The Transcriptional Landscape and Hub Genes Associated with Physiological Responses to Drought Stress in Pinus tabuliformis
Abstract
1. Introduction
2. Results
2.1. Drought Impact on Photosynthesis and Physiological Indexes in P. tabuliformis
2.2. The Global Transcriptomic Response to Drought in P. tabuliformis
2.3. The Drought Responsive Mechanism Is Primarily Conserved between Chinese Pine and Arabidopsis
2.4. Differential Expression of Transcription Factors, Protein Kinases Families, and Transcriptional Regulators Involved in Drought Stress
2.5. Identification of Hub Genes Associated with Control, Drought Stress, and Recovery in Pinus tabuliformis
2.6. ABA Signaling Pathway and PtNCED3 Expression during Drought Stress
2.7. Validation of Transcripts by qRT-PCR
3. Discussion
4. Material and Methods
4.1. Plant Material and Drought Treatment
4.2. Measurement of Photosynthetic Parameters
4.3. Antioxidants Extraction
4.4. RNA Library Construction and RNA-Seq Analysis
4.5. Gene Regulatory Network Analysis
4.6. Validation of DEGs
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gupta, A.; Rico-Medina, A.; Caño-Delgado, A. The physiology of plant responses to drought. Science 2020, 368, 266–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madritsch, S.; Wischnitzki, E.; Kotrade, P.; Ashoub, A.; Burg, A.; Fluch, S.; Brüggemann, W.; Sehr, E.M. Elucidating drought stress tolerance in European oaks through cross-species transcriptomics. G3 Genes Genomes Genet. 2019, 9, 3181–3199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sacks, D.; Baxter, B.; Campbell, B.C.V.; Carpenter, J.S.; Cognard, C.; Dippel, D.; Eesa, M.; Fischer, U.; Hausegger, K.; Hirsch, J.A.; et al. Multisociety Consensus Quality Improvement Revised Consensus Statement for Endovascular Therapy of Acute Ischemic Stroke. Int. J. Stroke Off. J. Int. Stroke Soc. 2018, 13, 612–632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehschuh, R.; Cecilia, A.; Zuber, M.; Faragó, T.; Baumbach, T.; Hartmann, H.; Jansen, S.; Mayr, S.; Ruehr, N.K. Drought-induced xylem embolism limits the recovery of leaf gas exchange in Scots pine. Plant Physiol. 2020, 184, 852–864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jonsson, M.; Bengtsson, J.; Gamfeldt, L.; Moen, J.; Snäll, T. Levels of forest ecosystem services depend on specific mixtures of commercial tree species. Nat. Plants 2019, 5, 141–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fox, H.; Doron-Faigenboim, A.; Kelly, G.; Bourstein, R.; Attia, Z.; Zhou, J.; Moshe, Y.; Moshelion, M.; David-Schwartz, R. Transcriptome analysis of Pinus halepensis under drought stress and during recovery. Tree Physiol. 2018, 38, 423–441. [Google Scholar] [CrossRef] [Scilit]
- Cailleret, M.; Jansen, S.; Robert, E.M.; Desoto, L.; Aakala, T.; Antos, J.A.; Beikircher, B.; Bigler, C.; Bugmann, H.; Caccianiga, M. A synthesis of radial growth patterns preceding tree mortality. Glob. Chang. Biol. 2017, 23, 1675–1690. [Google Scholar] [CrossRef] [Scilit]
- Fracasso, A.; Trindade, L.M.; Amaducci, S. Drought stress tolerance strategies revealed by RNA-Seq in two sorghum genotypes with contrasting WUE. BMC Plant Biol. 2016, 16, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Rooney, W.L.; Blumenthal, J.; Bean, B.; Mullet, J.E. Designing sorghum as a dedicated bioenergy feedstock. Biofuels Bioprod. Biorefining 2007, 1, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Anderegg, W.R.; Klein, T.; Bartlett, M.; Sack, L.; Pellegrini, A.F.; Choat, B.; Jansen, S. Meta-analysis reveals that hydraulic traits explain cross-species patterns of drought-induced tree mortality across the globe. Proc. Natl. Acad. Sci. USA 2016, 113, 5024–5029. [Google Scholar] [CrossRef] [Scilit]
- Umebayashi, T.; Morita, T.; Utsumi, Y.; Kusumoto, D.; Yasuda, Y.; Haishi, T.; Fukuda, K. Spatial distribution of xylem embolisms in the stems of Pinus thunbergii at the threshold of fatal drought stress. Tree Physiol. 2016, 36, 1210–1218. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Li, G.; Sun, H.; Ma, L.; Guo, Y.; Zhao, Z.; Gao, H.; Mei, L. Effects of drought stress on photosynthesis and photosynthetic electron transport chain in young apple tree leaves. Biol. Open 2018, 7, bio035279. [Google Scholar] [CrossRef] [Scilit]
- Zenes, N.; Kerr, K.L.; Trugman, A.T.; Anderegg, W.R. Competition and drought alter optimal stomatal strategy in tree seedlings. Front. Plant Sci. 2020, 11, 478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polle, A.; Chen, S.L.; Eckert, C.; Harfouche, A. Engineering Drought Resistance in Forest Trees. Front. Plant Sci. 2018, 9, 1875. [Google Scholar] [CrossRef] [Scilit]
- Ali, Q.; Ashraf, M. Induction of drought tolerance in maize (Zea mays L.) due to exogenous application of trehalose: Growth, photosynthesis, water relations and oxidative defence mechanism. J. Agron. Crop Sci. 2011, 197, 258–271. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhang, R.; Ou, H.; Gui, Y.; Wei, J.; Zhou, H.; Tan, H.; Li, Y. Comprehensive transcriptome analysis reveals genes in response to water deficit in the leaves of Saccharum narenga (Nees ex Steud.) hack. BMC Plant Biol. 2018, 18, 250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noctor, G.; Mhamdi, A.; Foyer, C.H. The roles of reactive oxygen metabolism in drought: Not so cut and dried. Plant Physiol. 2014, 164, 1636–1648. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, S.; Murata, N. How do environmental stresses accelerate photoinhibition? Trends Plant Sci. 2008, 13, 178–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Y.; Guo, Y.; Liu, Y.; Zhang, F.; Wang, Z.; Wang, H.; Wang, F.; Li, D.; Mao, D.; Luan, S. 9-cis-Epoxycarotenoid dioxygenase 3 regulates plant growth and enhances multi-abiotic stress tolerance in rice. Front. Plant Sci. 2018, 9, 162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef] [Scilit]
- Cardoso, A.A.; Gori, A.; Da-Silva, C.J.; Brunetti, C. Abscisic acid biosynthesis and signaling in plants: Key targets to improve water use efficiency and drought tolerance. Appl. Sci. 2020, 10, 6322. [Google Scholar] [CrossRef] [Scilit]
- Lu, M.; Seeve, C.M.; Loopstra, C.A.; Krutovsky, K.V. Exploring the genetic basis of gene transcript abundance and metabolite levels in loblolly pine (Pinus taeda L.) using association mapping and network construction. BMC Genet. 2018, 19, 100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Zhou, Q.; Xu, J.; Li, Q.; Zhang, S. RNA interference of NtNCED3 reduces drought tolerance and impairs plant growth through feedback regulation of isoprenoids in Nicotiana tabacum. Environ. Exp. Bot. 2018, 155, 332–344. [Google Scholar] [CrossRef] [Scilit]
- Neale, D.B.; McGuire, P.E.; Wheeler, N.C.; Stevens, K.A.; Crepeau, M.W.; Cardeno, C.; Zimin, A.V.; Puiu, D.; Pertea, G.M.; Sezen, U.U. The Douglas-fir genome sequence reveals specialization of the photosynthetic apparatus in Pinaceae. G3: Genes Genomes Genet. 2017, 7, 3157–3167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, D.; Wu, W.; Abrams, S.R.; Cutler, A.J. The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors. J. Exp. Bot. 2008, 59, 2991–3007. [Google Scholar] [CrossRef] [Scilit]
- Baldoni, E.; Genga, A.; Cominelli, E. Plant MYB transcription factors: Their role in drought response mechanisms. Int. J. Mol. Sci. 2015, 16, 15811–15851. [Google Scholar] [CrossRef] [Scilit]
- Roy, S. Function of MYB domain transcription factors in abiotic stress and epigenetic control of stress response in plant genome. Plant Signal. Behav. 2016, 11, e1117723. [Google Scholar] [CrossRef] [Scilit]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit]
- Tiwari, S.; Prasad, V.; Chauhan, P.S.; Lata, C. Bacillus amyloliquefaciens confers tolerance to various abiotic stresses and modulates plant response to phytohormones through osmoprotection and gene expression regulation in rice. Front. Plant Sci. 2017, 8, 1510. [Google Scholar] [CrossRef] [Scilit]
- Jiang, S.-Y.; Ramamoorthy, R.; Ramachandran, S. Comparative transcriptional profiling and evolutionary analysis of the GRAM domain family in eukaryotes. Dev. Biol. 2008, 314, 418–432. [Google Scholar] [CrossRef] [Scilit]
- Baron, K.N.; Schroeder, D.F.; Stasolla, C. GEm-Related 5 (GER5), an ABA and stress-responsive GRAM domain protein regulating seed development and inflorescence architecture. Plant Sci. 2014, 223, 153–166. [Google Scholar] [CrossRef] [Scilit]
- Tognetti, V.B.; Van Aken, O.; Morreel, K.; Vandenbroucke, K.; Van De Cotte, B.; De Clercq, I.; Chiwocha, S.; Fenske, R.; Prinsen, E.; Boerjan, W. Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell 2010, 22, 2660–2679. [Google Scholar] [CrossRef] [Scilit]
- Vanderauwera, S.; Zimmermann, P.; Rombauts, S.; Vandenabeele, S.; Langebartels, C.; Gruissem, W.; Inzé, D.; Van Breusegem, F. Genome-wide analysis of hydrogen peroxide-regulated gene expression in Arabidopsis reveals a high light-induced transcriptional cluster involved in anthocyanin biosynthesis. Plant Physiol. 2005, 139, 806–821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehman, H.M.; Nawaz, M.A.; Shah, Z.H.; Ludwig-Müller, J.; Chung, G.; Ahmad, M.Q.; Yang, S.H.; Lee, S.I. Comparative genomic and transcriptomic analyses of Family-1 UDP glycosyltransferase in three Brassica species and Arabidopsis indicates stress-responsive regulation. Sci. Rep. 2018, 8, 1875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, S.-H.; Liu, S.-W.; Ma, J.-J.; Han, F.-X.; Li, Y.; Li, W. The transcriptional activity of a temperature-sensitive transcription factor module is associated with pollen shedding time in pine. Tree Physiol. 2019, 39, 1173–1186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Deng, Z.; Lai, J.; Zhang, Y.; Yang, C.; Yin, B.; Zhao, Q.; Zhang, L.; Li, Y.; Yang, C. Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 2009, 19, 1279–1290. [Google Scholar] [CrossRef] [Scilit]
- Dugas, D.V.; Monaco, M.K.; Olson, A.; Klein, R.R.; Kumari, S.; Ware, D.; Klein, P.E. Functional annotation of the transcriptome of Sorghum bicolor in response to osmotic stress and abscisic acid. BMC Genom. 2011, 12, 514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Lv, Z.; Liu, Y.; Li, L.; Zhang, L. Network analysis of ABA-dependent and ABA-independent drought responsive genes in Arabidopsis thaliana. Genet. Mol. Biol. 2018, 41, 624–637. [Google Scholar] [CrossRef] [Scilit]
- Fujita, Y.; Nakashima, K.; Yoshida, T.; Katagiri, T.; Kidokoro, S.; Kanamori, N.; Umezawa, T.; Fujita, M.; Maruyama, K.; Ishiyama, K. Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiol. 2009, 50, 2123–2132. [Google Scholar] [CrossRef] [Scilit]
- Haider, M.S.; Khan, N.; Pervaiz, T.; Zhongjie, L.; Nasim, M.; Jogaiah, S.; Mushtaq, N.; Jiu, S.; Jinggui, F. Genome-wide identification, evolution, and molecular characterization of the PP2C gene family in woodland strawberry. Gene 2019, 702, 27–35. [Google Scholar] [CrossRef] [Scilit]
- Ni, L.; Fu, X.; Zhang, H.; Li, X.; Cai, X.; Zhang, P.; Liu, L.; Wang, Q.; Sun, M.; Wang, Q.W.; et al. Abscisic Acid Inhibits Rice Protein Phosphatase PP45 via H(2)O(2) and Relieves Repression of the Ca(2+)/CaM-Dependent Protein Kinase DMI3. Plant Cell 2019, 31, 128–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carianopol, C.S.; Chan, A.L.; Dong, S.; Provart, N.J.; Lumba, S.; Gazzarrini, S. An abscisic acid-responsive protein interaction network for sucrose non-fermenting related kinase1 in abiotic stress response. Commun. Biol. 2020, 3, 145. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Liu, K.; Niu, X.; Wang, Q.; Wan, Y.; Yang, F.; Li, G.; Wang, Y.; Wang, R. Genome-wide Identification of PP2C Genes and Their Expression Profiling in Response to Drought and Cold Stresses in Medicago truncatula. Sci. Rep. 2018, 8, 12841. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Li, Q.; Jiang, L.; Kai, W.; Liang, B.; Wang, J.; Du, Y.; Zhai, X.; Sun, Y.; Zhang, L.; et al. Suppressing Type 2C Protein Phosphatases Alters Fruit Ripening and the Stress Response in Tomato. Plant Cell Physiol. 2018, 59, 142–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ng, L.M.; Melcher, K.; Teh, B.T.; Xu, H.E. Abscisic acid perception and signaling: Structural mechanisms and applications. Acta Pharmacol. Sin. 2014, 35, 567–584. [Google Scholar] [CrossRef] [Scilit]
- Hwang, S.-G.; Chen, H.-C.; Huang, W.-Y.; Chu, Y.-C.; Shii, C.-T.; Cheng, W.-H. Ectopic expression of rice OsNCED3 in Arabidopsis increases ABA level and alters leaf morphology. Plant Sci. 2010, 178, 12–22. [Google Scholar] [CrossRef] [Scilit]
- Marino, G.; Brunetti, C.; Tattini, M.; Romano, A.; Biasioli, F.; Tognetti, R.; Loreto, F.; Ferrini, F.; Centritto, M. Dissecting the role of isoprene and stress-related hormones (ABA and ethylene) in Populus nigra exposed to unequal root zone water stress. Tree Physiol. 2017, 37, 1637–1647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitao, M.; Lei, T.T.; Koike, T.; Kayama, M.; Tobita, H.; Maruyama, Y. Interaction of drought and elevated CO2 concentration on photosynthetic down-regulation and susceptibility to photoinhibition in Japanese white birch seedlings grown with limited N availability. Tree Physiol. 2007, 27, 727–735. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhang, H.; Wang, J.; Wu, X.; Ma, S.; Xu, Z.; Zhou, T.; Xu, N.; Tang, X.; An, B. Increased CO2 concentrations increasing water use efficiency and improvement PSII function of mulberry seedling leaves under drought stress. J. Plant Interact. 2019, 14, 213–223. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J. Bot. 2012, 2012, 217037. [Google Scholar] [CrossRef] [Scilit]
- Magwanga, R.O.; Kirungu, J.N.; Lu, P.; Cai, X.; Xu, Y.; Wang, X.; Zhou, Z.; Hou, Y.; Agong, S.G.; Wang, K. Knockdown of ghAlba_4 and ghAlba_5 proteins in cotton inhibits root growth and increases sensitivity to drought and salt stresses. Front. Plant Sci. 2019, 10, 1292. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, W.; Qiu, C.W.; Zhang, C.; Cao, F.; Shuijin, Z.; Wu, F. Comparative physiological analysis in the tolerance to salinity and drought individual and combination in two cotton genotypes with contrasting salt tolerance. Physiol. Plant. 2019, 165, 155–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McAdam, S.A.; Brodribb, T.J. Mesophyll cells are the main site of abscisic acid biosynthesis in water-stressed leaves. Plant Physiol. 2018, 177, 911–917. [Google Scholar] [CrossRef] [Scilit]
- Cominelli, E.; Galbiati, M.; Vavasseur, A.; Conti, L.; Sala, T.; Vuylsteke, M.; Leonhardt, N.; Dellaporta, S.L.; Tonelli, C. A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr. Biol. 2005, 15, 1196–1200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mittal, S.; Banduni, P.; Mallikarjuna, M.G.; Rao, A.R.; Jain, P.A.; Dash, P.K.; Thirunavukkarasu, N. Structural, functional, and evolutionary characterization of major drought transcription factors families in maize. Front. Chem. 2018, 6, 177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, M.; Guan, Y.; Ren, H.; Zhang, F.; Chen, F. A bZIP transcription factor, OsABI5, is involved in rice fertility and stress tolerance. Plant Mol. Biol. 2008, 66, 675–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakashima, K.; Ito, Y.; Yamaguchi-Shinozaki, K. Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol. 2009, 149, 88–95. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Li, L.; Aluru, M.; Aluru, S.; Yin, Y. Mechanisms and networks for brassinosteroid regulated gene expression. Curr. Opin. Plant Biol. 2013, 16, 545–553. [Google Scholar] [CrossRef] [Scilit]
- Xie, Z.; Nolan, T.M.; Jiang, H.; Yin, Y. AP2/ERF transcription factor regulatory networks in hormone and abiotic stress responses in Arabidopsis. Front. Plant Sci. 2019, 10, 228. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.-Y.; Kim, S.Y.; Kim, D.H.; Dong, T.; Park, Y.; Jin, J.B.; Joo, S.-H.; Kim, S.-K.; Hong, J.C.; Hwang, D. The Arabidopsis NAC transcription factor ANAC096 cooperates with bZIP-type transcription factors in dehydration and osmotic stress responses. Plant Cell 2013, 25, 4708–4724. [Google Scholar] [CrossRef] [Scilit]
- Jensen, M.K.; Lindemose, S.; De Masi, F.; Reimer, J.J.; Nielsen, M.; Perera, V.; Workman, C.T.; Turck, F.; Grant, M.R.; Mundy, J. ATAF1 transcription factor directly regulates abscisic acid biosynthetic gene NCED3 in Arabidopsis thaliana. FEBS Open Bio 2013, 3, 321–327. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Kim, Y.-S.; Kim, S.-G.; Jung, J.-H.; Woo, J.-C.; Park, C.-M. Integration of auxin and salt signals by the NAC transcription factor NTM2 during seed germination in Arabidopsis. Plant Physiol. 2011, 156, 537–549. [Google Scholar] [CrossRef] [Scilit]
- Tiwari, M.; Sharma, D.; Singh, M.; Tripathi, R.D.; Trivedi, P.K. Expression of OsMATE1 and OsMATE2 alters development, stress responses and pathogen susceptibility in Arabidopsis. Sci. Rep. 2014, 4, 3964. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Liu, J.; Xu, J.; Duan, S.; Wang, Q.; Li, G.; Jin, L. Transcriptome profiling reveals effects of drought stress on gene expression in diploid potato genotype P3-198. Int. J. Mol. Sci. 2019, 20, 852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, S.; Lim, C.W.; Lee, S.C. The pepper MAP kinase CaAIMK1 positively regulates ABA and drought stress responses. Front. Plant Sci. 2020, 11, 720. [Google Scholar] [CrossRef] [Scilit]
- Lim, C.W.; Baek, W.; Jung, J.; Kim, J.-H.; Lee, S.C. Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci. 2015, 16, 15251–15270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chinchilla, D.; Bauer, Z.; Regenass, M.; Boller, T.; Felix, G. The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 2006, 18, 465–476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Li, L.; Macho, A.P.; Han, Z.; Hu, Z.; Zipfel, C.; Zhou, J.-M.; Chai, J. Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex. Science 2013, 342, 624–628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, L.; Huang, S.-s.C.; Wise, A.; Castanon, R.; Nery, J.R.; Chen, H.; Watanabe, M.; Thomas, J.; Bar-Joseph, Z.; Ecker, J.R. A transcription factor hierarchy defines an environmental stress response network. Science 2016, 354. [Google Scholar] [CrossRef] [Scilit]
- Zheng, C.; Zhou, J.; Zhang, F.; Yin, J.; Zhou, G.; Li, Y.; Chen, F.; Xie, X. OsABAR1, a novel GRAM domain-containing protein, confers drought and salt tolerance via an ABA-dependent pathway in rice. Plant Physiol. Biochem. 2020, 152, 138–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, H.; Dai, M.; Yao, J.; Xiao, B.; Li, X.; Zhang, Q.; Xiong, L. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc. Natl. Acad. Sci. USA 2006, 103, 12987–12992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sutjit, C.; Nualsri, C.; Duangpan, S.; Nakkanong, K. Characterization of 9-cis-epoxycarotenoid dioxygenase3 gene from hevea brasiliensis and its expression responses by tissue type during drought stress. Pak. J. Biotechnol. 2019, 16, 175–182. [Google Scholar]
- Tuteja, N. Abscisic acid and abiotic stress signaling. Plant Signal. Behav. 2007, 2, 135–138. [Google Scholar] [CrossRef] [Scilit]
- Nuruzzaman, M.; Sharoni, A.M.; Kikuchi, S. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 2013, 4, 248. [Google Scholar] [CrossRef] [Scilit]
- Takasaki, H.; Maruyama, K.; Takahashi, F.; Fujita, M.; Yoshida, T.; Nakashima, K.; Myouga, F.; Toyooka, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K. SNAC-As, stress-responsive NAC transcription factors, mediate ABA-inducible leaf senescence. Plant J. 2015, 84, 1114–1123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, S.; Jiang, H.; Zhang, S.; Chen, L.; Li, X.; Korpelainen, H.; Li, C. Transcriptional profiling reveals sexual differences of the leaf transcriptomes in response to drought stress in Populus yunnanensis. Tree Physiol. 2012, 32, 1541–1555. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Q.; Ma, T.; Hu, Q.; Liu, B.; Wu, Y.; Zhou, H.; Wang, Q.; Wang, J.; Liu, J. Genome-scale transcriptome analysis of the desert poplar, Populus euphratica. Tree Physiol. 2011, 31, 452–461. [Google Scholar] [CrossRef] [Scilit]
- Pervaiz, T.; Haifeng, J.; Salman Haider, M.; Cheng, Z.; Cui, M.; Wang, M.; Cui, L.; Wang, X.; Fang, J. Transcriptomic analysis of grapevine (cv. Summer black) leaf, using the illumina platform. PLoS ONE 2016, 11, e0147369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [Scilit]
- Niu, S.H.; Li, Z.X.; Yuan, H.W.; Chen, X.Y.; Li, Y.; Li, W. Transcriptome characterisation of Pinus tabuliformis and evolution of genes in the Pinus phylogeny. BMC Genom. 2013, 14, 263. [Google Scholar] [CrossRef] [Scilit]
- Pimentel, H.; Bray, N.L.; Puente, S.; Melsted, P.; Pachter, L. Differential analysis of RNA-seq incorporating quantification uncertainty. Nat. Methods 2017, 14, 687–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheadle, C.; Vawter, M.P.; Freed, W.J.; Becker, K.G. Analysis of microarray data using Z score transformation. J. Mol. Diagn. 2003, 5, 73–81. [Google Scholar] [CrossRef] [Scilit]
- Chin, C.-H.; Chen, S.-H.; Wu, H.-H.; Ho, C.-W.; Ko, M.-T.; Lin, C.-Y. cytoHubba: Identifying hub objects and sub-networks from complex interactome. BMC Syst. Biol. 2014, 8, S11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harb, A.; Krishnan, A.; Ambavaram, M.M.; Pereira, A. Molecular and physiological analysis of drought stress in Arabidopsis reveals early responses leading to acclimation in plant growth. Plant Physiol. 2010, 154, 1254–1271. [Google Scholar] [CrossRef] [Scilit]









| S. No | Gene ID | Gene Function | Primer Sequence |
|---|---|---|---|
| 1 | Pita_unigene7805 | WRKY DNA-binding protein 35 (WRKY35) | GTAGAAACGAGGGAGGGGAG GCTGCCGGAATCTCTCAATG |
| 2 | Pita_unigene63359 | WRKY DNA-binding protein 57 | AGGTCGGTGAACAGAGAAGG CTGCCTGCTGTTCCGATAAC |
| 3 | Pita_unigene60666 | Encodes WRKY DNA-binding protein 21 (WRKY21). | GGTTGTGTGTGTGCTGTGAT GCTGCAGAATACAAGGAGGC |
| 4 | Pita_unigene44994 | GRAS family transcription factor | ACAGCTATAGTCTCGTGGGC CCGAAGCTGCTCAAGATCAC |
| 5 | Pita_unigene1868 | GRAS family transcription factor | ACGGTTCAAGAAAGGACCCA CCACCCAGTTGCAGAGAAAC |
| 6 | Pita_unigene39308 | MYB domain protein 79 | AGTGCCAGTGTCGATCTTGA CCCTTTCAATTGCCTGGCTT |
| 7 | Tubulin | Reference gene primer | GGCATACCGGCAGCTCTTC AAGTTGTTGGCGGCGTCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pervaiz, T.; Liu, S.-W.; Uddin, S.; Amjid, M.W.; Niu, S.-H.; Wu, H.X. The Transcriptional Landscape and Hub Genes Associated with Physiological Responses to Drought Stress in Pinus tabuliformis. Int. J. Mol. Sci. 2021, 22, 9604. https://doi.org/10.3390/ijms22179604
Pervaiz T, Liu S-W, Uddin S, Amjid MW, Niu S-H, Wu HX. The Transcriptional Landscape and Hub Genes Associated with Physiological Responses to Drought Stress in Pinus tabuliformis. International Journal of Molecular Sciences. 2021; 22(17):9604. https://doi.org/10.3390/ijms22179604
Chicago/Turabian StylePervaiz, Tariq, Shuang-Wei Liu, Saleem Uddin, Muhammad Waqas Amjid, Shi-Hui Niu, and Harry X. Wu. 2021. "The Transcriptional Landscape and Hub Genes Associated with Physiological Responses to Drought Stress in Pinus tabuliformis" International Journal of Molecular Sciences 22, no. 17: 9604. https://doi.org/10.3390/ijms22179604
APA StylePervaiz, T., Liu, S.-W., Uddin, S., Amjid, M. W., Niu, S.-H., & Wu, H. X. (2021). The Transcriptional Landscape and Hub Genes Associated with Physiological Responses to Drought Stress in Pinus tabuliformis. International Journal of Molecular Sciences, 22(17), 9604. https://doi.org/10.3390/ijms22179604

