Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat
Abstract
:1. Introduction
2. Results
2.1. Sequence Analysis
2.2. Deletion and Complementation of FgMFS1 Gene in F. graminearum
2.3. FgMFS1 Is Important for Fungal Response to SA
2.4. FgMFS1 Affects Pathogenicity towards Wheat
2.5. Expression of FgMFS1 Affects the Accumulation of Phytohormones in Spikes
3. Discussion
4. Materials and Methods
4.1. Materials and Growth Conditions
4.2. Nucleic Acid Extraction and Sequence Analysis
4.3. Preparation of ΔFgMFS1 and C-FgMFS1 Mutants
4.4. Subcellular Localization of FgMFS1
| Primer | Sequence (5′–3′) | Source |
|---|---|---|
| FgMFS1-LB-F | GCGGGCCCACGATGCCTCCACTG | This study |
| FgMFS1-LB -R | GCGAGCTCTTGCCAAGCCTCTAAT | This study |
| FgMFS1-RB-F | GGAAGCTTTAGAGCCGAGGCAGAG | This study |
| FgMFS1-RB -R | GGACTAGTCGACCAATCGCCAGTA | This study |
| P5 | GAGTTTCCGTCGGTGTC | This study |
| P6 | CCTACTACTGGGCTGCTT | This study |
| P7 | GCCTGGACGACTAAAC | This study |
| P8 | TTCAAGACCTTGTGCC | This study |
| R- FgMFS1-F | CGAGCTCTCCGTCCCTCTATAAACTCC | This study |
| R- FgMFS1-R | CCCAAGCTTCATGTGAATGATTGCCTTGT | This study |
| RJ- FgMFS1-F | CTGTCGCCCTTGTTTCA | This study |
| RJ- FgMFS1-R | AAGCCACCGTTCTCCTG | This study |
| Qpcr-FgMFS1-F | GCCAGATTGACCACGAC | This study |
| Qpcr-FgMFS1-R | AAAGGAGAAGCACGATAGG | This study |
| Fg-GAPDH-F | TGACTTGACTGTTCGCCTCGAGAA | [13] |
| Fg-GAPDH-R | ATGGAGGAGTTGGTGTTGCCGTTA | [13] |
| Fg-Factor 1-F | CCTCCAGGATGTCTACAAGA | [13] |
| Fg-Factor 1-R | CTCAACGGACTTGACTTCAG | [13] |
| S-FgMFS1-F | ATGAGCGATAACGATAATATCG | This study |
| S-FgMFS1-R | TGTGAATGATTGCCTTGTG | This study |
| Actin-F | ATTATATGTTTAGAGGTTGCTGCTTTGG | [45] |
| Actin-R | CAATTCGTTGTAGAAGGTATGATGCC | [45] |
| SY-FgMFS1-F | CTATAGGGCGAATTGGAGCTCATGAGCGATAACGATAATATCG | This study |
| SY-FgMFS1-R | TCCTTTACTCATTATGGATCCTGTGAATGATTGCCTTGTGTTG | This study |
| w-GAPDH-F | AACTGTTCATGCCATCACTGCCAC | [13] |
| w-GAPDH-R | AGGACATACCAGTGAGCTTGCCAT | [13] |
| hn-RNP-Q-F | TCACCTTCGCCAAGCTCAGAACTA | [13] |
| hn-RNP-Q-R | AGTTGAACTTGCCCGAAACATGCC | [13] |
| Aox-F | GACTTGTCATGGTAGATGCCTG | [13] |
| Aox-R | CAGGACGAGCATAACCATTCTC | [13] |
4.5. Gene Expression Analysis
4.6. Pathogenicity Assay
4.7. Expression of FgMFS1 in Yeast
4.8. Quantification of Phytohormones
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Goswami, R.S.; Kistler, H. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef]
- Koga, S.; Rieder, A.; Ballance, S.; Uhlen, A.K.; Veiseth-Kent, E. Gluten-degrading proteases in wheat infected by Fusarium graminearum—Protease identification and effects on gluten and dough properties. J. Agric. Food Chem. 2019, 67, 11025–11034. [Google Scholar] [CrossRef]
- Xu, X.; Berrie, A.M. Epidemiology of mycotoxigenic fungi associated with Fusarium ear blight and apple blue mould: A review. Food Addit. Contam. 2005, 22, 290–301. [Google Scholar] [CrossRef]
- Kang’Ethe, E.K.; Sirma, A.J.; Murithi, G.; Mburugu-Mosoti, C.K.; Ouko, E.O.; Korhonen, H.J.; Nduhiu, G.J.; Mungatu, J.K.; Joutsjoki, V.; Lindfors, E.; et al. Occurrence of mycotoxins in food, feed, and milk in two counties from different agro-ecological zones and with historical outbreak of aflatoxins and fumonisins poisonings in Kenya. Food Qual. Saf. 2017, 1, 161–170. [Google Scholar] [CrossRef] [Green Version]
- Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef] [PubMed]
- Ameye, M.; Audenaert, K.; De Zutter, N.; Steppe, K.; Van Meulebroek, L.; Vanhaecke, L.; De Vleesschauwer, D.; Haesaert, G.; Smagghe, G. Priming of wheat with the green leaf volatile Z-3-hexenyl acetate enhances defense against Fusarium graminearum but boosts deoxynivalenol production. Plant Physiol. 2015, 167, 1671–1684. [Google Scholar] [CrossRef] [Green Version]
- Lopinto, A.J.; Mohammed, H.O.; Ledbetter, E.C. Prevalence and risk factors for isolation of methicillin-resistant Staphylococcus in dogs with keratitis. Vet. Ophthalmol. 2014, 18, 297–303. [Google Scholar] [CrossRef]
- Bai, G.; Shaner, G. Management and resistance in wheat and barley to Fusarium head blight. Annu. Rev. Phytopathol. 2004, 42, 135–161. [Google Scholar] [CrossRef]
- Gilbert, J.; Tekauz, A. Review: Recent developments in research on fusarium head blight of wheat in Canada. Can. J. Plant Pathol. 2000, 22, 1–8. [Google Scholar] [CrossRef]
- Mesterhazy, A. Types and components of resistance to Fusarium head blight of wheat. Plant Breed. 1995, 114, 377–386. [Google Scholar] [CrossRef]
- Wang, J.R.; Wang, L.; Gulden, S.; Rocheleau, H.; Balcerzak, M.; Hattori, J.; Cao, W.; Han, F.; Zheng, Y.-L.; Fedak, G.; et al. RNA profiling of Fusarium head blight-resistant wheat addition lines containing the Thinopyrum elongatum chromosome 7E. Can. J. Plant Pathol. 2010, 32, 188–214. [Google Scholar] [CrossRef]
- Makandar, R.; Essig, J.S.; Schapaugh, M.A.; Trick, H.; Shah, J. Genetically engineered resistance to Fusarium head blight in wheat by expression of arabidopsis NPR1. Mol. Plant Microbe Interact. 2006, 19, 123–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qi, P.-F.; Johnston, A.; Balcerzak, M.; Rocheleau, H.; Harris, L.J.; Long, X.-Y.; Wei, Y.-M.; Zheng, Y.-L.; Ouellet, T. Effect of salicylic acid on Fusarium graminearum, the major causal agent of fusarium head blight in wheat. Fungal Biol. 2012, 116, 413–426. [Google Scholar] [CrossRef]
- Qi, P.-F.; Balcerzak, M.; Rocheleau, H.; Leung, W.; Wei, Y.-M.; Zheng, Y.-L.; Ouellet, T. Jasmonic acid and abscisic acid play important roles in host-pathogen interaction between Fusarium graminearum and wheat during the early stages of Fusarium head blight. Physiol. Mol. Plant Pathol. 2016, 93, 39–48. [Google Scholar] [CrossRef]
- Sorahinobar, M.; Niknam, V.; Ebrahimzadeh, H.; Soltanloo, H.; Behmanesh, M.; Enferadi, S.T. Central role of salicylic acid in resistance of wheat against Fusarium graminearum. J. Plant Growth Regul. 2015, 35, 477–491. [Google Scholar] [CrossRef]
- Zhang, Y.-Z.; Chen, Q.; Liu, C.-H.; Liu, Y.-B.; Yi, P.; Niu, K.-X.; Wang, Y.-Q.; Wang, A.-Q.; Yu, H.-Y.; Pu, Z.-E.; et al. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum. Fungal Biol. 2016, 120, 764–774. [Google Scholar] [CrossRef]
- Zhang, Y.-Z.; Wei, Z.-Z.; Liu, C.-H.; Chen, Q.; Xu, B.-J.; Guo, Z.-R.; Cao, Y.-L.; Wang, Y.; Han, Y.-N.; Chen, C.; et al. Linoleic acid isomerase gene FgLAI12 affects sensitivity to salicylic acid, mycelial growth and virulence of Fusarium graminearum. Sci. Rep. 2017, 7, 46129. [Google Scholar] [CrossRef] [Green Version]
- Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Zhu, J.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Zheng, T.; Jiang, Y.-F.; et al. Fusarium graminearum ATP-binding cassette transporter gene FgABCC9 is required for its transportation of salicylic acid, fungicide resistance, mycelial growth and pathogenicity towards wheat. Int. J. Mol. Sci. 2018, 19, 2351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Jiang, Y.-F.; Zheng, T.; Gong, X.; et al. Functional analysis of FgNahG clarifies the contribution of salicylic acid to wheat (Triticum aestivum) resistance against Fusarium head blight. Toxins 2019, 11, 59. [Google Scholar] [CrossRef] [Green Version]
- Rocheleau, H.; Al-Harthi, R.; Ouellet, T. Degradation of salicylic acid by Fusarium graminearum. Fungal Biol. 2019, 123, 77–86. [Google Scholar] [CrossRef]
- Zhang, Y.-Z.; Chen, Q.; Liu, C.-H.; Lei, L.; Li, Y.; Zhao, K.; Wei, M.-Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; et al. Fusarium graminearum FgCWM1 encodes a cell wall mannoprotein conferring sensitivity to salicylic acid and virulence to wheat. Toxins 2019, 11, 628. [Google Scholar] [CrossRef] [Green Version]
- Del Sorbo, G.; Schoonbeek, H.-J.; De Waard, M.A. Fungal transporters involved in efflux of natural toxic compounds and fungicides. Fungal Genet. Biol. 2000, 30, 1–15. [Google Scholar] [CrossRef]
- Poolman, B.; Konings, W.N. Secondary solute transport in bacteria. Biochim. Biophys. Acta Bioenerg. 1993, 1183, 5–39. [Google Scholar] [CrossRef] [Green Version]
- Ward, S.J.; Scopes, D.; Christodoulides, M.; Clarke, I.; Heckels, J.E. Expression of Neisseria meningitidis class 1 porin as a fusion protein in Escherichia colli: The influence of liposomes and adjuvants on the production of a bactericidal immune reesponse. Microb. Pathog. 1996, 21, 499–512. [Google Scholar] [CrossRef]
- Yan, N. Structural advances for the major facilitator superfamily (MFS) transporters. Trends Biochem. Sci. 2013, 38, 151–159. [Google Scholar] [CrossRef]
- Reddy, V.S.; Shlykov, M.A.; Castillo, R.; Sun, E.I., Jr. The major facilitator superfamily (MFS) revisited. FEBS J. 2012, 279, 2022–2035. [Google Scholar] [CrossRef]
- Yan, N. Structural biology of the major facilitator superfamily transporters. Annu. Rev. Biophys. 2015, 44, 257–283. [Google Scholar] [CrossRef]
- Alexander, N.J.; McCormick, S.; Waalwijk, C.; Van Der Lee, T.; Proctor, R.H. The genetic basis for 3-ADON and 15-ADON trichothecene chemotypes in Fusarium. Fungal Genet. Biol. 2011, 48, 485–495. [Google Scholar] [CrossRef] [Green Version]
- López-Errasquín, E.; González-Jaén, M.T.; Callejas, C.; Vázquez, C. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport. Mycol. Res. 2006, 110, 1102–1110. [Google Scholar] [CrossRef]
- Harris, L.J.; Balcerzak, M.; Johnston, A.; Schneiderman, D.; Ouellet, T. Host-preferential Fusarium graminearum gene expression during infection of wheat, barley, and maize. Fungal Biol. 2016, 120, 111–123. [Google Scholar] [CrossRef] [Green Version]
- Glaser, L.; Brown, D.H. The synthesis of chitin in cell-free extracts of Neurospora crassa. J. Biol. Chem. 1957, 228, 729–742. [Google Scholar] [CrossRef]
- Ichinomiya, M.; Yamada, E.; Yamashita, S.; Ohta, A.; Horiuchi, H. Class I and class II chitin synthases are involved in septum formation in the filamentous fungus Aspergillus nidulans. Eukaryot. Cell 2005, 4, 1125–1136. [Google Scholar] [CrossRef] [Green Version]
- Qi, P.-F.; Jiang, Y.-F.; Guo, Z.-R.; Chen, Q.; Ouellet, T.; Zong, L.-J.; Wei, Z.-Z.; Wang, Y.; Zhang, Y.-Z.; Xu, B.-J.; et al. Transcriptional reference map of hormone responses in wheat spikes. BMC Genom. 2019, 20, 390. [Google Scholar] [CrossRef]
- Makandar, R.; Nalam, V.; Chaturvedi, R.; Jeannotte, R.; Sparks, A.A.; Shah, J. Involvement of salicylate and jasmonate signaling pathways in Arabidopsis interaction with Fusarium graminearum. Mol. Plant Microbe Interact. 2010, 23, 861–870. [Google Scholar] [CrossRef] [Green Version]
- Cao, H.; Glazebrook, J.; Clarke, J.D.; Volko, S.; Dong, X. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 1997, 88, 57–63. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Wu, L.; Mei, Y.; Zhao, Y.; Ma, Z.; Zhang, X.; Chen, Y. Host-induced gene silencing of multiple genes of Fusarium graminearum enhances resistance to Fusarium head blight in wheat. Plant Biotechnol. J. 2020, 18, 2373–2375. [Google Scholar] [CrossRef]
- Cappellini, R.A.; Peterson, J.L. Macroconidium formation in submerged cultures by a non-sporulating strain of Gibberella zeae. Mycologia 1965, 57, 962. [Google Scholar] [CrossRef]
- Sá-Correia, I.; Tenreiro, S. The multidrug resistance transporters of the major facilitator superfamily, 6 years after disclosure of Saccharomyces cerevisiae genome sequence. J. Biotechnol. 2002, 98, 215–226. [Google Scholar] [CrossRef]
- Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [Green Version]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tamura, K.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Green Version]
- Frandsen, R.J.N.; Andersson, J.A.; Kristensen, M.B.; Giese, H. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Mol. Biol. 2008, 9, 70. [Google Scholar] [CrossRef] [Green Version]
- Maier, F.J.; Malz, S.; Lösch, A.P.; Lacour, T.; Schäfer, W. Development of a highly efficient gene targeting system for Fusarium graminearum using the disruption of a polyketide synthase gene as a visible marker. FEMS Yeast Res. 2005, 5, 653–662. [Google Scholar] [CrossRef] [Green Version]
- Teste, M.-A.; Duquenne, M.; François, J.M.; Parrou, J.-L. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol. Biol. 2009, 10, 99. [Google Scholar] [CrossRef] [Green Version]
- Miller, J.D.; Blackwell, B.A. Biosynthesis of 3-acetyldeoxynivalenol and other metabolites by Fusarium culmorum HLX 1503 in a stirred jar fermentor. Can. J. Bot. 1986, 64, 1–5. [Google Scholar] [CrossRef]
- Zha, Q.; Xi, X.; He, Y.; Jiang, A. Transcriptomic analysis of the leaves of two grapevine cultivars under high-temperature stress. Sci. Hortic. 2020, 265, 109265. [Google Scholar] [CrossRef]
- Tang, Q.-Y.; Zhang, C.-X. Data processing system (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2012, 20, 254–260. [Google Scholar] [CrossRef] [PubMed]







Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Lei, L.; Liu, C.; Zhang, Y.; Xu, Q.; Zhu, J.; Guo, Z.; Wang, Y.; Li, Q.; Li, Y.; et al. Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat. Int. J. Mol. Sci. 2021, 22, 8497. https://doi.org/10.3390/ijms22168497
Chen Q, Lei L, Liu C, Zhang Y, Xu Q, Zhu J, Guo Z, Wang Y, Li Q, Li Y, et al. Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat. International Journal of Molecular Sciences. 2021; 22(16):8497. https://doi.org/10.3390/ijms22168497
Chicago/Turabian StyleChen, Qing, Lu Lei, Caihong Liu, Yazhou Zhang, Qiang Xu, Jing Zhu, Zhenru Guo, Yan Wang, Qingcheng Li, Yang Li, and et al. 2021. "Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat" International Journal of Molecular Sciences 22, no. 16: 8497. https://doi.org/10.3390/ijms22168497
APA StyleChen, Q., Lei, L., Liu, C., Zhang, Y., Xu, Q., Zhu, J., Guo, Z., Wang, Y., Li, Q., Li, Y., Kong, L., Jiang, Y., Lan, X., Wang, J., Jiang, Q., Chen, G., Ma, J., Wei, Y., Zheng, Y., & Qi, P. (2021). Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat. International Journal of Molecular Sciences, 22(16), 8497. https://doi.org/10.3390/ijms22168497

