell Migration and Invasion
2.5. Arsenic-Treated Mice Showed Increased M2 Macrophages
3. Discussion
4. Material and Methods
4.1. Cell Culture and Macrophage Polarization
4.2. XTT Cell Viability Assay
4.3. Quantitative Polymerase Chain Reaction (qPCR)
4.4. Enzyme-Linked Immunosorbent Assay (ELISA)
4.5. Migration Assay
4.6. Invasion Assay
4.7. Western Blotting
4.8. Immunofluorescent Staining
4.9. PINK1 Knockdown
4.10. Animals and Arsenic Exposure
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yu, S.; Liao, W.T.; Lee, C.H.; Chai, C.Y.; Yu, C.L.; Yu, H.S. Immunological dysfunction in chronic arsenic exposure: From subclinical condition to skin cancer. J. Dermatol. 2018, 45, 1271–1277. [Google Scholar] [CrossRef] [PubMed]
- Straif, K.; Benbrahim-Tallaa, L.; Baan, R.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Bouvard, V.; Guha, N.; Freeman, C.; Galichet, L.; et al. A review of human carcinogens—Part C: Metals, arsenic, dusts, and fibres. Lancet Oncol. 2009, 10, 453–454. [Google Scholar] [CrossRef]
- Parvez, F.; Chen, Y.; Yunus, M.; Olopade, C.; Segers, S.; Slavkovich, V.; Argos, M.; Hasan, R.; Ahmed, A.; Islam, T.; et al. Arsenic exposure and impaired lung function. Findings from a large population-based prospective cohort study. Am. J. Respir. Crit. Care Med. 2013, 188, 813–819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guha Mazumder, D.N. Arsenic and non-malignant lung disease. J. Environ. Sci. Health Part A Toxic/Hazard. Subst. Environ. Eng. 2007, 42, 1859–1867. [Google Scholar] [CrossRef] [PubMed]
- Siddique, A.E.; Rahman, M.; Hossain, M.I.; Karim, Y.; Hasibuzzaman, M.M.; Biswas, S.; Islam, M.S.; Rahman, A.; Hossen, F.; Mondal, V.; et al. Association between chronic arsenic exposure and the characteristic features of asthma. Chemosphere 2020, 246, 125790. [Google Scholar] [CrossRef]
- Assad, N.; Sood, A.; Campen, M.J.; Zychowski, K.E. Metal-Induced Pulmonary Fibrosis. Curr. Environ. Health Rep. 2018, 5, 486–498. [Google Scholar] [CrossRef]
- Wang, P.; Xiao, T.; Li, J.; Wang, D.; Sun, J.; Cheng, C.; Ma, H.; Xue, J.; Li, Y.; Zhang, A.; et al. miR-21 in EVs from pulmonary epithelial cells promotes myofibroblast differentiation via glycolysis in arsenic-induced pulmonary fibrosis. Environ. Pollut. 2021, 286, 117259. [Google Scholar] [CrossRef]
- Shi, T.; Denney, L.; An, H.; Ho, L.P.; Zheng, Y. Alveolar and lung interstitial macrophages: Definitions, functions, and roles in lung fibrosis. J. Leukoc. Biol. 2021, 110, 107–114. [Google Scholar] [CrossRef]
- Gordon, S.; Taylor, P.R. Monocyte and macrophage heterogeneity. Nat. Rev. Immunol. 2005, 5, 953–964. [Google Scholar] [CrossRef]
- Stein, M.; Keshav, S.; Harris, N.; Gordon, S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: A marker of alternative immunologic macrophage activation. J. Exp. Med. 1992, 176, 287–292. [Google Scholar] [CrossRef] [Green Version]
- Biswas, S.K.; Mantovani, A. Macrophage plasticity and interaction with lymphocyte subsets: Cancer as a paradigm. Nat. Immunol. 2010, 11, 889–896. [Google Scholar] [CrossRef]
- Gordon, S. Alternative activation of macrophages. Nat. Rev. Immunol. 2003, 3, 23–35. [Google Scholar] [CrossRef]
- Mantovani, A.; Sica, A.; Sozzani, S.; Allavena, P.; Vecchi, A.; Locati, M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 2004, 25, 677–686. [Google Scholar] [CrossRef]
- Hackett, T.L. Epithelial-mesenchymal transition in the pathophysiology of airway remodelling in asthma. Curr. Opin. Allergy Clin. Immunol. 2012, 12, 53–59. [Google Scholar] [CrossRef]
- Rout-Pitt, N.; Farrow, N.; Parsons, D.; Donnelley, M. Epithelial mesenchymal transition (EMT): A universal process in lung diseases with implications for cystic fibrosis pathophysiology. Respir. Res. 2018, 19, 136. [Google Scholar] [CrossRef]
- Dai, J.; Xu, M.; Zhang, X.; Niu, Q.; Hu, Y.; Li, Y.; Li, S. Bi-directional regulation of TGF-β/Smad pathway by arsenic: A systemic review and meta-analysis of in vivo and in vitro studies. Life Sci. 2019, 220, 92–105. [Google Scholar] [CrossRef]
- Wang, W.; Zheng, F.; Zhang, A. Arsenic-induced lung inflammation and fibrosis in a rat model: Contribution of the HMGB1/RAGE, PI3K/AKT, and TGF-β1/SMAD pathways. Toxicol. Appl. Pharmacol. 2021, 432, 115757. [Google Scholar] [CrossRef]
- Chen, H.C.; Chiou, H.C.; Tsai, M.L.; Chen, S.C.; Lin, M.H.; Chuang, T.C.; Hung, C.H.; Kuo, C.H. Effects of Montelukast on Arsenic-Induced Epithelial-Mesenchymal Transition and the Role of Reactive Oxygen Species Production in Human Bronchial Epithelial Cells. Front. Pharmacol. 2022, 13, 877125. [Google Scholar] [CrossRef]
- Liu, Y.; Gao, W.; Zhang, D. Effects of cigarette smoke extract on A549 cells and human lung fibroblasts treated with transforming growth factor-beta1 in a coculture system. Clin. Exp. Med. 2010, 10, 159–167. [Google Scholar] [CrossRef]
- Weber, C.E.; Li, N.Y.; Wai, P.Y.; Kuo, P.C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J. Burn Care Res. 2012, 33, 311–318. [Google Scholar] [CrossRef]
- Hu, Y.; Li, J.; Lou, B.; Wu, R.; Wang, G.; Lu, C.; Wang, H.; Pi, J.; Xu, Y. The Role of Reactive Oxygen Species in Arsenic Toxicity. Biomolecules 2020, 10, 240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanida, I.; Ueno, T.; Kominami, E. LC3 conjugation system in mammalian autophagy. Int. J. Biochem. Cell Biol. 2004, 36, 2503–2518. [Google Scholar] [CrossRef] [PubMed]
- Pickles, S.; Vigié, P.; Youle, R.J. Mitophagy and Quality Control Mechanisms in Mitochondrial Maintenance. Curr. Biol. 2018, 28, R170–R185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pickrell, A.M.; Youle, R.J. The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease. Neuron 2015, 85, 257–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larson-Casey, J.L.; Deshane, J.S.; Ryan, A.J.; Thannickal, V.J.; Carter, A.B. Macrophage Akt1 Kinase-Mediated Mitophagy Modulates Apoptosis Resistance and Pulmonary Fibrosis. Immunity 2016, 44, 582–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuivenhoven, M.; Mason, K. Arsenic Toxicity; StatPearls Publishing: Treasure Island, FL, USA, 2022. [Google Scholar]
- Liao, W.T.; Lan, C.C.; Lee, C.H.; Yu, H.S. Concentration-dependent cellular responses of arsenic in keratinocytes. Kaohsiung J. Med. Sci. 2011, 27, 390–395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, C.H.; Wu, S.B.; Hong, C.H.; Liao, W.T.; Wu, C.Y.; Chen, G.S.; Wei, Y.H.; Yu, H.S. Aberrant cell proliferation by enhanced mitochondrial biogenesis via mtTFA in arsenical skin cancers. Am. J. Pathol. 2011, 178, 2066–2076. [Google Scholar] [CrossRef] [Green Version]
- Gandhi, D.; Bhandari, S.; Mishra, S.; Tiwari, R.R.; Rajasekaran, S. Non-malignant respiratory illness associated with exposure to arsenic compounds in the environment. Environ. Toxicol. Pharmacol. 2022, 94, 103922. [Google Scholar] [CrossRef]
- Dutta, K.; Prasad, P.; Sinha, D. Chronic low level arsenic exposure evokes inflammatory responses and DNA damage. Int. J. Hyg. Environ. Health 2015, 218, 564–574. [Google Scholar] [CrossRef]
- Peters, B.A.; Liu, X.; Hall, M.N.; Ilievski, V.; Slavkovich, V.; Siddique, A.B.; Alam, S.; Islam, T.; Graziano, J.H.; Gamble, M.V. Arsenic exposure, inflammation, and renal function in Bangladeshi adults: Effect modification by plasma glutathione redox potential. Free Radic. Biol. Med. 2015, 85, 174–182. [Google Scholar] [CrossRef]
- Milton, A.H.; Hasan, Z.; Rahman, A.; Rahman, M. Non-cancer effects of chronic arsenicosis in Bangladesh: Preliminary results. J. Environ. Sci. Health Part A Toxic/Hazard. Subst. Environ. Eng. 2003, 38, 301–305. [Google Scholar] [CrossRef]
- Milton, A.H.; Rahman, M. Respiratory effects and arsenic contaminated well water in Bangladesh. Int. J. Environ. Health Res. 2002, 12, 175–179. [Google Scholar] [CrossRef]
- Mazumder, D.N.; Steinmaus, C.; Bhattacharya, P.; von Ehrenstein, O.S.; Ghosh, N.; Gotway, M.; Sil, A.; Balmes, J.R.; Haque, R.; Hira-Smith, M.M.; et al. Bronchiectasis in persons with skin lesions resulting from arsenic in drinking water. Epidemiology 2005, 16, 760–765. [Google Scholar] [CrossRef]
- Tsai, T.L.; Lei, W.T.; Kuo, C.C.; Sun, H.L.; Su, P.H.; Wang, S.L. Maternal and childhood exposure to inorganic arsenic and airway allergy—A 15-Year birth cohort follow-up study. Environ. Int. 2021, 146, 106243. [Google Scholar] [CrossRef]
- Olivas-Calderón, E.; Recio-Vega, R.; Gandolfi, A.J.; Lantz, R.C.; González-Cortes, T.; Gonzalez-De Alba, C.; Froines, J.R.; Espinosa-Fematt, J.A. Lung inflammation biomarkers and lung function in children chronically exposed to arsenic. Toxicol. Appl. Pharmacol. 2015, 287, 161–167. [Google Scholar] [CrossRef] [Green Version]
- Farzan, S.F.; Li, Z.; Korrick, S.A.; Spiegelman, D.; Enelow, R.; Nadeau, K.; Baker, E.; Karagas, M.R. Infant Infections and Respiratory Symptoms in Relation to in Utero Arsenic Exposure in a U.S. Cohort. Environ. Health Perspect. 2016, 124, 840–847. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, S.M.; Branscum, A.; Welch, B.M.; Megowan, M.; Bethel, J.W.; Odden, M.C.; Joya, S.A.; Ibn Hasan, M.O.S.; Lin, P.I.; Mostofa, G.; et al. A prospective cohort study of in utero and early childhood arsenic exposure and infectious disease in 4- to 5-year-old Bangladeshi children. Environ. Epidemiol. 2020, 4, e086. [Google Scholar] [CrossRef]
- Cui, J.; Xu, W.; Chen, J.; Li, H.; Dai, L.; Frank, J.A.; Peng, S.; Wang, S.; Chen, G. M2 polarization of macrophages facilitates arsenic-induced cell transformation of lung epithelial cells. Oncotarget 2017, 8, 21398–21409. [Google Scholar] [CrossRef] [Green Version]
- Kajdaniuk, D.; Marek, B.; Borgiel-Marek, H.; Kos-Kudła, B. Transforming growth factor β1 (TGFβ1) in physiology and pathology. Endokrynol. Pol. 2013, 64, 384–396. [Google Scholar] [CrossRef] [Green Version]
- Camoretti-Mercado, B.; Solway, J. Transforming growth factor-beta1 and disorders of the lung. Cell Biochem. Biophys. 2005, 43, 131–148. [Google Scholar] [CrossRef]
- Abdelaziz, M.H.; Abdelwahab, S.F.; Wan, J.; Cai, W.; Wang, H.; Cheng, J.; Kumar, K.D.; Vasudevan, A.; Sadek, A.; Su, Z.; et al. Alternatively activated macrophages; a double-edged sword in allergic asthma. J. Transl. Med. 2020, 18, 58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, Y.; Li, Y.; Pang, Y.; Ling, M.; Shen, L.; Yang, X.; Zhang, J.; Zhou, J.; Wang, X.; Liu, Q. EMT and stem cell-like properties associated with HIF-2alpha are involved in arsenite-induced transformation of human bronchial epithelial cells. PLoS ONE 2012, 7, e37765. [Google Scholar]
- Jiang, J.; Wang, K.; Chen, Y.; Chen, H.; Nice, E.C.; Huang, C. Redox regulation in tumor cell epithelial-mesenchymal transition: Molecular basis and therapeutic strategy. Signal Transduct. Target. Ther. 2017, 2, 17036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Li, N.; Zhang, X.; Horng, T. Mitochondrial metabolism regulates macrophage biology. J. Biol. Chem. 2021, 297, 100904. [Google Scholar] [CrossRef] [PubMed]
- Gkikas, I.; Palikaras, K.; Tavernarakis, N. The Role of Mitophagy in Innate Immunity. Front. Immunol. 2018, 9, 1283. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.C.; Lin, Y.C.; Tsai, M.L.; Liao, W.T.; Hung, C.H. TSLP regulates mitochondrial ROS-induced mitophagy via histone modification in human monocytes. Cell Biosci. 2022, 12, 32. [Google Scholar] [CrossRef]
- Patoli, D.; Mignotte, F.; Deckert, V.; Dusuel, A.; Dumont, A.; Rieu, A.; Jalil, A.; Van Dongen, K.; Bourgeois, T.; Gautier, T.; et al. Inhibition of mitophagy drives macrophage activation and antibacterial defense during sepsis. J. Clin. Investig. 2020, 130, 5858–5874. [Google Scholar] [CrossRef]
- Tsai, M.L.; Tsai, Y.G.; Lin, Y.C.; Hsu, Y.L.; Chen, Y.T.; Tsai, M.K.; Liao, W.T.; Lin, Y.C.; Hung, C.H. IL-25 Induced ROS-Mediated M2 Macrophage Polarization via AMPK-Associated Mitophagy. Int. J. Mol. Sci. 2021, 23, 3. [Google Scholar] [CrossRef]
- Shin, W.H.; Park, J.H.; Chung, K.C. The central regulator p62 between ubiquitin proteasome system and autophagy and its role in the mitophagy and Parkinson’s disease. BMB Rep. 2020, 53, 56–63. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Dai, C.; Fan, Y.; Guo, B.; Ren, K.; Sun, T.; Wang, W. From autophagy to mitophagy: The roles of P62 in neurodegenerative diseases. J. Bioenerg. Biomembr. 2017, 49, 413–422. [Google Scholar] [CrossRef]
- Bjorkoy, G.; Lamark, T.; Pankiv, S.; Overvatn, A.; Brech, A.; Johansen, T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009, 452, 181–197. [Google Scholar]
- Chen, D.; Xie, J.; Fiskesund, R.; Dong, W.; Liang, X.; Lv, J.; Jin, X.; Liu, J.; Mo, S.; Zhang, T.; et al. Chloroquine modulates antitumor immune response by resetting tumor-associated macrophages toward M1 phenotype. Nat. Commun. 2018, 9, 873. [Google Scholar] [CrossRef]
- Auwerx, J. The human leukemia cell line, THP-1: A multifacetted model for the study of monocyte-macrophage differentiation. Experientia 1991, 47, 22–31. [Google Scholar] [CrossRef]
- Chanput, W.; Mes, J.J.; Savelkoul, H.F.; Wichers, H.J. Characterization of polarized THP-1 macrophages and polarizing ability of LPS and food compounds. Food Funct. 2013, 4, 266–276. [Google Scholar] [CrossRef]
- Liao, W.T.; Lu, J.H.; Lee, C.H.; Lan, C.E.; Chang, J.G.; Chai, C.Y.; Yu, H.S. An Interaction between Arsenic-Induced Epigenetic Modification and Inflammatory Promotion in a Skin Equivalent during Arsenic Carcinogenesis. J. Investig. Dermatol. 2017, 137, 187–196. [Google Scholar] [CrossRef]
Name | Primer Sequences | Amplicon Size (bp) | Tm |
---|---|---|---|
Human GAPDH-F | CCACTCCTCCACCTTTGAC | 101 | 53.2 |
Human GAPDH-R | ACCCTGTTGCTGTAGCCA | 101 | 50.3 |
Human ARG-1-F | TCATCTGGGTGGATGCTCACAC | 130 | 67.3 |
Human ARG-1-R | GAGAATCCTGGCACATCGGGAA | 130 | 67.4 |
Human iNOS-F | CGGTGCTGTATTTCCTTACGAGGCGAAGAAGG | 259 | 65.7 |
Human iNOS-R | GGTGCTGCTTGTTAGGAGGTCAAGTAAAGGGC | 259 | 65.7 |
Mouse-GAPDH | GTGTTCCTACCCCCAATGTGT | 247 | 65.2 |
Mouse-GAPDH | ATTGTCATACCAGGAAATGAGCTT | 247 | 63.6 |
Mouse-iNOS | ATGGACCAGTATAAGGCAAGC | 428 | 52.4 |
Mouse-iNOS | GCTCTGGATGAGCCTATATTG | 428 | 52.4 |
Mouse-Arg-1 | AGCACTGAGGAAAGCTGGTC | 111 | 65.2 |
Mouse-Arg-1 | CAGACCGTGGGTTCTTCACA | 111 | 65 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hung, C.-H.; Hsu, H.-Y.; Chiou, H.-Y.C.; Tsai, M.-L.; You, H.-L.; Lin, Y.-C.; Liao, W.-T.; Lin, Y.-C. Arsenic Induces M2 Macrophage Polarization and Shifts M1/M2 Cytokine Production via Mitophagy. Int. J. Mol. Sci. 2022, 23, 13879. https://doi.org/10.3390/ijms232213879
Hung C-H, Hsu H-Y, Chiou H-YC, Tsai M-L, You H-L, Lin Y-C, Liao W-T, Lin Y-C. Arsenic Induces M2 Macrophage Polarization and Shifts M1/M2 Cytokine Production via Mitophagy. International Journal of Molecular Sciences. 2022; 23(22):13879. https://doi.org/10.3390/ijms232213879
Chicago/Turabian StyleHung, Chih-Hsing, Hua-Yu Hsu, Hsin-Ying Clair Chiou, Mei-Lan Tsai, Huey-Ling You, Yu-Chih Lin, Wei-Ting Liao, and Yi-Ching Lin. 2022. "Arsenic Induces M2 Macrophage Polarization and Shifts M1/M2 Cytokine Production via Mitophagy" International Journal of Molecular Sciences 23, no. 22: 13879. https://doi.org/10.3390/ijms232213879