Mesenchymal Stem Cell-Derived Extracellular Vesicles as Proposed Therapy in a Rat Model of Cerebral Small Vessel Disease
Abstract
1. Introduction
2. Results
2.1. MSC and MSC-Derived EV Characterization
2.2. MSC-EVs Accumulate in Cortices of SBH/y-DS
2.3. MSC-EVs Impact Anti-Inflammatory Response In Vitro
2.4. Uncovering Mechanisms of MSC-EV Treatment In Vivo
2.5. MSC-EVs Alleviate Clinical Features and Cognitive Deficits of SBH/y-DS
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.1.1. Primary Culture of Human Adipose-Derived Mesenchymal Stem Cells
4.1.2. Lipopolysaccharide (LPS)-Induced Microglia Activation
4.2. Extracellular Vesicle (EV) Isolation
4.3. Flow Cytometry
4.3.1. MSC Characterization
4.3.2. EV Characterization
4.4. Nanoparticle Tracking Analysis (NTA)
4.5. Transmission Electron Microscopy (TEM)
4.6. Multiplex Surface Marker Analysis
4.7. Animals
Experimental Design and Induction of Hypertension
4.8. EV Labeling
4.9. Histological Staining
4.10. Immunohistochemistry
4.11. Microscopy and Image Analysis
4.12. Neurological Deficit Scoring
4.13. Novel Object Recognition (NOR) Test
4.14. RNA Extraction
4.15. RNA Libraries Preparation and Sequencing
4.16. RNA-Seq Bioinformatics Analysis
4.17. Gene Set Enrichment Analysis (GSEA)
4.18. Real-Time PCR
4.19. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wardlaw, J.M.; Smith, C.; Dichgans, M. Mechanisms of sporadic cerebral small vessel disease: Insights from neuroimaging. Lancet Neurol. 2013, 12, 483–497. [Google Scholar] [CrossRef]
- Cuadrado-Godia, E.; Dwivedi, P.; Sharma, S.; Santiago, A.O.; Gonzalez, J.R.; Balcells, M.; Laird, J.; Turk, M.; Suri, H.S.; Nicolaides, A.; et al. Cerebral small vessel disease: A review focusing on pathophysiology, biomarkers, and machine learning strategies. J. Stroke 2018, 20, 302–320. [Google Scholar] [CrossRef] [PubMed]
- Pires, P.W.; Ramos, C.M.D.; Matin, N.; Dorrance, A.M. The effects of hypertension on the cerebral circulation. Am. J. Physiol.-Heart Circ. Physiol. 2013, 304, H1598. [Google Scholar] [CrossRef] [PubMed]
- Song, K.; Li, Y.; Zhang, H.; An, N.; Wei, Y.; Wang, L.; Tian, C.; Yuan, M.; Sun, Y.; Xing, Y.; et al. Oxidative Stress-Mediated Blood-Brain Barrier (BBB) Disruption in Neurological Diseases. Oxid. Med. Cell. Longev. 2020, 2020, 4356386. [Google Scholar] [CrossRef]
- Shindo, A.; Ishikawa, H.; Ii, Y.; Niwa, A.; Tomimoto, H. Clinical Features and Experimental Models of Cerebral Small Vessel Disease. Front. Aging Neurosci. 2020, 12, 109. [Google Scholar] [CrossRef]
- Pantoni, L. Cerebral small vessel disease: From pathogenesis and clinical characteristics to therapeutic challenges. Lancet Neurol. 2010, 9, 689–701. [Google Scholar] [CrossRef]
- Li, Y.; Cui, Y.; Yang, J.J.; Zhang, Z.G.; Chopp, M. Systemic administration of exosomes released from mesenchymal stromal cells promote functional recovery and neurovascular plasticity after stroke in rats. J. Cereb. Blood Flow Metab. 2013, 33, 1711–1715. [Google Scholar]
- Woith, E.; Fuhrmann, G.; Melzig, M.F. Extracellular Vesicles—Connecting Kingdoms. Int. J. Mol. Sci. 2019, 20, 5695. [Google Scholar] [CrossRef]
- Herrmann, I.K.; Wood, M.J.A.; Fuhrmann, G. Extracellular vesicles as a next-generation drug delivery platform. Nat. Nanotechnol. 2021, 16, 748–759. [Google Scholar] [CrossRef]
- Guy, R.; Offen, D. Promising opportunities for treating neurodegenerative diseases with mesenchymal stem cell-derived exosomes. Biomolecules 2020, 10, 1320. [Google Scholar] [CrossRef]
- Herman, S.; Fishel, I.; Offen, D. Intranasal delivery of mesenchymal stem cells-derived extracellular vesicles for the treatment of neurological diseases. Stem Cells 2021, 39, 1589–1600. [Google Scholar] [CrossRef] [PubMed]
- Betzer, O.; Perets, N.; Angel, A.; Motiei, M.; Sadan, T.; Yadid, G.; Offen, D.; Popovtzer, R. In Vivo Neuroimaging of Exosomes Using Gold Nanoparticles. ACS Nano 2017, 11, 10883–10893. [Google Scholar] [CrossRef]
- Perets, N.; Betzer, O.; Shapira, R.; Brenstein, S.; Angel, A.; Sadan, T.; Ashery, U.; Popovtzer, R.; Offen, D. Golden Exosomes Selectively Target Brain Pathologies in Neurodegenerative and Neurodevelopmental Disorders. Nano Lett. 2019, 19, 3422–3431. [Google Scholar] [CrossRef] [PubMed]
- Izadpanah, M.; Dargahi, L.; Ai, J.; Taei, A.A.; Barough, S.E.; Mowla, S.J.; TavoosiDana, G.; Farahmandfar, M. Extracellular Vesicles as a Neprilysin Delivery System Memory Improvement in Alzheimer’s Disease. Iran. J. Pharm. Res. 2020, 19, 45–60. [Google Scholar] [PubMed]
- Burrello, J.; Monticone, S.; Gai, C.; Gomez, Y.; Kholia, S.; Camussi, G. Stem Cell-Derived Extracellular Vesicles and Immune-Modulation. Front. Cell Dev. Biol. 2016, 4, 83. [Google Scholar] [CrossRef] [PubMed]
- Xin, H.; Li, Y.; Buller, B.; Katakowski, M.; Zhang, Y.; Wang, X.; Shang, X.; Zhang, Z.G.; Chopp, M. Exosome-mediated transfer of miR-133b from multipotent mesenchymal stromal cells to neural cells contributes to neurite outgrowth. Stem Cells 2012, 30, 1556–1564. [Google Scholar] [CrossRef] [PubMed]
- Pusic, A.D.; Kraig, R.P. Youth and environmental enrichment generate serum exosomes containing miR-219 that promote CNS myelination. Glia 2014, 62, 284–299. [Google Scholar] [CrossRef]
- Xin, H.; Katakowski, M.; Wang, F.; Qian, J.Y.; Liu, X.S.; Ali, M.M.; Buller, B.; Zhang, Z.G.; Chopp, M. MicroRNA cluster miR-17-92 Cluster in Exosomes Enhance Neuroplasticity and Functional Recovery after Stroke in Rats. Stroke 2017, 48, 747–753. [Google Scholar] [CrossRef]
- Cheng, X.; Zhang, G.; Zhang, L.; Hu, Y.; Zhang, K.; Sun, X.; Zhao, C.; Li, H.; Li, Y.M.; Zhao, J. Mesenchymal stem cells deliver exogenous miR-21 via exosomes to inhibit nucleus pulposus cell apoptosis and reduce intervertebral disc degeneration. J. Cell. Mol. Med. 2018, 22, 261–276. [Google Scholar] [CrossRef]
- Wang, X.; Gu, H.; Qin, D.; Yang, L.; Huang, W.; Essandoh, K.; Wang, Y.; Caldwell, C.C.; Peng, T.; Zingarelli, B.; et al. Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci. Rep. 2015, 5, 13721. [Google Scholar] [CrossRef]
- Xia, C.; Zeng, Z.; Fang, B.; Tao, M.; Gu, C.; Zheng, L.; Wang, Y.; Shi, Y.; Fang, C.; Mei, S.; et al. Mesenchymal stem cell-derived exosomes ameliorate intervertebral disc degeneration via anti-oxidant and anti-inflammatory effects. Free Radic. Biol. Med. 2019, 143, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Narbute, K.; Piļipenko, V.; Pupure, J.; Dzirkale, Z.; Jonavičė, U.; Tunaitis, V.; Kriaučiūnaitė, K.; Jarmalavičiūtė, A.; Jansone, B.; Kluša, V.; et al. Intranasal Administration of Extracellular Vesicles Derived from Human Teeth Stem Cells Improves Motor Symptoms and Normalizes Tyrosine Hydroxylase Expression in the Substantia Nigra and Striatum of the 6-Hydroxydopamine-Treated Rats. Stem Cells Transl. Med. 2019, 8, 490–499. [Google Scholar] [CrossRef] [PubMed]
- Guy, R.; Volkman, R.; Wilczynski, E.; Yagil, C.; Yagil, Y.; Findler, M.; Auriel, E.; Nevo, U.; Offen, D. A Novel Rodent Model of Hypertensive Cerebral Small Vessel Disease with White Matter Hyperintensities and Peripheral Oxidative Stress. Int. J. Mol. Sci. 2022, 23, 5915. [Google Scholar] [CrossRef] [PubMed]
- Koliha, N.; Wiencek, Y.; Heider, U.; Jüngst, C.; Kladt, N.; Krauthäuser, S.; Johnston, I.C.D.; Bosio, A.; Schauss, A.; Wild, S. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles. J. Extracell. Vesicles 2016, 5, 29975. [Google Scholar] [CrossRef]
- Guo, S.; Perets, N.; Betzer, O.; Ben-Shaul, S.; Sheinin, A.; Michaelevski, I.; Popovtzer, R.; Offen, D.; Levenberg, S. Intranasal Delivery of Mesenchymal Stem Cell Derived Exosomes Loaded with Phosphatase and Tensin Homolog siRNA Repairs Complete Spinal Cord Injury. ACS Nano 2019, 13, 10015–10028. [Google Scholar] [CrossRef]
- Huang, M.-Y.; Tu, C.-E.; Wang, S.-C.; Hung, Y.-L.; Su, C.-C.; Fang, S.-H.; Chen, C.-S.; Liu, P.-L.; Cheng, W.-C.; Huang, Y.-W.; et al. Corylin inhibits LPS-induced inflammatory response and attenuates the activation of NLRP3 inflammasome in microglia. BMC Complement. Altern. Med. 2018, 18, 221. [Google Scholar] [CrossRef]
- Fu, Y.; Yan, Y. Emerging Role of Immunity in Cerebral Small Vessel Disease. Front. Immunol. 2018, 9, 67. [Google Scholar] [CrossRef]
- Sconocchia, T.; Sconocchia, G. Regulation of the Immune System in Health and Disease by Members of the Bone Morphogenetic Protein Family. Front. Immunol. 2021, 12, 5208. [Google Scholar] [CrossRef]
- Seo, W.; Shimizu, K.; Kojo, S.; Okeke, A.; Kohwi-Shigematsu, T.; Fujii, S.-I.; Taniuchi, I. Runx-mediated regulation of CCL5 via antagonizing two enhancers influences immune cell function and anti-tumor immunity. Nat. Commun. 2020, 11, 1562. [Google Scholar] [CrossRef]
- Barnabei, L.; Laplantine, E.; Mbongo, W.; Rieux-Laucat, F.; Weil, R. NF-κB: At the Borders of Autoimmunity and Inflammation. Front. Immunol. 2021, 12, 3169. [Google Scholar] [CrossRef]
- Chen, B.; Van Winkle, J.A.; Lyden, P.D.; Brown, J.H.; Purcell, N.H. PHLPP1 gene deletion protects the brain from ischemic injury. J. Cereb. Blood Flow Metab. 2013, 33, 196–204. [Google Scholar] [CrossRef] [PubMed]
- Kubota, M.; Yoshida, Y.; Kobayashi, E.; Matsutani, T.; Li, S.-Y.; Zhang, B.-S.; Mine, S.; Machida, T.; Takizawa, H.; Hiwasa, T.; et al. Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction. Sci. Rep. 2021, 11, 21772. [Google Scholar] [CrossRef]
- Filipek, A.; Leśniak, W. S100A6 and Its Brain Ligands in Neurodegenerative Disorders. Int. J. Mol. Sci. 2020, 21, 3979. [Google Scholar] [CrossRef] [PubMed]
- Hunter, A.; Hatcher, J.; Virley, D.; Nelson, P.; Irving, E.; Hadingham, S.; Parsons, A. Functional assessments in mice and rats after focal stroke. Neuropharmacology 2000, 39, 806–816. [Google Scholar] [CrossRef]
- Morad, G.; Carman, C.V.; Hagedorn, E.J.; Perlin, J.R.; Zon, L.I.; Mustafaoglu, N.; Park, T.-E.; Ingber, D.E.; Daisy, C.C.; Moses, M.A. Tumor-Derived Extracellular Vesicles Breach the Intact Blood-Brain Barrier via Transcytosis. ACS Nano 2019, 13, 13853–13865. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, J.; Ma, B.; Li, N.; Wang, S.; Sun, Z.; Xue, C.; Han, Q.; Wei, J.; Zhao, R.C. MSC-derived exosomes promote recovery from traumatic brain injury via microglia/macrophages in rat. Aging 2020, 12, 18274–18296. [Google Scholar] [CrossRef]
- Kodali, M.; Castro, O.W.; Kim, D.-K.; Thomas, A.; Shuai, B.; Attaluri, S.; Upadhya, R.; Gitai, D.; Madhu, L.N.; Prockop, D.J.; et al. Intranasally Administered Human MSC-Derived Extracellular Vesicles Pervasively Incorporate into Neurons and Microglia in both Intact and Status Epilepticus Injured Forebrain. Int. J. Mol. Sci. 2020, 21, 181. [Google Scholar] [CrossRef]
- Lankford, K.L.; Arroyo, E.J.; Nazimek, K.; Bryniarski, K.; Askenase, P.W.; Kocsis, J.D. Intravenously delivered mesenchymal stem cell-derived exosomes target M2-type macrophages in the injured spinal cord. PLoS ONE 2018, 13, e0190358. [Google Scholar] [CrossRef]
- Xu, R.; Bai, Y.; Min, S.; Xu, X.; Tang, T.; Ju, S. In Vivo Monitoring and Assessment of Exogenous Mesenchymal Stem Cell-Derived Exosomes in Mice with Ischemic Stroke by Molecular Imaging. Int. J. Nanomed. 2020, 15, 9011–9023. [Google Scholar] [CrossRef]
- Zhou, W.; Fong, M.Y.; Min, Y.; Somlo, G.; Liu, L.; Palomares, M.R.; Yu, Y.; Chow, A.; O’Connor, S.T.F.; Chin, A.R.; et al. Cancer-secreted miR-105 destroys vascular endothelial barriers to promote metastasis. Cancer Cell 2014, 25, 501–515. [Google Scholar] [CrossRef]
- Li, Z.; Liu, F.; He, X.; Yang, X.; Shan, F.; Feng, J. Exosomes derived from mesenchymal stem cells attenuate inflammation and demyelination of the central nervous system in EAE rats by regulating the polarization of microglia. Int. Immunopharmacol. 2019, 67, 268–280. [Google Scholar] [CrossRef] [PubMed]
- Riazifar, M.; Mohammadi, M.R.; Pone, E.J.; Yeri, A.; Lässer, C.; Segaliny, A.I.; McIntyre, L.L.; Shelke, G.V.; Hutchins, E.; Hamamoto, A.; et al. Stem Cell-Derived Exosomes as Nanotherapeutics for Autoimmune and Neurodegenerative Disorders. ACS Nano 2019, 13, 6670–6688. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Gan, Y.; Xu, G.; Yin, G.; Liu, D. MSCs-Derived Exosomes Attenuate Acute Brain Injury and Inhibit Microglial Inflammation by Reversing CysLT2R-ERK1/2 Mediated Microglia M1 Polarization. Neurochem. Res. 2020, 45, 1180–1190. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.-H.; Chen, C.-H.; Wallace, C.G.; Yuen, C.-M.; Kao, G.-S.; Chen, Y.-L.; Shao, P.-L.; Chen, Y.-L.; Chai, H.-T.; Lin, K.-C.; et al. Intravenous administration of xenogenic adipose-derived mesenchymal stem cells (ADMSC) and ADMSC-derived exosomes markedly reduced brain infarct volume and preserved neurological function in rat after acute ischemic stroke. Oncotarget 2016, 7, 74537–74556. [Google Scholar] [CrossRef] [PubMed]
- Doeppner, T.R.; Herz, J.; Görgens, A.; Schlechter, J.; Ludwig, A.-K.; Radtke, S.; de Miroschedji, K.; Horn, P.A.; Giebel, B.; Hermann, D.M. Extracellular Vesicles Improve Post-Stroke Neuroregeneration and Prevent Postischemic Immunosuppression. Stem Cells Transl. Med. 2015, 4, 1131–1143. [Google Scholar] [CrossRef]
- Li, C.; Fei, K.; Tian, F.; Gao, C.; Song, Y. Adipose-derived mesenchymal stem cells attenuate ischemic brain injuries in rats by modulating miR-21-3p/MAT2B signaling transduction. Croat. Med. J. 2019, 60, 439–448. [Google Scholar] [CrossRef]
- Ni, H.; Yang, S.; Siaw-Debrah, F.; Hu, J.; Wu, K.; He, Z.; Yang, J.; Pan, S.; Lin, X.; Ye, H.; et al. Exosomes Derived From Bone Mesenchymal Stem Cells Ameliorate Early Inflammatory Responses Following Traumatic Brain Injury. Front. Neurosci. 2019, 13, 14. [Google Scholar] [CrossRef]
- Sisa, C.; Kholia, S.; Naylor, J.; Sanchez, M.B.H.; Bruno, S.; Deregibus, M.C.; Camussi, G.; Inal, J.; Lange, S.; Hristova, M. Mesenchymal stromal cell derived extracellular vesicles reduce hypoxia-ischaemia induced perinatal injury. Front. Physiol. 2019, 10, 282. [Google Scholar] [CrossRef]
- Ding, M.; Shen, Y.; Wang, P.; Xie, Z.; Xu, S.; Zhu, Z.; Wang, Y.; Lyu, Y.; Wang, D.; Xu, L.; et al. Exosomes Isolated From Human Umbilical Cord Mesenchymal Stem Cells Alleviate Neuroinflammation and Reduce Amyloid-Beta Deposition by Modulating Microglial Activation in Alzheimer’s Disease. Neurochem. Res. 2018, 43, 2165–2177. [Google Scholar] [CrossRef]
- Hassan, R.; Rabea, A.A.; Ragae, A.; Sabry, D. The prospective role of mesenchymal stem cells exosomes on circumvallate taste buds in induced Alzheimer’s disease of ovariectomized albino rats: (Light and transmission electron microscopic study). Arch. Oral Biol. 2020, 110, 104596. [Google Scholar] [CrossRef]
- Drommelschmidt, K.; Serdar, M.; Bendix, I.; Herz, J.; Bertling, F.; Prager, S.; Keller, M.; Ludwig, A.-K.; Duhan, V.; Radtke, S.; et al. Mesenchymal stem cell-derived extracellular vesicles ameliorate inflammation-induced preterm brain injury. Brain. Behav. Immun. 2017, 60, 220–232. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chopp, M.; Meng, Y.; Katakowski, M.; Xin, H.; Mahmood, A.; Xiong, Y. Effect of exosomes derived from multipluripotent mesenchymal stromal cells on functional recovery and neurovascular plasticity in rats after traumatic brain injury. J. Neurosurg. 2015, 122, 856–867. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Huang, Y.; Cai, W.; Chen, X.; Men, X.; Lu, T.; Wu, A.; Lu, Z. Age-related cerebral small vessel disease and inflammaging. Cell Death Dis. 2020, 11, 932. [Google Scholar] [CrossRef]
- Low, A.; Mak, E.; Rowe, J.B.; Markus, H.S.; O’Brien, J.T. Inflammation and cerebral small vessel disease: A systematic review. Ageing Res. Rev. 2019, 53, 100916. [Google Scholar] [CrossRef] [PubMed]
- Bath, P.M.; Wardlaw, J.M. Pharmacological Treatment and Prevention of Cerebral Small Vessel Disease: A Review of Potential Interventions. Int. J. Stroke 2015, 10, 469–478. [Google Scholar] [CrossRef]
- Song, Y.; Dou, H.; Li, X.; Zhao, X.; Li, Y.; Liu, D.; Ji, J.; Liu, F.; Ding, L.; Ni, Y.; et al. Exosomal miR-146a Contributes to the Enhanced Therapeutic Efficacy of Interleukin-1β-Primed Mesenchymal Stem Cells Against Sepsis. Stem Cells 2017, 35, 1208–1221. [Google Scholar] [CrossRef] [PubMed]
- Araña, M.; Mazo, M.; Aranda, P.; Pelacho, B.; Prosper, F. Adipose tissue-derived mesenchymal stem cells: Isolation, expansion, and characterization. Methods Mol. Biol. 2013, 1036, 47–61. [Google Scholar]
- Théry, C.; Amigorena, S.; Raposo, G.; Clayton, A. Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids. Curr. Protoc. Cell Biol. 2006, 30, 3–22. [Google Scholar] [CrossRef]
- Yagil, C.; Katni, G.; Rubattu, S.; Stolpe, C.; Kreutz, R.; Lindpaintner, K.; Ganten, D.; Ben-Ishay, D.; Yagil, Y. Development, genotype and phenotype of a new colony of the Sabra hypertension prone (SBH/y) and resistant (SBN/y) rat model of slat sensitivity and resistance. J. Hypertens. 1996, 14, 1175–1182. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Xing, Y.; Yu, T.; Wu, Y.N.; Roy, M.; Kim, J.; Lee, C. An expectation-maximization algorithm for probabilistic reconstructions of full-length isoforms from splice graphs. Nucleic Acids Res. 2006, 34, 3150–3160. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
Specie | Gene | Sequence |
---|---|---|
Mouse | CASP1 | Fw: TGTGACTTGGAGGACATTTTCAG Rev: GGTCACCCTATCAGCAGTGG |
Mouse | CCL3 | Fw: GTACCATGACACTCTGCAACC Rev: GTCAGGAAAATGACACCTGGC |
Mouse | GAPDH | Fw: CATGGCCTTCCGTGTTCCTA Rev: CTGGTCCTCAGTGTAGCCCAA |
Mouse | IL1β | Fw: GGAGAACCAAGCAACGACAAAATA Rev: TGGGAACTCTGCAGACTCAAAC |
Mouse | IL6 | Fw: ATGGATGCTACCAAACTGGAT Rev: TGAAGGACTCTGGCTTTGTCT |
Rat | AIF1 | Fw: AGCCCAACAGGAAGAGAGGT Rev: TGCTGTACTTGGGATCATCG |
Rat | BMP7 | Fw: ATAATTCGGCGCCCATGTTC Rev: AAACCGGAACTCTCGATGGT |
Rat | CCL5 | Fw: TGCCCACGTGAAGGAGTATT Rev: ACTTCTTCTCTGGGTTGGCA |
Rat | GAPDH | Fw: GGTGCTGAGTATGTCGTGGA Rev: CGGAGATGATGACCCTTTTG |
Rat | GFAP | Fw: GGTGGAGAGGGACAATCTCA Rev: CAGCCTCAGGTTGGTTTCAT |
Rat | NFκB | Fw: AAAATATTCACCTGCACGCCC Rev: ATCCGTGCTTCCAGTGTTTC |
Rat | PHLPP1 | Fw: ACACATGGCTTATAACCGGC Rev: TGGTTGTTGGGATGGCTTTC |
Rat | S100A6 | Fw: TCTTCCACAAGTACTCTGGCA Rev: TGTTACGGTCCAGATCATCCA |
Rat | SERPINE1 | Fw: AGGCCTCCAAAGACCGAAAT Rev: TGAAGAAGTGGGGCATGAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guy, R.; Herman, S.; Benyamini, H.; Ben-Zur, T.; Kobo, H.; Pasmanik-Chor, M.; Yaacobi, D.; Barel, E.; Yagil, C.; Yagil, Y.; et al. Mesenchymal Stem Cell-Derived Extracellular Vesicles as Proposed Therapy in a Rat Model of Cerebral Small Vessel Disease. Int. J. Mol. Sci. 2022, 23, 11211. https://doi.org/10.3390/ijms231911211
Guy R, Herman S, Benyamini H, Ben-Zur T, Kobo H, Pasmanik-Chor M, Yaacobi D, Barel E, Yagil C, Yagil Y, et al. Mesenchymal Stem Cell-Derived Extracellular Vesicles as Proposed Therapy in a Rat Model of Cerebral Small Vessel Disease. International Journal of Molecular Sciences. 2022; 23(19):11211. https://doi.org/10.3390/ijms231911211
Chicago/Turabian StyleGuy, Reut, Shay Herman, Hadar Benyamini, Tali Ben-Zur, Hila Kobo, Metsada Pasmanik-Chor, Dafna Yaacobi, Eric Barel, Chana Yagil, Yoram Yagil, and et al. 2022. "Mesenchymal Stem Cell-Derived Extracellular Vesicles as Proposed Therapy in a Rat Model of Cerebral Small Vessel Disease" International Journal of Molecular Sciences 23, no. 19: 11211. https://doi.org/10.3390/ijms231911211
APA StyleGuy, R., Herman, S., Benyamini, H., Ben-Zur, T., Kobo, H., Pasmanik-Chor, M., Yaacobi, D., Barel, E., Yagil, C., Yagil, Y., & Offen, D. (2022). Mesenchymal Stem Cell-Derived Extracellular Vesicles as Proposed Therapy in a Rat Model of Cerebral Small Vessel Disease. International Journal of Molecular Sciences, 23(19), 11211. https://doi.org/10.3390/ijms231911211