CD163 as a Potential Biomarker of Monocyte Activation in Ischemic Stroke Patients
Abstract
:1. Introduction
2. Results
2.1. CD163 and CD80 Expression in Peripheral Blood Monocytes
2.2. Cytokines Gene Expression
2.3. Correlation between the Percentage CD163+/CD16+ Events and Stroke Severity
3. Discussion
4. Materials and Methods
4.1. Patients and Sample Collection
4.2. Isolation of Peripheral Blood Mononuclear Cells (PBMCs)
4.3. Monocyte Isolation
4.4. Flow Cytometry Analysis
4.5. Gene Expression (rtPCR) in Monocytes
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Petry, G.; Boiziau, C.; Dousset, V.; Brochet, B. Magnetic resonance imaging of human brain macrophage infiltration. Neurotherapeutics 2007, 4, 434–442. [Google Scholar] [CrossRef]
- Chiba, T.; Umegaki, K. Pivotal roles of monocytes/macrophages in stroke. Mediat. Inflamm. 2013, 2013, 759103. [Google Scholar] [CrossRef]
- Zrzavy, T.; Machado-Santos, J.; Christine, S.; Baumgartner, C.; Weiner, H.L.; Butovsky, O.; Lassmann, H. Dominant role of microglial and macrophage innate immune responses in human ischemic infarcts. Brain Pathol. 2018, 28, 791–805. [Google Scholar] [CrossRef] [PubMed]
- Miró-Mur, F.; Pérez-de-Puig, I.; Ferrer-Ferrer, M.; Urra, X.; Justicia, C.; Chamorro, A.; Planas, A.M. Immature monocytes recruited to the ischemic mouse brain differentiate into macrophages with features of alternative activation. Brain Behav. Immun. 2016, 53, 18–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ziegler-Heitbrock, L.; Ancuta, P.; Crowe, S.; Dalod, M.; Grau, V.; Hart, D.N.; Leenen, P.J.; Liu, Y.J.; MacPherson, G.; Randolph, G.J.; et al. Nomenclature of monocytes and dendritic cells in blood. Blood 2010, 116, e74–e80. [Google Scholar] [CrossRef] [PubMed]
- Wong, K.L.; Tai, J.J.; Wong, W.C.; Han, H.; Sem, X.; Yeap, W.H.; Kourilsky, P.; Wong, S.C. Gene expression profiling reveals the defining features of the classical, intermediate, and nonclassical human monocyte subsets. Blood 2011, 118, e16–e31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gren, S.T.; Rasmussen, T.B.; Janciauskiene, S.; Håkansson, K.; Gerwien, J.G.; Grip, O. A Single-Cell Gene-Expression Profile Reveals Inter-Cellular Heterogeneity within Human Monocyte Subsets. PLoS ONE 2015, 10, e0144351. [Google Scholar] [CrossRef] [Green Version]
- Kapellos, T.S.; Bonaguro, L.; Gemünd, I.; Reusch, N.; Saglam, A.; Hinkley, E.R.; Schultze, J.L. Human Monocyte Subsets and Phenotypes in Major Chronic Inflammatory Diseases. Front. Immunol. 2019, 10, 2035. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merah-Mourah, F.S.; Cohen, S.O.; Charron, D.; Mooney, N.; Haziot, A. Identification of Novel Human Monocyte Subsets and Evidence for Phenotypic Groups Defined by Interindividual Variations of Expression of Adhesion Molecules. Sci. Rep. 2020, 10, 4397. [Google Scholar] [CrossRef]
- Zhao, M.; Tuo, H.; Wang, S.; Zhao, L. The Roles of Monocyte and Monocyte-Derived Macrophages in Common Brain Disorders. BioMed Res. Int. 2020, 2020, 9396021. [Google Scholar]
- Ren, H.; Han, L.; Liu, H.; Wang, L.; Liu, X.; Gao, Y. Decreased Lymphocyte-to-Monocyte Ratio Predicts Poor Prognosis of Acute Ischemic Stroke Treated with Thrombolysis. Med. Sci. Monit. 2017, 23, 5826–5833. [Google Scholar] [CrossRef] [Green Version]
- Liberale, L.; Montecucco, F.; Bonaventura, A.; Casetta, I.; Seraceni, S.; Trentini, A.; Padroni, M.; Dallegri, F.; Fainardi, E.; Carbone, F. Monocyte count at onset predicts poststroke outcomes during a 90-day follow-up. Eur. J. Clin. Investig. 2017, 47, 702–710. [Google Scholar] [CrossRef] [PubMed]
- Nadareishvili, Z.; Luby, M.; Leigh, R.; Shah, J.; Lynch, J.K.; Hsia, A.W.; Benson, R.T.; Latour, L.L. An MRI Hyperintense Acute Reperfusion Marker Is Related to Elevated Peripheral Monocyte Count in Acute Ischemic Stroke. J. Neuroimaging 2018, 28, 57–60. [Google Scholar] [CrossRef] [PubMed]
- Narasimhan, P.B.; Marcovecchio, P.; Hamers, A.A.J.; Hedrick, C.C. Nonclassical Monocytes in Health and Disease. Annu. Rev. Immunol. 2019, 37, 439–456. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Cheng, Y.; Song, Q.; Wei, C.; Liu, J.; Wu, B.; Liu, M. The association between monocyte to high-density lipoprotein ratio and hemorrhagic transformation in patients with acute ischemic stroke. Aging 2020, 12, 2498–2506. [Google Scholar] [CrossRef] [PubMed]
- Boyette, L.B.; Macedo, C.; Hadi, K.; Elinoff, B.D.; Walters, J.T.; Ramaswami, B.; Chalasani, G.; Taboas, J.M.; Lakkis, F.G.; Metes, D.M. Phenotype, function, and differentiation potential of human monocyte subsets. PLoS ONE 2017, 12, e0176460. [Google Scholar]
- Kaito, M.; Araya, S.; Gondo, Y.; Fujita, M.; Minato, N.; Nakanishi, M.; Matsui, M. Relevance of distinct monocyte subsets to clinical course of ischemic stroke patients. PLoS ONE 2013, 8, e69409. [Google Scholar] [CrossRef] [PubMed]
- Urra, X.; Cervera, A.; Obach, V.; Climent, N.; Planas, A.M.; Chamorro, A. Monocytes are major players in the prognosis and risk of infection after acute stroke. Stroke 2009, 40, 1262–1268. [Google Scholar] [CrossRef] [Green Version]
- Greco, R.; Demartini, C.; Zanaboni, A.; Tumelero, E.; Elisa, C.; Persico, A.; Morotti, A.; Amantea, D.; Tassorelli, C. Characterization of CB2 Receptor Expression in Peripheral Blood Monocytes of Acute Ischemic Stroke Patients. Transl. Stroke Res 2020, 12, 550–558. [Google Scholar] [CrossRef]
- Murdoch, C.; Tazzyman, S.; Webster, S.; Lewis, C.E. Expression of Tie-2 by human monocytes and their responses to angiopoietin-2. J. Immunol. 2007, 178, 7405–7411. [Google Scholar] [CrossRef] [Green Version]
- Skrzeczyńska-Moncznik, J.; Bzowska, M.; Loseke, S.; Grage-Griebenow, E.; Zembala, M.; Pryjma, J. Peripheral blood CD14high CD16+ monocytes are main producers of IL-10. Scand J. Immunol. 2008, 67, 152–159. [Google Scholar] [CrossRef] [PubMed]
- Berg, K.E.; Ljungcrantz, I.; Andersson, L.; Bryngelsson, C.; Hedblad, B.; Fredrikson, G.N.; Nilsson, J.; Björkbacka, H. Elevated CD14++CD16- monocytes predict cardiovascular events. Circ. Cardiovasc. Genet. 2012, 5, 122–131. [Google Scholar] [CrossRef] [Green Version]
- Orecchioni, M.; Ghosheh, Y.; Pramod, A.B.; Ley, K. Macrophage Polarization: Different Gene Signatures in M1(LPS+) vs. Classically and M2(LPS−) vs. Alternatively Activated Macrophages. Front. Immunol. 2019, 10, 1084. [Google Scholar] [CrossRef]
- Zhang, C.; Yang, M.; Ericsson, A.C. Function of Macrophages in Disease: Current Understanding on Molecular Mechanisms. Front. Immunol. 2021, 12, 620510. [Google Scholar] [CrossRef]
- Onofre, G.; Koláčková, M.; Jankovičová, K.; Krejsek, J. Scaverger receptor CD163 and its biological fucntions: Molecular characterization. Acta Med. 2009, 52, 57–61. [Google Scholar]
- Van Gorp, H.; Delputte, P.L.; Nauwynck, H.J. Scavenger receptor CD163, a Jack-ofall-trades and potential target for cell-directed therapy. Mol. Immunol. 2010, 47, 1650–1660. [Google Scholar] [CrossRef]
- Rajan, W.D.; Wojtas, B.; Gielniewski, B.; Miró-Mur, F.; Pedragosa, J.; Zawadzka, M.; Pilanc, P.; Planas, A.M.; Kaminska, B. Defining molecular identity and fates of CNS-border associated macrophages after ischemic stroke in rodents and humans. Neurobiol. Dis. 2020, 137, 104722. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, R.; Kanti Barman, P.; Kumar Thatoi, P.; Tripathy, R.; Kumar Das, B.; Ravindran, B. Non-Classical monocytes display inflammatory features: Validation in Sepsis and Systemic Lupus Erythematous. Sci. Rep. 2015, 5, 13886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, L.; Akahori, H.; Harari, E.; Smith, S.L.; Polavarapu, R.; Karmali, V.; Otsuka, F.; Gannon, R.L.; Braumann, R.E.; Dickinson, M.H.; et al. CD163+ macrophages promote angiogenesis and vascular permeability accompanied by inflammation in atherosclerosis. J. Clin. Investig. 2018, 128, 1106–1124. [Google Scholar] [CrossRef]
- Mohme, M.; Sauvigny, T.; Mader, M.M.; Schweingruber, N.; Maire, C.L.; Rünger, A.; Ricklefs, F.; Regelsberger, J.; Schmidt, N.O.; Westphal, M.; et al. Immune Characterization in Aneurysmal Subarachnoid Hemorrhage Reveals Distinct Monocytic Activation and Chemokine Patterns. Transl. Stroke Res. 2020, 11, 1348–1361. [Google Scholar] [CrossRef]
- Park, J.; Chang, J.Y.; Kim, J.Y.; Lee, J.E. Monocyte Transmodulation: The Next Novel Therapeutic Approach in Overcoming Ischemic Stroke? Front. Neurol. 2020, 11, 578003. [Google Scholar] [CrossRef]
- Zhang, S.R.; Phan, T.G.; Sobey, C.G. Targeting the Immune System for Ischemic Stroke. Trends Pharm. Sci. 2021, 42, 96–105. [Google Scholar] [CrossRef]
- Iadecola, C.; Buckwalter, M.S.; Anrather, J. Immune responses to stroke: Mechanisms, modulation, and therapeutic potential. J. Clin. Investig. 2020, 130, 2777–2788. [Google Scholar] [CrossRef]
- Etzerodt, A.; Moestrup, S.K. CD163 and inflammation: Biological, diagnostic, and therapeutic aspects. Antioxid Redox Signal. 2013, 18, 2352–2363. [Google Scholar] [CrossRef] [Green Version]
- Hudig, D.; Hunter, K.W.; Diamond, W.J.; Redelman, D. Properties of human blood monocytes. II. Monocytes from healthy adults are highly heterogeneous within and among individuals. Cytom. B Clin. Cytom. 2014, 86, 121–134. [Google Scholar] [CrossRef]
- Polfliet, M.M.; Fabriek, B.O.; Daniëls, W.P.; Dijkstra, C.D.; van den Berg, T.K. The rat macrophage scavenger receptor CD163: Expression, regulation and role in inflammatory mediator production. Immunobiology 2006, 211, 419–425. [Google Scholar] [CrossRef]
- Barros, M.H.; Hauck, F.; Dreyer, J.H.; Kempkes, B.; Niedobitek, G. Macrophage polarisation: An immunohistochemical approach for identifying M1 and M2 macrophages. PLoS ONE 2013, 8, e80908. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Philippidis, P.; Mason, J.C.; Evans, B.J.; Nadra, I.; Taylor, K.M.; Haskard, D.O.; Landis, R.C. Hemoglobin scavenger receptor CD163 mediates interleukin-10 release and heme oxygenase-1 synthesis: Antiinflammatory monocyte-macrophage responses in vitro, in resolving skin blisters in vivo, and after cardiopulmonary bypass surgery. Circ. Res. 2004, 94, 119–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferrarese, C.; Mascarucci, P.; Zoia, C.; Cavarretta, R.; Frigo, M.; Begni, B.; Sarinella, F.; Frattola, L.; De Simoni, M.G. Increased cytokine release from peripheral blood cells after acute stroke. J. Cereb. Blood Flow Metab. 1999, 19, 1004–1009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, X.; Tang, Y.; Xu, H.; Lit, L.; Walker, W.; Ashwood, P.; Gregg, J.P.; Sharp, F.R. Genomic profiles for human peripheral blood T cells, B cells, natural killer cells, monocytes, and polymorphonuclear cells: Comparisons to ischemic stroke, migraine, and Tourette syndrome. Genomics 2006, 87, 693–703. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Xu, H.; Du, X.; Lit, L.; Walker, W.; Lu, A.; Ran, R.; Gregg, J.P.; Reilly, M.; Pancioli, A.; et al. Gene expression in blood changes rapidly in neutrophils and monocytes after ischemic stroke in humans: A microarray study. J. Cereb. Blood Flow Metab. 2006, 26, 1089–1102. [Google Scholar] [CrossRef] [Green Version]
- Basic Kes, V.; Simundic, A.M.; Nikolac, N.; Topic, E.; Demarin, V. Pro-inflammatory and anti-inflammatory cytokines in acute ischemic stroke and their relation to early neurological deficit and stroke outcome. Clin. Biochem. 2008, 41, 1330–1334. [Google Scholar] [CrossRef] [PubMed]
- O’Connell, G.C.; Tennant, C.S.; Lucke-Wold, N.; Kabbani, Y.; Tarabishy, A.R.; Chantler, P.D.; Barr, T.L. Monocyte-lymphocyte cross-communication via soluble CD163 directly links innate immune system activation and adaptive immune system suppression following ischemic stroke. Sci. Rep. 2017, 7, 12940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nayak, A.R.; Kashyap, R.S.; Kabra, D.; Purohit, H.J.; Taori, G.M.; Daginawala, H.F. Time course of inflammatory cytokines in acute ischemic stroke patients and their relation to inter-alfa trypsin inhibitor heavy chain 4 and outcome. Ann. Indian Acad. Neurol. 2012, 15, 181–185. [Google Scholar]
- Perini, F.; Morra, M.; Alecci, M.; Galloni, E.; Marchi, M.; Toso, V. Temporal profile of serum anti-inflammatory and pro-inflammatory interleukins in acute ischemic stroke patients. Neurol. Sci. 2001, 22, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Licata, G.; Tuttolomondo, A.; Di Raimondo, D.; Corrao, S.; Di Sciacca, R.; Pinto, A. Immuno-inflammatory activation in acute cardio-embolic strokes in comparison with other subtypes of ischaemic stroke. Thromb. Haemost. 2009, 101, 929–937. [Google Scholar] [PubMed] [Green Version]
- Buechler, C.; Ritter, M.; Orsó, E.; Langmann, T.; Klucken, J.; Schmitz, G. Regulation of scavenger receptor CD163 expression in human monocytes and macrophages by pro- and antiinflammatory stimuli. J. Leukoc. Biol. 2000, 67, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Hamann, W.; Flöter, A.; Schmutzler, W.; Zwadlo-Klarwasser, G. Characterization of a novel anti-inflammatory factor produced by RM3/1 macrophages derived from glucocorticoid treated human monocytes. Inflamm. Res. 1995, 44, 535–540. [Google Scholar] [CrossRef] [PubMed]
- Huang, P.; Lo, L.H.; Chen, Y.C.; Lin, R.T.; Shiea, J.; Liu, C.K. Serum free hemoglobin as a novel potential biomarker for acute ischemic stroke. J. Neurol. 2009, 256, 625–631. [Google Scholar] [CrossRef]
- Holfelder, K.; Schittenhelm, J.; Trautmann, K.; Haybaeck, J.; Meyermann, R.; Beschorner, R. De novo expression of the hemoglobin scavenger receptor CD163 by activated microglia is not associated with hemorrhages in human brain lesions. Histol. Histopathol. 2011, 26, 1007–1017. [Google Scholar]
- Vila, N.; Castillo, J.; Dávalos, A.; Esteve, A.; Planas, A.M.; Chamorro, A. Levels of anti-inflammatory cytokines and neurological worsening in acute ischemic stroke. Stroke 2003, 34, 671–675. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Healthy Controls | Patients | p-Value | |
---|---|---|---|
Subjects (n) | 16 | 26 | |
Age (median with range) | 83 (94–46) | 77 (95–52) | 0.98 a |
Gender (F/M) | 12/16 | 16/26 | 0.07 b |
Hypertension (%) | 2/16 (12.5%) | 14/26 (53%) | |
Dyslipidemia (%) | 0 | 5/26 (19.2%) | |
Diabetes mellitus (%) | 0 | 6/26 (23%) | |
Obesity (%) | 0 | 6/26 (23%) | |
Smoking (%) | 0 | 6/26 (23%) | |
Alcohol abuse (%) | 0 | 1/26 (3.8%) | |
Drug abuse (%) | 0 | 1/26 (3.8%) | |
Prior stroke (%) | 0 | 3/26 (11.5%) | |
Thrombolysis (%) | 0 | 11/26 (42%) | |
Thrombectomy (%) | 0 | 10/26 (38.5%) | |
Thrombolysis and Thrombectomy (%) | 0 | 5/26 (19.2%) | |
NIHSS score (entrance) (median with range) | 0 | 5.5 (1–19) | |
NIHSS score (discharge) (median with range) | 0 | 1.5 (1–4) | |
mRS entrance (median with range) | 0 | 3 (0–5) | |
mRS discharge (median with range) | 0 | 2 (0–5) | |
TOAST | |||
Stroke of undetermined cause | 0 | 6/26 (26%) | |
Large artery atherosclerosis | 0 | 5/26 (19.2%) | |
Lacunar | 0 | 1/26 (3.8%) | |
Stroke of other determined cause | 0 | 7/26 (26.69%) | |
Cardioembolism | 0 | 7/26 (26.9%) |
Gene | Forward Primer | Reverse Primer |
---|---|---|
UBC | AGAGGCTGATCTTTGCTGGA | GTGGACTCTTTCTGGATG |
IL-1beta | CCTGAGCTCGCCAGTGAAAT | TCGTGCACATAAGCCTCGTT |
TNF-alpha | CACAGTGAAGTGCTGGCAAC | ACATTGGGTCCCCCAGGATA |
IL-4 | CGTCTTTAGCCTTTCCAAGAA | CGAGTTGACCGTAACAGA |
IL-10 | GTCATCGATTTCTTCCCTGTG | ACTCATGGCTTTGTAGATGCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Greco, R.; Demartini, C.; Zanaboni, A.M.; Tumelero, E.; Persico, A.; Candeloro, E.; Morotti, A.; Amantea, D.; Tassorelli, C. CD163 as a Potential Biomarker of Monocyte Activation in Ischemic Stroke Patients. Int. J. Mol. Sci. 2021, 22, 6712. https://doi.org/10.3390/ijms22136712
Greco R, Demartini C, Zanaboni AM, Tumelero E, Persico A, Candeloro E, Morotti A, Amantea D, Tassorelli C. CD163 as a Potential Biomarker of Monocyte Activation in Ischemic Stroke Patients. International Journal of Molecular Sciences. 2021; 22(13):6712. https://doi.org/10.3390/ijms22136712
Chicago/Turabian StyleGreco, Rosaria, Chiara Demartini, Anna Maria Zanaboni, Elena Tumelero, Alessandra Persico, Elisa Candeloro, Andrea Morotti, Diana Amantea, and Cristina Tassorelli. 2021. "CD163 as a Potential Biomarker of Monocyte Activation in Ischemic Stroke Patients" International Journal of Molecular Sciences 22, no. 13: 6712. https://doi.org/10.3390/ijms22136712
APA StyleGreco, R., Demartini, C., Zanaboni, A. M., Tumelero, E., Persico, A., Candeloro, E., Morotti, A., Amantea, D., & Tassorelli, C. (2021). CD163 as a Potential Biomarker of Monocyte Activation in Ischemic Stroke Patients. International Journal of Molecular Sciences, 22(13), 6712. https://doi.org/10.3390/ijms22136712