Transcriptome Expression Profiling in Response to Drought Stress in Paulownia australis
Abstract
:1. Introduction
2. Results and Discussion
2.1. Physiological Responses of Diploid and Tetraploid Paulownia to Drought Stress
2.2. Illumina Paired-End Sequencing and the De Novo Assembly of Paulownia
2.3. Annotation of the Paulownia Unigenes against the Public Databases
2.4. Functional Analysis of the Unigenes of Paulownia Leaves
2.5. Metabolic Pathway Analysis of Paulownia Leaf Transcripts
2.6. DEGs Related to Drought Response
2.7. qRT-PCR Verification of Genes Related to Drought Response in Paulownia Leaves
2.8. Discussion
3. Experimental Section
3.1. Materials
3.2. Physiological Responses of Diploid and Tetraploid Paulownia to Drought Stress
3.3. Construction of cDNA Libraries of Paulownia
3.4. Bioinformatic Analysis
3.5. Unigene Function Annotation
3.6. Unigene GO Classification
3.7. Protein CDS Prediction
3.8. Unigene Expression Difference Analysis
3.9. Gene Ontology Functional Enrichment Analysis for Differentially Expressed Genes
3.10. KEGG Pathway Analysis for DEGs
3.11. qRT-PCR Analysis of Potential Drought Response DEGs
4. Conclusions
Acknowledgments
Conflicts of Interest
- Author ContributionsY.D. analyzed the data and wrote the paper. G.F. conceived and designed the experiments. Z.Z. performed the experiments. M.D. contributed reagents and analysis tools.
References
- Simms, E.L. Defining tolerance as a norm of reaction. Evol. Ecol. 2000, 14, 563–570. [Google Scholar]
- Artlip, T.S.; Wisniewski, M.E. Induction of proteins in response to biotic and abiotic stresses. In Handbook of Plant and Crop Physiology; Pessarakli, M., Ed.; Marcel Dekker: New York, NY, USA, 2001. [Google Scholar]
- Madhava Rao, K.V. Introduction. In Physiology and Molecular Biology of Stress Tolerance in Plants; Madhava Rao, K.V., Raghavendra, A.S., Janardhan Reddy, K., Eds.; Springer: Dordrecht, The Nertherlands, 2006; pp. 1–14. [Google Scholar]
- Assmann, S.M.; Snyder, J.A.; Lee, Y.R.J. ABA-deficient (aba1) and ABA-insensitive (abi1-1 abi2-1) mutants of Arabidopsis have a wild-type stomatal response to humidity. Plant Cell Environ. 2000, 23, 387–395. [Google Scholar]
- Hirayama, T.; Shinozaki, K. Research on plant abiotic stress responses in the post-genome era: Past present and future. Plant J. 2010, 61, 1041–1052. [Google Scholar]
- Larcher, W. Physiological Plant Ecology; Springer: Berlin, Germany, 1995; pp. 48–55. [Google Scholar]
- Yokota, A.; Takahara, K.; Akashi, K. Water stress. In Physiology and Molecular Biology of Stress Tolerance in Plants; Madhava Rao, K.V., Raghavendra, A.S., Janardhan Reddy, K., Eds.; Springer: Dordrecht, The Nertherlands, 2006; pp. 15–40. [Google Scholar]
- Teraza, W.; Martinez, D.; Rengifo, E.; Herrera, A. Photosynthetic responses of the tropical snipy shrub Lycium nodosum (Solanaceae) to drought soil salinity and saline spray. Ann. Bot. 2013, 92, 757–765. [Google Scholar]
- Orcutt, D.M.; Nilsen, E.T. Salinity stress. In The Physiology of Plants under Stress; Wiley: New York, NY, USA, 2000; pp. 177–237. [Google Scholar]
- Mantri, N.; Patade, V.; Penna, S.; Ford, R.; Pang, E. Abiotic stress responses in plants: Present and future. In Abiotic Stress Responses in Plants: Metabolism, Productivity and Sustainability; Ahmad, P., Prasad, M.N.V., Eds.; Springer: New York, NY, USA, 2012. [Google Scholar]
- Padmanabhan, V.; Dias, D.M.; Newton, R.J. Expression analysis of a gene family in loblolly pine (Pinus taeda L) induced by water deficit stress. Plant Mol. Biol. 1997, 35, 801–807. [Google Scholar]
- Dubos, C.; Plomion, C. Identification of water-deficit responsive genes in maritime pine (Pinus pinaster Ait) roots. Plant Mol. Biol. 2003, 51, 249–262. [Google Scholar]
- Yang, C.P.; Wang, Y.C.; Liu, G.F.; Jiang, J. Study on gene expression of Tamarix under NaHCO3 stress using SSH technology. Yi Chuan Xue Bao 2004, 31, 926–933. (in Chinese). [Google Scholar]
- Gong, P.; Zhang, J.; Li, H.; Yang, C.; Zhang, C.; Zhang, X.; Khurram, Z.; Zhang, Y.; Wang, T.; Fei, Z.; et al. Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction and biochemical pathways in tomato. J. Exp. Bot. 2010, 61, 3563–3575. [Google Scholar]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 2007, 58, 221–227. [Google Scholar]
- Zhu, Z.; Chao, C.; Lu, X.; Xiong, Y. Taxonomy and distribution. In Paulownia in China: Cultivation and Utilization; The Asian Network for Biological Sciences and the International Development: Beijing, China, 1988; pp. 3–11. [Google Scholar]
- Lyons, A. Paulownia. In Agroforestry: Trees for Productive Farming; Race, D., Ed.; Agmedia; Victoria, Australia, 1993; pp. 149–154. [Google Scholar]
- Ates, S.; Ni, Y.A.M.; Tozluoglu, A. Characterization and evaluation of Paulownia elongota as a raw material for paper production. Afr. J. Biotechnol. 2008, 7, 4153–4158. [Google Scholar]
- Ipekci, Z.; Gozukirmizi, N. Direct somatic embryogenesis and synthetic seed production from Paulownia elongata. Plant Cell Rep. 2003, 22, 16–24. [Google Scholar]
- Tang, R.C.; Carpenter, S.B.; Wittwer, R.F.; Graves, D.H. Paulownia: A crop tree for wood products and reclamation of surface-mined land. South. J. Appl. For. 1980, 4, 19–24. [Google Scholar]
- Mou, H.Q.; Lu, J.; Zhu, S.F.; Lin, C.L.; Tian, G.Z.; Xu, X.; Zhao, W.J. Transcriptomic analysis of paulownia infected by paulownia witches’-broom phytoplasma. PLoS One 2013, 8, e77217. [Google Scholar]
- Zhang, X.S.; Liu, R.N.; Wang, Y.; Zhao, Z.; Fan, G.Q. Study on the physiological characteristic in tetraploid Paulownia under drought stress. J. Henan Agric. Univ. 2013, 47, 541–545. [Google Scholar]
- Iseli, C.; Jongeneel, C.V.; Bucher, P. ESTScan: A program for detecting evaluating and reconstructing potential coding regions in EST sequences. ISMB 1999, 99, 138–148. [Google Scholar]
- Yu, L.X.; Setter, T.L. Comparative transcriptional profiling of placenta and endosperm in developing maize kernels in response to water deficit. Plant Physiol. 2003, 131, 568–582. [Google Scholar]
- Setter, T.L.; Yan, J.; Warburton, M.; Ribaut, J.M.; Xu, Y.; Sawkins, M.; Buckler, E.S.; Zhang, Z.; Gore, M.A. Genetic association mapping identifies single nucleotide polymorphisms in genes that affect abscisic acid levels in maize floral tissues during drought. J. Exp. Bot. 2011, 62, 701–716. [Google Scholar]
- Nambara, E.; Marion-Poll, A. Abscisic acid biosynthesis and catabolism. Ann. Rev. Plant Biol. 2005, 56, 165–185. [Google Scholar]
- Kakumanu, A.; Ambavaram, M.M.; Klumas, C.; Krishnan, A.; Batlang, U.; Myers, E.; Grene, R.; Pereira, A. Effects of drought on gene expression in maize reproductive and leaf meristem tissue revealed by RNA-Seq. Plant Physiol. 2012, 160, 846–867. [Google Scholar]
- Xiang, L.; Li, Y.; Rolland, F.; van den Ende, W. Neutral invertase hexokinase and mitochondrial ROS homeostasis: Emerging links between sugar metabolism sugar signaling and ascorbate synthesis. Plant Signal. Behav. 2011, 6, 1567–1573. [Google Scholar]
- Bolouri-Moghaddam, M.R.; le Roy, K.; Xiang, L.; Rolland, F.; van den Ende, W. Sugar signalling and antioxidant network connections in plant cells. FEBS J. 2010, 277, 2022–2037. [Google Scholar]
- Hanson, J.; Smeekens, S. Sugar perception and signaling—An update. Curr. Opin. Plant Biol. 2009, 12, 562–567. [Google Scholar]
- Ruan, Y.L.; Jin, Y.; Yang, Y.J.; Li, G.J.; Boyer, J.S. Sugar input metabolism and signaling mediated by invertase: Roles in development yield potential and response to drought and heat. Mol. Plant 2010, 3, 942–955. [Google Scholar]
- Kushiro, T.; Okamoto, M.; Nakabayashi, K.; Yamagishi, K.; Kitamura, S.; Asami, T.; Hirai, N.; Koshiba, T.; Kamiya, Y.; Nambara, E. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8′-hydroxylases: Key enzymes in ABA catabolism. EMBO J. 2004, 23, 1647–1656. [Google Scholar]
- Umezawa, T.; Okamoto, M.; Kushiro, T.; Nambara, E.; Oono, Y.; Seki, M.; Kobayashi, M.; Koshiba, T.; Kamiya, Y.; Shinozaki, K. CYP707A3 a major ABA 8′-hydroxylase involved in dehydration and rehydration response in Arabidopsis thaliana. Plant J. 2006, 46, 171–182. [Google Scholar]
- Okamoto, M.; Kuwahara, A.; Seo, M.; Kushiro, T.; Asami, T.; Hirai, N.; Kamiya, Y.; Koshiba, T.; Nambara, E. CYP707A1 and CYP707A2 which encode abscisic acid 8′-hydroxylases are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiol. 2006, 141, 97–107. [Google Scholar]
- Boyer, G.L.; Zeevaart, J.A. Isolation and quantitation of β-d-glucopyranosyl abscisate from leaves of Xanthium and Spinach. Plant Physiol. 1982, 70, 227–231. [Google Scholar]
- Bray, E.A.; Zeevaart, J.A. The Compartmentation of abscisic acid and β-d-glucopyranosyl abscisate in mesophyll cells. Plant Physiol. 1985, 79, 719–722. [Google Scholar]
- Lee, K.H.; Piao, H.L.; Kim, H.Y.; Choi, S.M.; Jiang, F.; Hartung, W.; Hwang, I.; Kwak, J.M.; Lee, I.J.; Hwang, I. Activation of glucosidase via stress-induced polymerization rapidly increases active pools of abscisic acid. Cell 2006, 126, 1109–1120. [Google Scholar]
- Xu, Z.Y.; Lee, K.H.; Dong, T.; Jeong, J.C.; Jin, J.B.; Kanno, Y.; Kim, D.H.; Kim, S.Y.; Seo, M.; Bressan, R.A.; et al. A vacuolar beta-glucosidase homolog that possesses glucose-conjugated abscisic acid hydrolyzing activity plays an important role in osmotic stress responses in Arabidopsis. Plant Cell 2012, 24, 2184–2199. [Google Scholar]
- Lu, P.L.; Chen, N.Z.; An, R.; Su, Z.; Qi, B.S.; Ren, F.; Chen, J.; Wang, X.C. A novel droughtinducible gene ATAF1 encodes a NAC family protein that negatively regulates the expression of stress-responsive genes in Arabidopsis. Plant Mol. Biol. 2007, 63, 289–305. [Google Scholar]
- Bao, S.D. Agricultural Soil Analysis; China Agriculture Press: Beijing, China, 2000. [Google Scholar]
- An, Y.Y.; Liang, Z.C.; Han, R.L. Water use characteristics and drought adaption of three native shrubs in the loess plateau. Sci. Silvae Sin. 2011, 47, 8–15. [Google Scholar]
- Li, H. Principle and Technology of Plant Physiology and Biochemistry; Higher Education Press: Beijing, China, 2000. [Google Scholar]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar]
- Conesa, A.; Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Talon, M.; Robles, M. Blast2GO: A universal tool for annotation visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar]
- Ye, J.; Fang, L.; Zheng, H.; Zhang, Y.; Chen, J.; Zhang, Z.; Wang, J.; Li, S.; Li, R.; Bolund, L.; et al. WEGO: A web tool for plotting GO annotations. Nucleic Acids Res. 2006, 34, W293–W297. [Google Scholar]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar]
- Audic, S.; Claverie, J.M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986–995. [Google Scholar]
- Broberg, P. A comparative review of estimates of the proportion unchanged genes and the false discovery rate. BMC Bioinform. 2005, 6, 199. [Google Scholar]







| Statistics of data production | PA2 | PA4 | PA2T | PA4T |
|---|---|---|---|---|
| Number of clean reads | 65,271,332 | 66,045,998 | 67,261,140 | 66,439,124 |
| Total nucleotides (nt) | 5,874,419,880 | 5,944,139,820 | 6,053,502,600 | 5,979,521,160 |
| Q20 percentage (%) | 97.38% | 97.42% | 97.31% | 97.36% |
| N percentage | 0.00% | 0.00% | 0.00% | 0.00% |
| GC percentage (%) | 46.94% | 46.21% | 46.41% | 46.16% |
| Contigs | PA2 | PA4 | PA2T | PA4T |
| Number of contigs | 135,157 | 159,240 | 147,935 | 159,789 |
| Total nucleotides (nt) in contigs | 44,242,508 | 49,398,069 | 44,264,333 | 49,481,225 |
| Average length of contigs (nt) | 327 | 310 | 299 | 310 |
| Length of N50 (bp) | 555 | 472 | 447 | 477 |
| Unigenes | PA2 | PA4 | PA2T | PA4T |
| Number of unigenes | 78,254 | 93,351 | 86,152 | 97,980 |
| Total nucleotides (nt) in unigenes | 63,081,300 | 66,626,947 | 63,561,654 | 78,415,946 |
| Length of N50 (bp) | 1,425 | 1,243 | 1,285 | 1,413 |
| Average length of unigenes (bp) | 806 | 714 | 738 | 800 |
| All unigenes | ||||
| Number of all unigenes | 111,660 | |||
| Total nucleotides (nt) in all unigenes | 113,092,718 | |||
| Length of N50 (bp) | 1,667 | |||
| Average length of all unigenes (bp) | 1,013 | |||
| Ontology | Class | Number of DGEs |
|---|---|---|
| Biological process | biological adhesion | 2 |
| biological regulation | 252 | |
| carbon utilization | 5 | |
| cell proliferation | 4 | |
| cellular component organization or biogenesis | 179 | |
| cellular process | 562 | |
| death | 35 | |
| developmental process | 169 | |
| establishment of localization | 213 | |
| growth | 31 | |
| immune system process | 69 | |
| localization | 218 | |
| locomotion | 1 | |
| metabolic process | 583 | |
| multi-organism process | 137 | |
| multicellular organismal process | 169 | |
| Biological process | negative regulation of biological process | 50 |
| positive regulation of biological process | 43 | |
| regulation of biological process | 223 | |
| reproduction | 91 | |
| reproductive process | 90 | |
| response to stimulus | 379 | |
| signaling | 76 | |
| single-organism process | 217 | |
| Cellular component | cell | 637 |
| cell junction | 31 | |
| cell part | 637 | |
| extracellular matrix | 1 | |
| extracellular region | 132 | |
| macromolecular complex | 72 | |
| membrane | 362 | |
| membrane part | 129 | |
| membrane-enclosed lumen | 3 | |
| nucleoid | 1 | |
| organelle | 498 | |
| organelle part | 236 | |
| symplast | 31 | |
| Molecular function | antioxidant activity | 9 |
| binding | 375 | |
| catalytic activity | 490 | |
| electron carrier activity | 33 | |
| enzyme regulator activity | 8 | |
| molecular transducer activity | 11 | |
| nucleic acid binding transcription factor activity | 16 | |
| nutrient reservoir activity | 8 | |
| protein binding transcription factor activity | 2 | |
| receptor activity | 3 | |
| structural molecule activity | 5 | |
| transporter activity | 107 | |
| No. | Pathway | DEGs genes with pathway annotation | Pathway ID |
|---|---|---|---|
| 1 | Metabolic pathways | 46 (6.84%) | ko00710 |
| 2 | Biosynthesis of secondary metabolites | 282 (41.9%) | ko01100 |
| 3 | Carbon fixation in photosynthetic organisms | 26 (3.86%) | ko00910 |
| 4 | Endocytosis | 150 (22.29%) | ko01110 |
| 5 | Glycerophospholipid metabolism | 23 (3.42%) | ko00195 |
| 6 | Ether lipid metabolism | 28 (4.16%) | ko00630 |
| 7 | Plant hormone signal transduction | 15 (2.23%) | ko00904 |
| 8 | Phenylpropanoid biosynthesis | 18 (2.67%) | ko00250 |
| 9 | Plant-pathogen interaction | 20 (2.97%) | ko00030 |
| 10 | Starch and sucrose metabolism | 21 (3.12%) | ko00260 |
| 11 | Glyoxylate and dicarboxylate metabolism | 19 (2.82%) | ko00908 |
| 12 | Nitrogen metabolism | 13 (1.93%) | ko00944 |
| 13 | Photosynthesis | 31 (4.61%) | ko00940 |
| 14 | Glycine, serine and threonine metabolism | 16 (2.38%) | ko00945 |
| 15 | Pentose phosphate pathway | 10 (1.49%) | ko00905 |
| 16 | Pentose and glucuronate interconversions | 32 (4.75%) | ko00565 |
| 17 | Zeatin biosynthesis | 5 (0.74%) | ko00196 |
| 18 | Alanine, aspartate and glutamate metabolism | 20 (2.97%) | ko00040 |
| 19 | Stilbenoid, diarylheptanoid and gingerol biosynthesis | 5 (0.74%) | ko00943 |
| 20 | Spliceosome | 7 (1.04%) | ko00740 |
| 21 | Cyanoamino acid metabolism | 14 (2.08%) | ko00903 |
| 22 | Diterpenoid biosynthesis | 15 (2.23%) | ko00460 |
| 23 | Limonene and pinene degradation | 10 (1.49%) | ko00360 |
| 24 | Flavone and flavonol biosynthesis | 8 (1.19%) | ko00073 |
| 25 | Flavonoid biosynthesis | 7 (1.04%) | ko00920 |
| 26 | RNA transport | 11 (1.63%) | ko00906 |
| 27 | Ascorbate and aldarate metabolism | 12 (1.78%) | ko00941 |
| 28 | Carotenoid biosynthesis | 29 (4.31%) | ko00500 |
| 29 | Glycolysis/Gluconeogenesis | 2 (0.3%) | ko00942 |
| 30 | Amino sugar and nucleotide sugar metabolism | 34 (5.05%) | ko00564 |
| 31 | ABC transporters | 12 (1.78%) | ko00053 |
| 32 | Brassinosteroid biosynthesis | 35 (5.2%) | ko04144 |
| 33 | Arginine and proline metabolism | 4 (0.59%) | ko00591 |
| 34 | Phenylalanine metabolism | 5 (0.74%) | ko00909 |
| 35 | Galactose metabolism | 10 (1.49%) | ko00051 |
| 36 | Fructose and mannose metabolism | 2 (0.3%) | ko00902 |
| 37 | Purine metabolism | 10 (1.49%) | ko00052 |
| 38 | Oxidative phosphorylation | 10 (1.49%) | ko00330 |
| 39 | Pyrimidine metabolism | 3 (0.45%) | ko00960 |
| 40 | Cutin, suberin and wax biosynthesis | 2 (0.3%) | ko00603 |
| 41 | Circadian rhythm: plant | 3 (0.45%) | ko00950 |
| 42 | Protein processing in endoplasmic reticulum | 6 (0.89%) | ko00511 |
| 43 | Ribosome biogenesis in eukaryotes | 2 (0.3%) | ko00901 |
| 44 | Riboflavin metabolism | 6 (0.89%) | ko00350 |
| 45 | Sulfur metabolism | 2 (0.3%) | ko00966 |
| 46 | Pyruvate metabolism | 2 (0.3%) | ko00604 |
| 47 | Lysine degradation | 1 (0.15%) | ko00785 |
| 48 | Terpenoid backbone biosynthesis | 6 (0.89%) | ko00310 |
| 49 | Cysteine and methionine metabolism | 2 (0.3%) | ko00750 |
| 50 | Other glycan degradation | 5 (0.74%) | ko00600 |
| 51 | RNA polymerase | 3 (0.45%) | ko00130 |
| 52 | Tyrosine metabolism | 2 (0.3%) | ko00402 |
| 53 | RNA degradation | 10 (1.49%) | ko00520 |
| 54 | Peroxisome | 8 (1.19%) | ko04712 |
| 55 | Isoflavonoid biosynthesis | 2 (0.3%) | ko00670 |
| 56 | Sesquiterpenoid and triterpenoid biosynthesis | 10 (1.49%) | ko02010 |
| 57 | Photosynthesis; antenna proteins | 1 (0.15%) | ko03450 |
| 58 | Sphingolipid metabolism | 6 (0.89%) | ko00270 |
| 59 | Linoleic acid metabolism | 2 (0.3%) | ko00061 |
| 60 | alpha-Linolenic acid metabolism | 4 (0.59%) | ko00592 |
| 61 | Inositol phosphate metabolism | 4 (0.59%) | ko00480 |
| 62 | mRNA surveillance pathway | 6 (0.89%) | ko00900 |
| 63 | Glutathione metabolism | 3 (0.45%) | ko00400 |
| 64 | Glycosylphosphatidylinositol (GPI)-anchor biosynthesis | 3 (0.45%) | ko00563 |
| 65 | Porphyrin and chlorophyll metabolism | 2 (0.3%) | ko00531 |
| 66 | Tropane, piperidine and pyridine alkaloid biosynthesis | 3 (0.45%) | ko00860 |
| 67 | Phenylalanine, tyrosine and tryptophan biosynthesis | 1 (0.15%) | ko00760 |
| 68 | Isoquinoline alkaloid biosynthesis | 6 (0.89%) | ko03020 |
| 69 | Citrate cycle (tricarboxylic acid (TCA) cycle) | 5 (0.74%) | ko04146 |
| 70 | Glycerolipid metabolism | 31 (4.61%) | ko04075 |
| 71 | Ubiquinone and other terpenoid-quinone biosynthesis | 1 (0.15%) | ko00450 |
| 72 | beta-Alanine metabolism | 11 (1.63%) | ko00010 |
| 73 | Ubiquitin mediated proteolysis | 4 (0.59%) | ko00562 |
| 74 | Natural killer cell mediated cytotoxicity | 2 (0.3%) | ko03410 |
| 75 | Fatty acid biosynthesis | 3 (0.45%) | ko00410 |
| 76 | Glycosphingolipid biosynthesis: ganglio series | 2 (0.3%) | ko03030 |
| 77 | Anthocyanin biosynthesis | 9 (1.34%) | ko00190 |
| 78 | Glycosaminoglycan degradation | 1 (0.15%) | ko00770 |
| 79 | Fatty acid metabolism | 1 (0.15%) | ko00290 |
| 80 | Monoterpenoid biosynthesis | 9 (1.34%) | ko00240 |
| 81 | Glucosinolate biosynthesis | 2 (0.3%) | ko04650 |
| 82 | Benzoxazinoid biosynthesis | 7 (1.04%) | ko00620 |
| 83 | DNA replication | 1 (0.15%) | ko01040 |
| 84 | Indole alkaloid biosynthesis | 7 (1.04%) | ko03008 |
| 85 | Tryptophan metabolism | 3 (0.45%) | ko00020 |
| 86 | Valine, leucine and isoleucine degradation | 2 (0.3%) | ko00380 |
| 87 | One carbon pool by folate | 3 (0.45%) | ko00561 |
| 88 | Vitamin B6 metabolism | 31 (4.61%) | ko04626 |
| 89 | Glycosphingolipid biosynthesis: globo series | 1 (0.15%) | ko00650 |
| 90 | Base excision repair | 1 (0.15%) | ko03050 |
| 91 | Selenocompound metabolism | 6 (0.89%) | ko03018 |
| 92 | Lipoic acid metabolism | 9 (1.34%) | ko00230 |
| 93 | Pantothenate and CoA biosynthesis | 1 (0.15%) | ko00510 |
| 94 | N-Glycan biosynthesis | 2 (0.3%) | ko00280 |
| 95 | Biosynthesis of unsaturated fatty acids | 2 (0.3%) | ko00071 |
| 96 | Butanoate metabolism | 15 (2.23%) | ko03040 |
| 97 | Basal transcription factors | 1 (0.15%) | ko03022 |
| 98 | Non-homologous end-joining | 12 (1.78%) | ko03013 |
| 99 | Phosphatidylinositol signaling system | 4 (0.59%) | ko03015 |
| 100 | Nicotinate and nicotinamide metabolism | 1 (0.15%) | ko04070 |
| 101 | Ribosome | 7 (1.04%) | ko04141 |
| 102 | Proteasome | 3 (0.45%) | ko04120 |
| 103 | Valine, leucine and isoleucine biosynthesis | 1 (0.15%) | ko03010 |
| Potential gene function | Nr-ID | Size (bp) | Primer | Sequence |
|---|---|---|---|---|
| Ribulose bisphosphate carboxylase | gi|255582745|ref|XP_002532149.1| | 952 | CL10638.Contig1-f | AATACCTTCTCCGTCTCAAG |
| CL10638.Contig1-r | TCGTCCAATTCGTTCACC | |||
| mitogen-activated protein kinase kinase | gi|290784293|gb|ADD62693.1| | 217 | CL11655.Contig1-f | GCGGAGGATGGAGACTTC |
| CL11655.Contig1-r | AGTTCACCACAAGCACAC | |||
| laccase-14 | gi|359495139|ref|XP_002264394.2| | 988 | CL14171.Contig2-f | CCAACCAACCACATAGAAG |
| CL14171.Contig2-r | TTAACTACACGGCGGATG | |||
| Asparagine synthetase | gi|5915696|sp|O24661.3|ASNS_TRIVS | 2,370 | CL1834.Contig1-f | ATAAGGAGTTGAAGGAATGGC |
| CL1834.Contig1-r | ACTTGATGGCTCTGTCTG | |||
| alanine--glyoxylate aminotransferase 2 | gi|225434396|ref|XP_002270785.1| | 2,078 | CL1998.Contig8-f | ACAATAGCATCCACCACCTGAG |
| CL1998.Contig8-r | CCGCCGTCTTCCACTTCTTC | |||
| dehydrin | gi|157497151|gb|ABV58322.1| | 551 | CL3830.Contig3-f | CCACAACACAAGACCACCAAC |
| CL3830.Contig3-r | TCACTCCACCGCCACTCC | |||
| inositol oxygenase 1 | gi|225442398|ref|XP_002282395.1| | 899 | CL5837.Contig1-f | CTATACAGCAAGAGCAAGGTTCGG |
| CL5837.Contig1-r | TCCAAGCATCCAGCCATTTCAAG | |||
| carbonic anhydrase | gi|225452452|ref|XP_002277957.1| | 1,384 | CL5917.Contig2-f | TCCTCCTCCACTGACTTC |
| CL5917.Contig2-r | CTTCACCAATCCATCTCTAAC | |||
| flavonoid glycosyltransferase | gi|260279128|dbj|BAI44134.1| | 1,662 | CL7275.Contig5-f | TTCTTCGTTCTCCATCTTCATC |
| CL7275.Contig5-r | TGTTATCAGAGGCAGGTAGC | |||
| short chain alcohol dehydrogenase | gi|255565739|ref|XP_002523859.1| | 1,722 | CL9398.Contig3-f | AGGCGTAGGAACAAGGTATGG |
| CL9398.Contig3-r | CATTGGTGGTGGTGCTTCG | |||
| cytochrome P450 76A2 | gi|255539320|ref|XP_002510725.1| | 1,762 | Unigene1109-f | CTTCCTCAGTGTCAATCC |
| Unigene1109-r | TCGCAGAATATGTGTTGG | |||
| geraniol 10-hydroxylase | gi|300193870|gb|ADJ68324.1| | 1,796 | Unigene11285-f | ATGTCCACTTCTGATTCC |
| Unigene11285-r | GGTTCCATTCTTGATTCC | |||
| disease resistance response protein 206 | gi|225441531|ref|XP_002280791.1| | 864 | Unigene11643-f | AACCAACCACCAGTAGAAGC |
| Unigene11643-r | CCGAGTCCGAAGTGATTGC | |||
| photosystem I reaction center subunit X psaK | gi|325180223|emb|CCA14626.1| | 597 | Unigene4744-f | GCTCGCTGTGACTTCATTGG |
| Unigene4744-r | TGCCTTCCTGTTCGCTGA |
© 2014 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Dong, Y.; Fan, G.; Zhao, Z.; Deng, M. Transcriptome Expression Profiling in Response to Drought Stress in Paulownia australis. Int. J. Mol. Sci. 2014, 15, 4583-4607. https://doi.org/10.3390/ijms15034583
Dong Y, Fan G, Zhao Z, Deng M. Transcriptome Expression Profiling in Response to Drought Stress in Paulownia australis. International Journal of Molecular Sciences. 2014; 15(3):4583-4607. https://doi.org/10.3390/ijms15034583
Chicago/Turabian StyleDong, Yanpeng, Guoqiang Fan, Zhenli Zhao, and Minjie Deng. 2014. "Transcriptome Expression Profiling in Response to Drought Stress in Paulownia australis" International Journal of Molecular Sciences 15, no. 3: 4583-4607. https://doi.org/10.3390/ijms15034583
APA StyleDong, Y., Fan, G., Zhao, Z., & Deng, M. (2014). Transcriptome Expression Profiling in Response to Drought Stress in Paulownia australis. International Journal of Molecular Sciences, 15(3), 4583-4607. https://doi.org/10.3390/ijms15034583

