Three Novel Bacteria Associated with Two Centric Diatom Species from the Mediterranean Sea, Thalassiosira rotula and Skeletonema marinoi
Abstract
:1. Introduction
2. Results
2.1. Sequencing, Assembly, Binning and Classification of MAGs
2.2. Analysis of MAG Secondary Metabolite Gene Clusters
2.3. Ectoine Quantification in Xenic T. rotula Cultures
2.4. Verification of MAG Association with Diatoms
2.5. MAG-Diatom Association Type and Temporal Variation
2.6. MAG Antibiotic Tolerance
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Strain Information and Culturing
5.2. Ectoine Quantification by UPLC-MS/MS
5.3. DNA Extraction and Sequencing
5.4. Metagenome Sequencing, Assembly, Binning and Annotation
5.5. SA and FL Bacterial Fractions Separation
5.6. Reintroduction of Bacteria in T. rotula FE80 Cultures
5.7. Cl-1, Cl-2 and Cl-8 Growth Characterization
5.8. Liquid Bacterial Cultures
5.9. Solid Media Culturing
5.10. DNA Extraction, Primer Design and PCR
5.11. Quantitative PCR Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Amin, S.A.; Parker, M.S.; Armbrust, E.V. Interactions between Diatoms and Bacteria. Microbiol. Mol. Biol. Rev. 2012, 76, 667–684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amin, S.; Hmelo, L.R.; Van Tol, H.M.; Durham, B.P.; Carlson, L.T.; Heal, K.R.; Morales, R.L.; Berthiaume, C.T.; Parker, M.S.; Djunaedi, B.; et al. Interaction and signalling between a cosmopolitan phytoplankton and associated bacteria. Nature 2015, 522, 98–101. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lewitus, A.J.; Brown, P.; Wilde, S.B. Growth-promoting effects of a bacterium on raphidophytes and other phytoplankton. Harmful Algae 2007, 7, 1–10. [Google Scholar] [CrossRef]
- Sison-Mangus, M.P.; Jiang, S.; Tran, K.N.; Kudela, R.M. Host-specific adaptation governs the interaction of the marine diatom, Pseudo-nitzschia and their microbiota. ISME J. 2013, 8, 63–76. [Google Scholar] [CrossRef] [Green Version]
- Grossart, H.P.; Kiørboe, T.; Tang, K.W.; Allgaier, M.; Yam, E.M.; Ploug, H. Interactions between marine snow and heterotrophic bacteria: Aggregate formation and microbial dynamics. Aquat. Microb. Ecol. 2006, 42, 19–26. [Google Scholar] [CrossRef] [Green Version]
- Gärdes, A.; Iversen, M.H.; Grossart, H.-P.; Passow, U.; Ullrich, M.S. Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J. 2010, 5, 436–445. [Google Scholar] [CrossRef] [PubMed]
- Field, C.B.; Behrenfeld, M.J.; Randerson, J.T.; Falkowski, P. Primary Production of the Biosphere: Integrating Terrestrial and Oceanic Components. Science 1998, 281, 237–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Armbrust, E.V. The life of diatoms in the world’s oceans. Nature 2009, 459, 185–192. [Google Scholar] [CrossRef]
- Malviya, S.; Scalco, E.; Audic, S.; Vincent, F.; Veluchamy, A.; Poulain, J.; Wincker, P.; Iudicone, D.; de Vargas, C.; Bittner, L.; et al. Insights into global diatom distribution and diversity in the world’s ocean. Proc. Natl. Acad. Sci. USA 2016, 113, E1516–E1525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grossart, H.-P.; Czub, G.; Simon, M. Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environ. Microbiol. 2006, 8, 1074–1084. [Google Scholar] [CrossRef] [PubMed]
- Croft, M.T.; Lawrence, A.D.; Raux-Deery, E.; Warren, M.J.; Smith, A.G. Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature 2005, 438, 90–93. [Google Scholar] [CrossRef] [PubMed]
- Amin, S.A.; Green, D.H.; Hart, M.C.; Kupper, F.C.; Sunda, W.G.; Carrano, C.J. Photolysis of iron-siderophore chelates promotes bacterial-algal mutualism. Proc. Natl. Acad. Sci. USA 2009, 106, 17071–17076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grossart, H.-P.; Levold, F.; Allgaier, M.; Simon, M.; Brinkhoff, T. Marine diatom species harbour distinct bacterial communities. Environ. Microbiol. 2005, 7, 860–873. [Google Scholar] [CrossRef] [PubMed]
- Mönnich, J.; Tebben, J.; Bergemann, J.; Case, R.; Wohlrab, S.; Harder, T. Niche-based assembly of bacterial consortia on the diatom Thalassiosira rotula is stable and reproducible. ISME J. 2020, 14, 1614–1625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Majzoub, M.E.; Beyersmann, P.G.; Simon, M.; Thomas, T.; Brinkhoff, T.; Egan, S. Phaeobacter inhibens controls bacterial community assembly on a marine diatom. FEMS Microbiol. Ecol. 2019, 95. [Google Scholar] [CrossRef] [PubMed]
- Teeling, H.; Fuchs, B.M.; Becher, D.; Klockow, C.; Gardebrecht, A.; Bennke, C.M.; Kassabgy, M.; Huang, S.; Mann, A.J.; Waldmann, J.; et al. Substrate-Controlled Succession of Marine Bacterioplankton Populations Induced by a Phytoplankton Bloom. Science 2012, 336, 608–611. [Google Scholar] [CrossRef] [PubMed]
- Dittmann, K.K.; Sonnenschein, E.C.; Egan, S.; Gram, L.; Bentzon-Tilia, M. Impact of Phaeobacter inhibens on marine eukaryote-associated microbial communities. Environ. Microbiol. Rep. 2018, 11, 401–413. [Google Scholar] [CrossRef] [Green Version]
- Quigley, K.M.; Roa, C.A.; Torda, G.; Bourne, D.G.; Willis, B.L. Co-dynamics of Symbiodiniaceae and bacterial populations during the first year of symbiosis with Acropora tenuis juveniles. MicrobiologyOpen 2019, 9, e959. [Google Scholar] [CrossRef] [PubMed]
- Egan, S.; Thomas, T.; Kjelleberg, S. Unlocking the diversity and biotechnological potential of marine surface associated microbial communities. Curr. Opin. Microbiol. 2008, 11, 219–225. [Google Scholar] [CrossRef] [PubMed]
- Guedes, A.C.; Amaro, H.M.; Malcata, F.X. Microalgae as sources of high added-value compounds-a brief review of recent work. Biotechnol. Prog. 2011, 27, 597–613. [Google Scholar] [CrossRef] [PubMed]
- Trindade, M.; van Zyl, L.J.; Navarro-Fernández, J.; AbdElrazak, A. Targeted metagenomics as a tool to tap into marine natural product diversity for the discovery and production of drug candidates. Front. Microbiol. 2015, 6, 890. [Google Scholar] [CrossRef] [PubMed]
- Lindequist, U. Marine-Derived Pharmaceuticals—Challenges and Opportunities. Biomol. Ther. 2016, 24, 561–571. [Google Scholar] [CrossRef] [Green Version]
- Krawiec, R.W. Autecology and clonal variability of the marine centric diatom Thalassiosira rotula (Bacillariophyceae) in response to light, temperature and salinity. Mar. Biol. 1982, 69, 79–89. [Google Scholar] [CrossRef]
- Di Dato, V.; Di Costanzo, F.; Barbarinaldi, R.; Perna, A.; Ianora, A.; Romano, G. Unveiling the presence of biosynthetic pathways for bioactive compounds in the Thalassiosira rotula transcriptome. Sci. Rep. 2019, 9, 9893. [Google Scholar] [CrossRef] [PubMed]
- Ianora, A.; Poulet, S.A.; Miralto, A.; Grottoli, R. The diatom Thalassiosira rotula affects reproductive success in the copepod Acartia clausi. Mar. Biol. 1996, 125, 279–286. [Google Scholar] [CrossRef]
- Qin, J.G.; D’Antignana, T.; Zhang, W.; Franco, C. Discovery of antimicrobial activities of a marine diatom Thalassiosira rotula. Afr. J. Microbiol. Res. 2013, 7, 5687–5696. [Google Scholar] [CrossRef] [Green Version]
- Garcia, N.S.; Yung, C.-M.; Davis, K.M.; Rynearson, T.; Hunt, D.E. Draft genome sequences of three bacterial isolates from cultures of the marine diatom Thalassiosira rotula. Genome Announc. 2017, 5, e00316-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grossart, H.-P.; Simon, M. Interactions of planktonic algae and bacteria: Effects on algal growth and organic matter dynamics. Aquat. Microb. Ecol. 2007, 47, 163–176. [Google Scholar] [CrossRef] [Green Version]
- Lin, H.-H.; Liao, Y.-C. Accurate binning of metagenomic contigs via automated clustering sequences using information of genomic signatures and marker genes. Sci. Rep. 2016, 6, 24175. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Won, S.-M.; Kim, H.; Park, D.-S.; Yoon, J.-H. Aestuariivita boseongensis gen. nov., sp. nov., isolated from a tidal flat sediment. Int. J. Syst. Evol. Microbiol. 2014, 64, 2969–2974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamalanathan, M.; Chiu, M.-H.; Bacosa, H.; Schwehr, K.; Tsai, S.-M.; Doyle, S.; Yard, A.; Mapes, S.; Vasequez, C.; Bretherton, L.; et al. Role of polysaccharides in diatom Thalassiosira pseudonana and its associated bacteria in hydrocarbon presence. Plant Physiol. 2019, 180, 1898–1911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinnaka, A.K.; Tanuku, N.R.S. The family cyclobacteriaceae. In The Prokaryotes: Other Major Lineages of Bacteria and the Archaea; Rosenberg, E., DeLong, E.F., Lory, S., Stackebrandt, E., Thompson, F., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 551–575. ISBN 978-3-642-38954-2. [Google Scholar]
- Chaumeil, P.-A.; Mussig, A.J.; Hugenholtz, P.; Parks, D.H. GTDB-Tk: A toolkit to classify genomes with the genome taxonomy database. Bioinformatics 2019, 36, 1925–1927. [Google Scholar] [CrossRef] [PubMed]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST server: Rapid Annotations using Subsystems Technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [Green Version]
- Shoguchi, E.; Shinzato, C.; Kawashima, T.; Gyoja, F.; Mungpakdee, S.; Koyanagi, R.; Takeuchi, T.; Hisata, K.; Tanaka, M.; Fujiwara, M.; et al. Draft assembly of the Symbiodinium minutum nuclear genome reveals dinoflagellate gene structure. Curr. Biol. 2013, 23, 1399–1408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parks, D.H.; Rinke, C.; Chuvochina, M.; Chaumeil, P.-A.; Woodcroft, B.J.; Evans, P.N.; Hugenholtz, P.; Tyson, G.W. Recovery of nearly 8,000 metagenome-assembled genomes substantially expands the tree of life. Nat. Microbiol. 2017, 2, 1533–1542. [Google Scholar] [CrossRef] [PubMed]
- Skinnider, M.A.; Merwin, N.J.; Johnston, C.W.; Magarvey, N.A. PRISM 3: Expanded prediction of natural product chemical structures from microbial genomes. Nucleic Acids Res. 2017, 45, W49–W54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blin, K.; Shaw, S.; Steinke, K.; Villebro, R.; Ziemert, N.; Lee, S.Y.; Medema, M.H.; Weber, T. antiSMASH 5.0: Updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 2019, 47, W81–W87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guillard, R.R.L. Culture of phytoplankton for feeding marine invertebrates. In Culture of Marine Invertebrate Animals: Proceedings —1st Conference on Culture of Marine Invertebrate Animals Greenport; Smith, W.L., Chanley, M.H., Eds.; Springer US: Boston, MA, USA, 1975; pp. 29–60. ISBN 978-1-4615-8714-9. [Google Scholar]
- Windler, M.; Tsymbal, D.; Kryvenda, A.; Straile, D.; Gruber, A.; Kroth, P. Influence of bacteria on cell size development and morphology of cultivated diatoms. Phycol. Res. 2014, 62, 269–281. [Google Scholar] [CrossRef] [Green Version]
- Cirri, E.; Vyverman, W.; Pohnert, G. Biofilm interactions—bacteria modulate sexual reproduction success of the diatom Seminavis robusta. FEMS Microbiol. Ecol. 2018, 94. [Google Scholar] [CrossRef] [PubMed]
- Behringer, G.; Ochsenkühn, M.A.; Fei, C.; Fanning, J.; Koester, J.A.; Amin, S.A. Bacterial communities of diatoms display strong conservation across strains and time. Front. Microbiol. 2018, 9, 659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García-López, M.; Meier-Kolthoff, J.P.; Tindall, B.J.; Gronow, S.; Woyke, T.; Kyrpides, N.C.; Hahnke, R.L.; Göker, M. Analysis of 1,000 type-strain genomes improves taxonomic classification of Bacteroidetes. Front. Microbiol. 2019, 10, 2083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, G.; Lai, Q.; Du, Y.; Liu, X.; Sun, F.; Shao, Z. Aestuariivita atlantica sp. nov., isolated from deep-sea sediment. Int. J. Syst. Evol. Microbiol. 2015, 65, 3281–3285. [Google Scholar] [CrossRef]
- Wirth, J.S.; Whitman, W.B. Phylogenomic analyses of a clade within the Roseobacter group suggest taxonomic reassignments of species of the genera Aestuariivita, Citreicella, Loktanella, Nautella, Pelagibaca, Ruegeria, Thalassobius, Thiobacimonas and Tropicibacter, and the proposal of six novel genera. Int. J. Syst. Evol. Microbiol. 2018, 68, 2393–2411. [Google Scholar] [CrossRef] [PubMed]
- Olsen, J.D.; Martin, E.C.; Hunter, C.N. The PufX quinone channel enables the light-harvesting 1 antenna to bind more carotenoids for light collection and photoprotection. FEBS Lett. 2017, 591, 573–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qian, P.; Martin, E.C.; Ng, I.W.; Hunter, C.N. The C-terminus of PufX plays a key role in dimerisation and assembly of the reaction center light-harvesting 1 complex from Rhodobacter sphaeroides. Biochim. Biophys. Acta Bioenerg. 2017, 1858, 795–803. [Google Scholar] [CrossRef] [PubMed]
- Branduardi, P.; Sauer, M. Microbial carbon dioxide fixation: New tricks for an old game. FEMS Microbiol. Lett. 2017, 365. [Google Scholar] [CrossRef] [PubMed]
- Tomasch, J.; Gohl, R.; Bunk, B.; Diez, M.S.; Wagner-Döbler, I. Transcriptional response of the photoheterotrophic marine bacterium Dinoroseobacter shibae to changing light regimes. ISME J. 2011, 5, 1957–1968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imhoff, J.F.; Rahn, T.; Künzel, S.; Neulinger, S.C. Photosynthesis is widely distributed among Proteobacteria as demonstrated by the phylogeny of PufLM reaction center proteins. Front. Microbiol. 2018, 8, 2679. [Google Scholar] [CrossRef] [PubMed]
- Simon, M.; Scheuner, C.; Meier-Kolthoff, J.P.; Brinkhoff, T.; Wagner-Döbler, I.; Ulbrich, M.; Klenk, H.-P.; Schomburg, D.; Petersen, J.; Göker, M. Phylogenomics of Rhodobacteraceae reveals evolutionary adaptation to marine and non-marine habitats. ISME J. 2017, 11, 1483–1499. [Google Scholar] [CrossRef] [PubMed]
- Sunagawa, S.; Coelho, L.P.; Chaffron, S.; Kultima, J.R.; Labadie, K.; Salazar, G.; Djahanschiri, B.; Zeller, G.; Mende, D.R.; Alberti, A.; et al. Ocean Plankton. Structure and function of the global ocean microbiome. Science 2015, 348, 1261359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nedashkovskaya, O.I.; Kim, S.B.; Lysenko, A.M.; Park, M.S.; Mikhailov, V.V.; Bae, K.S.; Park, H.Y. Roseivirga echinicomitans sp. nov., a novel marine bacterium isolated from the sea urchin Strongylocentrotus intermedius, and emended description of the genus Roseivirga. Int. J. Syst. Evol. Microbiol. 2005, 55, 1797–1800. [Google Scholar] [CrossRef] [Green Version]
- Nedashkovskaya, O.I.; Kim, S.B.; Lee, D.H.; Lysenko, A.M.; Shevchenko, L.S.; Frolova, G.M.; Mikhailov, V.V.; Lee, K.H.; Bae, K.S. Roseivirga ehrenbergii gen. nov., sp. nov., a novel marine bacterium of the phylum ‘Bacteroidetes’, isolated from the green alga Ulva fenestrata. Int. J. Syst. Evol. Microbiol. 2005, 55, 231–234. [Google Scholar] [CrossRef] [Green Version]
- Lau, S.C.K.; Tsoi, M.M.Y.; Li, X.; Plakhotnikova, I.; Dobretsov, S.; Wu, M.; Wong, P.K.; Pawlik, J.R.; Qian, P.-Y. Description of Fabibacter halotolerans gen. nov., sp. nov. and Roseivirga spongicola sp. nov., and reclassification of [Marinicola] seohaensis as Roseivirga seohaensis comb. nov. Int. J. Syst. Evol. Microbiol. 2006, 56, 1059–1065. [Google Scholar] [CrossRef]
- Jung, Y.-T.; Park, S.; Lee, J.-S.; Yoon, J.-H. Roseivirga maritima sp. nov., isolated from seawater. Int. J. Syst. Evol. Microbiol. 2016, 66, 2664–2670. [Google Scholar] [CrossRef]
- Selvaratnam, C.; Thevarajoo, S.; Goh, K.M.; Chan, K.-G.; Chong, C.S. Proposal to reclassify Roseivirga ehrenbergii (Nedashkovskaya et al., 2008) as Roseivirga seohaensis comb. nov., description of Roseivirga seohaensis subsp. aquiponti subsp. nov. and emendation of the genus Roseivirga. Int. J. Syst. Evol. Microbiol. 2016, 66, 5537–5543. [Google Scholar] [CrossRef] [PubMed]
- Seymour, J.R.; Amin, S.A.; Raina, J.-B.; Stocker, R. Zooming in on the phycosphere: The ecological interface for phytoplankton–bacteria relationships. Nat. Microbiol. 2017, 2, 17065. [Google Scholar] [CrossRef] [PubMed]
- Suleiman, M.; Zecher, K.; Yücel, O.; Jagmann, N.; Philipp, B. Interkingdom cross-feeding of ammonium from marine methylamine-degrading bacteria to the diatom Phaeodactylum tricornutum. Appl. Environ. Microbiol. 2016, 82, 7113–7122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maryam, L.; Khan, A.U. A Mechanism of synergistic effect of streptomycin and cefotaxime on CTX-M-15 type β-lactamase producing strain of E. cloacae: A first report. Front. Microbiol. 2016, 7, 2007. [Google Scholar] [CrossRef] [PubMed]
- Graf, R.; Anzali, S.; Buenger, J.; Pfluecker, F.; Driller, H. The multifunctional role of ectoine as a natural cell protectant. Clin. Dermatol. 2008, 26, 326–333. [Google Scholar] [CrossRef] [PubMed]
- Pastor, J.M.; Salvador, M.; Argandoña, M.; Bernal, V.; Reina-Bueno, M.; Csonka, L.N.; Iborra, J.L.; Vargas, C.; Nieto, J.J.; Cánovas, M. Ectoines in cell stress protection: Uses and biotechnological production. Biotechnol. Adv. 2010, 28, 782–801. [Google Scholar] [CrossRef] [PubMed]
- Moghaieb, R.E.; Nakamura, A.; Saneoka, H.; Fujita, K. Evaluation of salt tolerance in ectoine-transgenic tomato plants (Lycopersicon esculentum) in terms of photosynthesis, osmotic adjustment, and carbon partitioning. GM Crop. 2011, 2, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Bownik, A.; Stępniewska, Z. Ectoine as a promising protective agent in humans and animals. Arh. Hig. Rada Toksikol. 2016, 67, 260–265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, A.D. Compatible solutes and extreme water stress in Eukaryotic micro-organisms. Adv. Microb. Physiol. 1978, 17, 181–242. [Google Scholar] [CrossRef]
- Kirst, G.O. Salinity tolerance of Eukaryotic marine algae. Annu. Rev. Plant Biol. 1990, 41, 21–53. [Google Scholar] [CrossRef]
- Pade, N.; Hagemann, M. Salt acclimation of Cyanobacteria and their application in biotechnology. Life 2015, 5, 25–49. [Google Scholar] [CrossRef]
- Empadinhas, N.; da Costa, M.S. Diversity, biological roles and biosynthetic pathways for sugar-glycerate containing compatible solutes in bacteria and archaea. Environ. Microbiol. 2011, 13, 2056–2077. [Google Scholar] [CrossRef]
- Sauer, T.; Galinski, E.A. Bacterial milking: A novel bioprocess for production of compatible solutes. Biotechnol. Bioeng. 1998, 57, 306–313. [Google Scholar] [CrossRef]
- Fenizia, S.; Thume, K.; Wirgenings, M.; Pohnert, G. Ectoine from bacterial and algal origin is a compatible solute in microalgae. Mar. Drugs 2020, 18, 42. [Google Scholar] [CrossRef] [Green Version]
- Vallet, M.; Kaftan, F.; Grabe, V.; Ghaderiardakani, F.; Fenizia, S.; Svatoš, A.; Pohnert, G.; Wichard, T. A new glance at the chemosphere of macroalgal–bacterial interactions: In situ profiling of metabolites in symbiosis by mass spectrometry. Beilstein J. Org. Chem. 2021, 17, 1313–1322. [Google Scholar] [CrossRef]
- Gerecht, A.; Romano, G.; Ianora, A.; D’Ippolito, G.; Cutignano, A.; Fontana, A. Plasticity of oxylipin metabolism among clones of the marine diatom Skeletonema marinoi (Bacillariophyceae). J. Phycol. 2011, 47, 1050–1056. [Google Scholar] [CrossRef] [PubMed]
- Parks, D.H.; Imelfort, M.; Skennerton, C.T.; Hugenholtz, P.; Tyson, G.W. CheckM: Assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015, 25, 1043–1055. [Google Scholar] [CrossRef] [Green Version]
- Seemann, T. Prokka: Rapid Prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
- Arkin, A.P.; Cottingham, R.W.; Henry, C.S.; Harris, N.L.; Stevens, R.L.; Maslov, S.; Dehal, P.; Ware, D.; Perez, F.; Canon, S.; et al. KBase: The United States Department of Energy systems biology knowledgebase. Nat. Biotechnol. 2018, 36, 566–569. [Google Scholar] [CrossRef] [Green Version]
- Bowers, R.M.; Kyrpides, N.C.; Stepanauskas, R.; Harmon-Smith, M.; Doud, D.; Reddy, T.B.K.; Schulz, F.; Jarett, J.; Rivers, A.R.; Eloe-Fadrosh, E.A.; et al. Minimum information about a single amplified genome (MISAG) and a metagenome-assembled genome (MIMAG) of bacteria and archaea. Nat. Biotechnol. 2017, 35, 725–731. [Google Scholar] [CrossRef] [Green Version]
- Laslett, D.; Canback, B. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Res. 2004, 32, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Sabatino, V.; Russo, M.T.; Patil, S.; D’Ippolito, G.; Fontana, A.; Ferrante, M.I. Establishment of genetic transformation in the sexually reproducing diatoms Pseudo-nitzschia multistriata and Pseudo-nitzschia arenysensis and inheritance of the transgene. Mar. Biotechnol. 2015, 17, 452–462. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hansen, M.C.; Tolker-Nielsen, T.; Givskov, M.; Molin, S. Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region. FEMS Microbiol. Ecol. 1998, 26, 141–149. [Google Scholar] [CrossRef]
- Reysenbach, A.L.; Pace, N.R. Reliable Amplification of Hyperthermophilic Archaeal 16S rRNA Genes by the Polymerase Chain Reaction; Robb F T Place R Archaea Cold; Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1995; pp. 101–105. [Google Scholar]
Parameter Type | Base Pairs |
---|---|
Total number of reads before trimming | 20,505,104 |
Total number of reads after trimming | 19,519,539 |
Average read length | 239.5 |
Number of reads in contigs | 17,286,414 |
Number of contigs >5 kb | 416 |
N50 (bp) | 146,992 |
Assembly size (Mb) | 22.15 |
Maximum contig length (bp) | 952,220 |
Cluster | Cl-1 | Cl-2 | Cl-8 |
---|---|---|---|
Completeness % | 97.66 | 99.57 | 99.05 |
Contamination % | 0.38 | 1.3 | 1.64 |
Number of contigs | 81 | 20 | 80 |
N50 (bp) | 98,035 | 327,203 | 346,266 |
Assembly size (Mb) | 4.78 | 3.74 | 8.57 |
Maximum contig length (bp) | 239,842 | 952,220 | 622,837 |
Average coverage | 633.5 | 66.6 | 31.6 |
Number of CDS | 4680 | 4101 | 7071 |
G + C% | 62 | 56 | 45 |
Number of tRNAs | 37 | 40 | 48 |
Cluster | Cl-1 | Cl-2 | Cl-8 |
---|---|---|---|
Phylum | Proteobacteria | Proteobacteria | Bacteroidota |
Family | Rhodobacteraceae | Parvibaculaceae | Cyclobacteriaceae |
Genus | Aestuariivita | Mf105b01 | Roseivirga_A |
Average Amino acid Identity (AAI) | 77.56% | 90.05% | 81.41% |
Cluster | Cl-1 | Cl-2 | Cl-8 | |
---|---|---|---|---|
PRISM | n° of Biosynthetic clusters | 7 | 1 | 3 |
Type of Biosynthetic clusters | PKS, NRPS, acyl homoserine lactone, ectoine | PKS | Lasso peptide, PKS, NRPS | |
antiSMASH | n° of Biosynthetic clusters | 9 | 1 | 8 |
Type of Biosynthetic clusters | NRPS, hserlactone, ectoine, terpenes, T1PKS, Bacteriocin | Bacteriocin | NRPS, T1PKS, T3PKS, bacteriocin, terpenes, beta lactone |
Primer Name | Forward Sequence | Reverse Sequence | Tm (°C) | Amplicon Length (bp) |
---|---|---|---|---|
C8_c608 | GCTCCAGTGTTTTAACCGG | CCATCTATTCTGCCGACC | 62.1/60.7 | 251 |
C8_c450 | TCGCCAATACTGATTATGCT | GTCGTAGTTCCTAAGGTCAC | 59.7/55.3 | 169 |
C1_c182 | CTGATCTGTTATATGATGCGGA | GACATGACAGTGATGCATTG | 61.3/60.2 | 161 |
C2_c82 | GTATCAATATCGGGCAGTGT | CGATATTCCAAATGTGAGCG | 58.9/63.0 | 243 |
E9F/U1510R (16s) | GAGTTTGATCCTGGCTCAG | GGCTTACCTTGTTACGACTT | 60/53.1 | 1500 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Costanzo, F.; Di Dato, V.; van Zyl, L.J.; Cutignano, A.; Esposito, F.; Trindade, M.; Romano, G. Three Novel Bacteria Associated with Two Centric Diatom Species from the Mediterranean Sea, Thalassiosira rotula and Skeletonema marinoi. Int. J. Mol. Sci. 2021, 22, 13199. https://doi.org/10.3390/ijms222413199
Di Costanzo F, Di Dato V, van Zyl LJ, Cutignano A, Esposito F, Trindade M, Romano G. Three Novel Bacteria Associated with Two Centric Diatom Species from the Mediterranean Sea, Thalassiosira rotula and Skeletonema marinoi. International Journal of Molecular Sciences. 2021; 22(24):13199. https://doi.org/10.3390/ijms222413199
Chicago/Turabian StyleDi Costanzo, Federica, Valeria Di Dato, Leonardo Joaquim van Zyl, Adele Cutignano, Francesco Esposito, Marla Trindade, and Giovanna Romano. 2021. "Three Novel Bacteria Associated with Two Centric Diatom Species from the Mediterranean Sea, Thalassiosira rotula and Skeletonema marinoi" International Journal of Molecular Sciences 22, no. 24: 13199. https://doi.org/10.3390/ijms222413199
APA StyleDi Costanzo, F., Di Dato, V., van Zyl, L. J., Cutignano, A., Esposito, F., Trindade, M., & Romano, G. (2021). Three Novel Bacteria Associated with Two Centric Diatom Species from the Mediterranean Sea, Thalassiosira rotula and Skeletonema marinoi. International Journal of Molecular Sciences, 22(24), 13199. https://doi.org/10.3390/ijms222413199