Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Knockout of HERV-K env Gene in Human Colorectal Cancer Cell Lines
2.2. HERV-K env KO Reduced Tumorigenic Characteristics Including Proliferation, Invasion, Migration, and Tumor Colonization in DLD-1 Colorectal Cancer Cells
2.3. HERV-K env KO Reduced Tumor Growth in the In Vivo Xenograft Models
2.4. Next-Generation Sequencing (NGS) for Analysis of Gene Expression Profile
2.5. The Effect of NUPR1 on DLD-1 Colorectal Cancer Cells
2.6. The Effect of HERV-K env KO on Reactive Oxygen Species (ROS) Generation and Protein Expression Levels Involved in Apoptosis, Autophagy, and ER Stress
2.7. Confirmation of the Effect of HERV-K env KO on HCT116 Colorectal Cancer
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. Generation of Knockout Cell Line with CRISPR-Cas9
4.3. Plasmid Construct for Over-Expression
4.4. RT-PCR and Genomic PCR
4.5. Western Blot Analysis
4.6. Invasion and Migration Assays
4.7. Soft-Agar Colonogenic Assay
4.8. Cell Viability Assay
4.9. Immunofluorescence (IF) and Immunohistochemistry (IHC)
4.10. Tumor Xenograft Assays
4.11. RNA-Seq Data Analysis
4.12. Flow Cytometry Analysis for Measurement Generation of ROS
4.13. si RNA of NUPR1
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
Abbreviations
HERV | human endogenous retrovirus |
HERV-K | HML-2 |
Env | envelope |
ROS | reactive oxygen species |
NUPR1 | nuclear protein-1 |
KO | knockout |
KD | knockdown |
NGS | next generation sequencing |
FC | fold change |
CRC | colorectal cancer |
siRNA | Small interfering RNA |
References
- Belshaw, R.; Pereira, V.; Katzourakis, A.; Talbot, G.; Paces, J.; Burt, A.; Tristem, M. Long-term reinfection of the human genome by endogenous retroviruses. Proc. Natl. Acad. Sci. USA 2004, 101, 4894–4899. [Google Scholar] [CrossRef] [PubMed]
- Belshaw, R.; Dawson, A.L.; Woolven-Allen, J.; Redding, J.; Burt, A.; Tristem, M. Genomewide Screening Reveals High Levels of Insertional Polymorphism in the Human Endogenous Retrovirus Family HERV-K(HML2): Implications for Present-Day Activity. J. Virol. 2005, 79, 12507–12514. [Google Scholar] [CrossRef]
- Hohn, O.; Hanke, K.; Bannert, N. HERV-K(HML-2), the Best Preserved Family of HERVs: Endogenization, Expression, and Implications in Health and Disease. Front. Oncol. 2013, 3, 246. [Google Scholar] [CrossRef] [PubMed]
- Flockerzi, A.; Ruggieri, A.; Frank, O.; Sauter, M.; Maldener, E.; Kopper, B.; Wullich, B.; Seifarth, W.; Muller-Lantzsch, N.; Leib-Mosch, C.; et al. Expression patterns of transcribed human endogenous retrovirus HERV-K(HML-2) loci in human tissues and the need for a HERV Transcriptome Project. BMC Genom. 2008, 9, 354. [Google Scholar] [CrossRef]
- Hanke, K.; Hohn, O.; Bannert, N. HERV-K(HML-2), a seemingly silent subtenant—But still waters run deep. Apmis 2016, 124, 67–87. [Google Scholar] [CrossRef]
- Boller, K.; Schonfeld, K.; Lischer, S.; Fischer, N.; Hoffmann, A.; Kurth, R.; Tonjes, R.R. Human endogenous retrovirus HERV-K113 is capable of producing intact viral particles. J. Gen. Virol. 2008, 89, 567–572. [Google Scholar] [CrossRef]
- Ruprecht, K.; Ferreira, H.; Flockerzi, A.; Wahl, S.; Sauter, M.; Mayer, J.; Mueller-Lantzsch, N. Human Endogenous Retrovirus Family HERV-K(HML-2) RNA Transcripts Are Selectively Packaged into Retroviral Particles Produced by the Human Germ Cell Tumor Line Tera-1 and Originate Mainly from a Provirus on Chromosome 22q11.21. J. Virol. 2008, 82, 10008–10016. [Google Scholar] [CrossRef] [PubMed]
- Wang-Johanning, F.; Rycaj, K.; Plummer, J.B.; Li, M.; Yin, B.; Frerich, K.; Garza, J.G.; Shen, J.; Lin, K.; Yan, P.; et al. Immunotherapeutic Potential of Anti-Human Endogenous Retrovirus-K Envelope Protein Antibodies in Targeting Breast Tumors. J. Natl. Cancer Inst. 2012, 104, 189–210. [Google Scholar] [CrossRef]
- Wang-Johanning, F.; Li, M.; Esteva, F.J.; Hess, K.R.; Yin, B.; Rycaj, K.; Plummer, J.B.; Garza, J.G.; Ambs, S.; Johanning, G.L. Human endogenous retrovirus type K antibodies and mRNA as serum biomarkers of early-stage breast cancer. Int. J. Cancer 2014, 134, 587–595. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Rycaj, K.; Geng, S.; Li, M.; Plummer, J.B.; Yin, B.; Liu, H.; Xu, X.; Zhang, Y.; Yan, Y.; et al. Expression of Human Endogenous Retrovirus Type K Envelope Protein is a Novel Candidate Prognostic Marker for Human Breast Cancer. Genes Cancer 2011, 2, 914–922. [Google Scholar] [CrossRef]
- Ishida, T.; Obata, Y.; Ohara, N.; Matsushita, H.; Sato, S.; Uenaka, A.; Saika, T.; Miyamura, T.; Chayama, K.; Nakamura, Y.; et al. Identification of the HERV-K gag antigen in prostate cancer by SEREX using autologous patient serum and its immunogenicity. Cancer Immun. 2008, 8, 15. [Google Scholar] [PubMed]
- Hahn, S.; Ugurel, S.; Hanschmann, K.M.; Strobel, H.; Tondera, C.; Schadendorf, D.; Lower, J.; Lower, R. Serological Response to Human Endogenous Retrovirus K in Melanoma Patients Correlates with Survival Probability. AIDS Res. Hum. Retrovir. 2008, 24, 717–723. [Google Scholar] [CrossRef] [PubMed]
- Wang-Johanning, F.; Liu, J.; Rycaj, K.; Huang, M.; Tsai, K.; Rosen, D.G.; Chen, D.T.; Lu, D.W.; Barnhart, K.F.; Johanning, G.L. Expression of multiple human endogenous retrovirus surface envelope proteins in ovarian cancer. Int. J. Cancer 2007, 120, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Iramaneerat, K.; Rattanatunyong, P.; Khemapech, N.; Triratanachat, S.; Mutirangura, A. HERV-K Hypomethylation in Ovarian Clear Cell Carcinoma is Associated with a Poor Prognosis and Platinum Resistance. Int. J. Gyn. Cancer 2011, 21, 51–57. [Google Scholar] [CrossRef]
- Curty, G.; Marston, J.L.; Rougvie, M.D.M.; Leal, F.E.; Nixon, D.F.; Soares, M.A. Human Endogenous Retrovirus K in Cancer: A Potential Biomarker and Immunotherapeutic Target. Viruses 2020, 12. [Google Scholar] [CrossRef] [PubMed]
- Jo, J.O.; Kang, Y.J.; Ock, M.S.; Song, K.S.; Jeong, M.J.; Jeong, S.J.; Choi, Y.H.; Ko, E.J.; Leem, S.H.; Kim, S.; et al. Expression profiles of HERV-K Env protein in normal and cancerous tissues. Genes Genom. 2016, 98, 91–107. [Google Scholar] [CrossRef]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Radvanyi, L.; Yin, B.; Rycaj, K.; Li, J.; Chivukula, R.; Lin, K.; Lu, Y.; Shen, J.; Chang, D.Z.; et al. Downregulation of Human Endogenous Retrovirus Type K (HERV-K) Viral env RNA in Pancreatic Cancer Cells Decreases Cell Proliferation and Tumor Growth. Clin. Cancer Res. 2017, 23, 5892–5911. [Google Scholar] [CrossRef]
- Zhou, F.; Li, M.; Wei, Y.; Lin, K.; Lu, Y.; Shen, J.; Johanning, G.L.; Wang-Johanning, F. Activation of HERV-K Env protein is essential for tumorigenesis and metastasis of breast cancer cells. Oncotarget 2016, 7, 84093–84117. [Google Scholar] [CrossRef] [PubMed]
- Mallo, G.V.; Fiedler, F.; Calvo, E.L.; Ortiz, E.M.; Vasseur, S.; Keim, V.; Morisset, J.; Iovanna, J.L. loning and Expression of the Rat p8 cDNA, a New Gene Activated in Pancreas during the Acute Phase of Pancreatitis, Pancreatic Development, and Regeneration, and Which Promotes Cellular Growth. J. Biol. Chem. 1997, 272, 32360–32369. [Google Scholar] [CrossRef]
- Santofimia-Castano, P.; Lan, W.; Bintz, J.; Gayet, O.; Carrier, A.; Lomberk, G.; Neira, J.L.; Gonzalez, A.; Urrutia, R.; Soubeyran, P.; et al. Inactivation of NUPR1 promotes cell death by coupling ER-stress responses with necrosis. Sci. Rep. 2018, 8, 16999. [Google Scholar] [CrossRef]
- Cai, D.; Huang, E.; Luo, B.; Yang, Y.; Zhang, F.; Liu, C.; Lin, Z.; Xie, W.B.; Wang, H. Nupr1/Chop signal axis is involved in mitochondrion-related endothelial cell apoptosis induced by methamphetamine. Cell Death Dis. 2016, 7, e2161. [Google Scholar] [CrossRef]
- Emma, M.R.; Iovanna, J.L.; Bachvarov, D.; Puleio, R.; Loria, G.R.; Augello, G.; Candido, S.; Libra, M.; Gulino, A.; Cancila, V.; et al. NUPR1, a new target in liver cancer: Implication in controlling cell growth, migration, invasion and sorafenib resistance. Cell Death Dis. 2016, 7, e2269. [Google Scholar] [CrossRef]
- Li, J.; Ren, S.; Liu, Y.; Lian, Z.; Dong, B.; Yao, Y.; Xu, Y. Knockdown of NUPR1 inhibits the proliferation of glioblastoma cells via ERK1/2, p38 MAPK and caspase-3. J. Neuro Oncol. 2017, 132, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Cano, C.E.; Hamidi, T.; Sandi, M.J.; Iovanna, J.L. Nupr1: The Swiss-knife of cancer. J. Cell. Physiol. 2011, 226, 1439–1443. [Google Scholar] [CrossRef] [PubMed]
- Hamidi, T.; Cano, C.E.; Grasso, D.; Garcia, M.N.; Sandi, M.J.; Calvo, E.L.; Dagorn, J.C.; Lomberk, G.; Urrutia, R.; Goruppi, S.; et al. Nupr1-Aurora Kinase A Pathway Provides Protection against Metabolic Stress-Mediated Autophagic-Associated Cell Death. Clin. Cancer Res. 2012, 18, 5234–5246. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Zeng, W.; Ouyang, W.; Xu, Q.; Chen, J.; Wang, B.; Zhang, X. Quercetin induced NUPR1-dependent autophagic cell death by disturbing reactive oxygen species homeostasis in osteosarcoma cells. J. Clin. Biochem. Nutr. 2020, 67, 137–145. [Google Scholar] [CrossRef] [PubMed]
- Tavakolian, S.; Goudarzi, H.; Faghihloo, E. Evaluating the expression level of HERV-K env, np9, rec and gag in breast tissue. Infect. Agents Cancer 2019, 14, 42. [Google Scholar] [CrossRef] [PubMed]
- Jo, J.O.; Kim, S.R.; Bae, M.K.; Kang, Y.J.; Ock, M.S.; Kleinman, H.K.; Cha, H.J. Thymosin beta4 induces the expression of vascular endothelial growth factor (VEGF) in a hypoxia-inducible factor (HIF)-1alpha-dependent manner. Biochim. Biophys. Acta 2010, 1803, 1244–1251. [Google Scholar] [CrossRef] [PubMed]
- Grasso, D.; Garcia, M.N.; Hamidi, T.; Cano, C.; Calvo, E.; Lomberk, G.; Urrutia, R.; Iovanna, J.L. Genetic inactivation of the pancreatitis-inducible gene Nupr1 impairs PanIN formation by modulating Kras(G12D)-induced senescence. Cell Death Differ. 2014, 21, 1633–1641. [Google Scholar] [CrossRef] [PubMed]
- Cha, H.J.; Jeong, M.J.; Kleinman, H.K. Role of Thymosin β4 in Tumor Metastasis and Angiogenesis. J. Natl. Cancer Inst. 2003, 95, 1674–1680. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.J.; Jo, J.O.; Ock, M.S.; Chang, H.K.; Baek, K.W.; Lee, J.R.; Choi, Y.H.; Kim, W.J.; Leem, S.H.; Kim, H.S.; et al. Human ERV3-1 env protein expression in various human tissues and tumours. J. Clin. Pathol. 2013. [Google Scholar] [CrossRef] [PubMed]
HERV | Chromosomal Position (hg19) | Reverse Sequence 5′–3′ | Product Size (bp) |
---|---|---|---|
K101 | chr22:18,926,187–18,935,361 | TTCTTTCAAAATAATCCATGACTGG | 1480 |
K102 | chr1:155,596,457–155,605,636 | CATCTGAAAGGAGAACATAGGAGTG | 1444 |
K107 | chr5:156,084,717–156,093,896 | ATGCCTATGATCCCAGCACTTT | 1578 |
K109 | chr6:78,426,662–78,436,083 | GATGTCAAGCAAGGTAGAAAATGAT | 1455 |
K115 | chr8:7,355,397–7,364,859 | TCATTTAAAATTGTCTTCTCCATCC | 1594 |
K117 | chr3:185,280,336–185,289,515 | TTCCATGCCTTAGTTTAACAGGTAG | 1196 |
K119 | chr12:58,721,197–58,722,612 | TGACCCCTGTCACTCTAGTAA AACT | 1416 |
Case | Sample Name | Raw Data | Ensemble 72 (23,362 Coding Genes) Homo sapiens | ||
---|---|---|---|---|---|
Expressed Genes (FPKM > 0) | Unexpressed Genes | ||||
1 | Mock | CON | 69,280,600 | 17,135 | 6227 |
2 | HERV-K Env+ | POE (Positive − overexpressed) | 51,232,816 | 16,523 | 6839 |
3 | HERV-K Env- | NKO (Negative − knockout) | 65,934,080 | 17,216 | 6146 |
Target Gene | Fold Change (/CON) | Classification | Raw Data (FPKM) | |
---|---|---|---|---|
nupr1 | K env KO | 0.174 | Down –regulation | 285 |
K env Overexpression | 1.793 | Up-regulation | 2269 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ko, E.-J.; Ock, M.-S.; Choi, Y.-H.; Iovanna, J.L.; Mun, S.; Han, K.; Kim, H.-S.; Cha, H.-J. Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells. Int. J. Mol. Sci. 2021, 22, 3941. https://doi.org/10.3390/ijms22083941
Ko E-J, Ock M-S, Choi Y-H, Iovanna JL, Mun S, Han K, Kim H-S, Cha H-J. Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells. International Journal of Molecular Sciences. 2021; 22(8):3941. https://doi.org/10.3390/ijms22083941
Chicago/Turabian StyleKo, Eun-Ji, Mee-Sun Ock, Yung-Hyun Choi, Juan L. Iovanna, Seyoung Mun, Kyudong Han, Heui-Soo Kim, and Hee-Jae Cha. 2021. "Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells" International Journal of Molecular Sciences 22, no. 8: 3941. https://doi.org/10.3390/ijms22083941
APA StyleKo, E.-J., Ock, M.-S., Choi, Y.-H., Iovanna, J. L., Mun, S., Han, K., Kim, H.-S., & Cha, H.-J. (2021). Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells. International Journal of Molecular Sciences, 22(8), 3941. https://doi.org/10.3390/ijms22083941